Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
World Academy of Sciences Journal
Join Editorial Board Propose a Special Issue
Print ISSN: 2632-2900 Online ISSN: 2632-2919
Journal Cover
September-October 2020 Volume 2 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-October 2020 Volume 2 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

ADAM3A deletion is associated with high‑risk features in acute lymphoblastic leukemia

  • Authors:
    • Jéssica Almeida Batista‑Gomes
    • Fernando Augusto Rodrigues Mello Jr
    • Michel Platini Caldas De Souza
    • Alayde Vieira Wanderley
    • Edivaldo Herculano Correa De Oliveira
    • André Salim Khayat
  • View Affiliations / Copyright

    Affiliations: Oncology Research Center, Federal University of Pará, Belém, Pará 66073‑000, Brazil, Cell Culture and Cytogenetic Laboratory, Evandro Chagas Institute, Ananindeua, Pará 67030‑000, Brazil, Octávio Lobo Children's Cancer Hospital, Belém, Pará 66063‑005, Brazil
    Copyright: © Batista‑Gomes et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 15
    |
    Published online on: June 19, 2020
       https://doi.org/10.3892/wasj.2020.56
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Acute lymphoblastic leukemia (ALL) is a malignant proliferation of lymphoid cells characterized as a heterogeneous disease at demographic, clinical and genetic levels. Copy number alterations (CNAs) are defined as secondary abnormalities subsequently required for the establishment of the leukemic clone. As the risk stratification of ALL is partly based on genetic analysis, different genomic tools are increasingly being used to screen for novel genetic biomarkers. In the present study, through array‑comparative genomic hybridization (aCGH), CNAs in 12 ADAM genes were investigated and their association with clinicopathological features in 16 pediatric ALL cases was evaluated. The most frequent amplification was found in ADAM6 (94%), and deletion was more common in ADAM3A (31%). ADAM3A deletion were associated with male patients (P=0.025), leukocytosis (P=0.007) and high‑risk cases (P=0.004). However, the effects of aberration on ADAM genes still needs to be fully defined in hematological malignancies, particularly in leukemia. The findings of the present study corroborate those of previous studies that suggest that ADAM genes play a role in carcinogenesis.

Introduction

Acute Lymphoblastic Leukemia (ALL) is characterized by primary and secondary genetic aberrations, which lead the initiation and progression of the leukemic clone (1,2). Primary abnormalities are often chromosomal translocations, whereas secondary abnormalities are usually copy number alterations (CNAs) and point mutations, which may be present in only a subset of leukemic cells (2).

Chromosomal abnormalities are used as biomarkers to provide subtype, outcome and therapeutic response information. The application of genomic tools either in cases with or without an established abnormality revels copy number alterations, which can be used alone or in combination as prognostic information (3).

Initially, the role of a disintegrin and metalloproteases (ADAMs) proteins was limited to the fusion of gametes; however, due to their adhesion properties in intercellular interactions, their involvement in tumor biology has also been suggested (4).

Members of the ADAM family are currently an object of considerable scientific attention, due to their role in numerous signaling pathways associated with carcinogenesis, such as phosphoinositide 3-kinase (PI3K), Notch and transforming growth factor (TGF)-β (5-7). Research concerning ADAMs often focuses on their role in carcinogenesis and as potential targets of novel anticancer therapies (8,9).

The properties of ADAMs mentioned above render them an important object of interest in cancer. Thus, the present study investigated CNAs in 12 different ADAM genes that have been implicated in carcinogenesis and associated their CNA status with the clinicopathological data of ALL pediatric patients. The findings of the present study demonstrate that the deletion of ADAM3A is significantly related to leukocytosis and high-risk cases.

Patients and methods

Patients

In the present study, 16 ALL pediatric patients (5±3 years old) treated at Octávio Lobo Children's Cancer Hospital were selected for ADAMs copy number investigation by array-comparative genomic hybridization (aCGH). The patients were classified by immunophenotyping and morphology. The phenotypic diagnosis was performed by flow cytometry at Octávio Lobo Children's Cancer Hospital, using peripheral blood and/or bone marrow samples and staining-lyse-wash protocols. The diagnosis for ALL includes an acute leukemia orientation cell line screening test: CyMPO/CD79a/CD45/CD3c; CD19/CD7/CD45/CD34; the following combinations were used to classify B-ALL: CD34/CD20/CD19/CD10; CyIgM/CD13/CD19/CD22; nTdt/CD33/CD19/CD38 and nTdt/CD7/CD3c/CD10; CD8/CD7/CD4/CD3s; CD2/CD1a/CD5/CD7 for T-ALL cases. Gene fusions were investigated through reverse transcription-polymerase chain reaction (RT-PCR). The blood samples were collected prior to cancer treatment between 2017 and 2019 (Table I).

Table I

Clinicopathological data.

Table I

Clinicopathological data.

CharacteristicaCGH (n=16)
Male:female8:8
Median age (years)6.5
Median WBC count (x109/l)73
Immunophenotypea 
     B-cell lineage16
     T-cell lineage 
Karyotypic alterations investigatedb 
     TCF3-PBX1 (n) 6
     BCR-ABL1 (n) 1
     MLL-AF4 (n) 
     ETV6-RUNX1 (n) 
NCI risk 
     High (n) 7
     Standard (n) 9
Deaths (%) 3
 81

[i] aData obtained by flow cytometry;

[ii] bdata obtained by RT-PCR. NCI, National Cancer International; WBC, white blood cell count. Patients at high risk were considered those with a WBC count >50x109 cells/µl, an age of ≤1 year, or an age of ≥10 years. Patients with standard risk were those with a WBC count ≤50x109 cells/µl, or an age between 1 and 10 years.

The age at diagnosis and white blood cell (WBC) count were the criteria for assigning the prognostic risk of ALL, according to the National Cancer Institute (NCI) (10): i) High-risk, WBC count >50x109 cells/µl, age ≤1 year, or age ≥10 years; and ii) standard risk, WBC count ≤50x109 cells/µl, or between 1 and 10 years of age. Cases with BCR-ABL1 or MLL-AF4 also were assigned to the NCI high-risk group. Written consent forms were obtained from all parents of the patients. The present study was approved by the Octávio Lobo Children's Hospital Ethics Committee (CAAE: 00905812.1.0000.00.18).

RT-PCR

Total RNA was extracted from blood samples using the RNeasy Mini kit (Qiagen GmbH). RT-PCR was performed using a High Capacity c-DNA Reverse Transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. Multiplex PCR was performed to identify the fused transcripts using the primers listed in Table II. The reactions were performed in a GeneAmp Thermal Cycler 2720 (Applied Biosystems; Thermo Fisher Scientific, Inc.).

Table II

Nucleotide sequence of RT-PCR primers.

Table II

Nucleotide sequence of RT-PCR primers.

GenesPrimers (5'-3')Size (bp)PositionExons
TCF3 CTACTCCCCGGATCACTCAA201086-110513
PBX1 AGGCTTCATTCTGTGGCAGT203893-39122
MLL CGCCCAAGTATCCCTGTAAA204071-40908
AF4 GAGCATGGATGACGTTCCTT201546-15658
BCR TCGCAGAACTCGCAACAGT191707-17251
ABL ACACCATTCCCCATTGTGAT20284-3033
ETV6 TCTCTCATCGGGAAGACCTG201191-12105
RUNX1 TGCGGTAGCATTTCTCAGC19619-6375
SIL TCCTACCCTGCAAACAGACC2073-921
TAL1 AGGCGGAGGATCTCATTCTT201250-12694

Briefly, 1 µl of 10 ng cDNA was added to 4.25 µl nuclease-free water (Ambion; Thermo Fisher Scientific, Inc.); with 6,25 µl of GoTaq Colorless Master Mix (Promega Corp.) and 0,5 µl of each primer. The following profile was used: Denaturation at 95˚C for 3 min, followed by 35 cycles of 94˚C for 2 min, 61˚C for 1 min and 70˚C for 2 min in each cycle. The final extension at 70˚C by 30 min was carried out to guarantee the complete elongation of all PCR products.

PCR products were viewed on agarose gel electrophoresis performed by 30 min at 100 V with 1% agarose gel in a TBE buffer (Tris-Borate-EDTA) stained with SYBR® Safe DNA Gel Stain (Life Technologies; Thermo Fisher Scientific, Inc.). The visualization of possible bands on the gel was performed using a Safe Imager 2.0 Blue Light Transiluminator (Invitrogen; Thermo Fisher Scientific, Inc.).

aCGH

Genomic DNA was extracted from peripheral blood by Pure Link Genomic DNA Mini kit (Invitrogen; Thermo Fisher Scientific, Inc.). aCGH was performed using Agilent 4x180k CGH + SNP microarray (Agilent Technologies, Inc.). Following DNA extraction, a restriction enzyme digestion step and labeling with fluorochrome cyanine 5 were performed using random primers and exo-Klenow fragment DNA polymerase. DNA control was labeled with fluorochrome cyanine 3. DNA samples from the patients and controls [controls were samples of human genomic DNA (male or female) used as reference sample, which were supplied with the Agilent aCGH kit] were combined and hybridized on the microarray. Data were analyzed using Agilent's CytoGenomics v5.0 software.

Statistical analysis

Statistical analysis for comparisons of the CNAs between subgroups and pathological features of the patients was performed using the Chi-squared test (two-sided) or Fisher's exact test, as appropriate. The analyses were performed using the PASW Statistics program. P-values <0.05 were considered to indicate statistically significant differences.

Results

All samples exhibited at least one aberration to one of the investigated ADAM genes (Table III). These genes are described in the literature as being associated with the carcinogenesis of numerous types of cancer. For the 12 genes investigated, only ADAM29 exhibited no changes. The most frequent aberrations were amplifications of ADAM6 (94%). Notably, ADAM3A was deleted in 31% of the samples whilst it was amplified in 31%. It is noteworthy that 8 of these gene alterations have not been previously associated with ALL (Table III).

Table III

Frequency of alterations in ADAM genes found in childhood ALL samples.

Table III

Frequency of alterations in ADAM genes found in childhood ALL samples.

GeneCytobandN (%)Aberration typeStudies concerning these genes in cancer (Refs.)
ADAM3Aa8p11.235 (31%)Amp(16,17)
  5 (31%)Del(12,14,19)
ADAM6a14q32.3315 (94%)Amp(33-36)
ADAM8a10q26.32 (12%)Amp(4b,39b,5)
ADAM9a8p11.221 (6%)Amp(4b)
ADAM1015q21.31 (6%)Del(11,14,38,40-45)
ADAM12a10q26.23 (19%)Amp(4,39b)
ADAM15a1q21.31 (6%)Amp(4,39b)
  1 (6%)Del 
ADAM172p25.11 (6%)Del(9,14,41-45)
ADAM22a7q21.121 (6%)Amp(8,4b,39b)
  1 (6%)Del 
ADAM288p21.21 (6%)Amp(14,46-50)
ADAM294q34.10Not detected(4,39b)
ADAM33a20p132 (12%)Amp(4,39b)

[i] aAlterations that have not been previously described in B-ALL;

[ii] breview by Zadka et al (4) and Mullooly et al (39). ALL, acute lymphoblastic leukemia; Del, deletion; Amp, amplification.

The occurrence of gene aberration according to the NCI risk group, sex, age and cytogenetic findings in at least 2 samples is presented in Table IV. Deletions involving ADAM3A were significantly associated with male patients (P=0.025), leukocytosis (P=0.007) and NCI-HR cases (P=0.004). We did not find significant results correlating any other genes (Table IV).

Table IV.

Frequency of specific gene deletion or amplification according to the clinicopathological data in at least 2 ALL samples.

Table IV.

Frequency of specific gene deletion or amplification according to the clinicopathological data in at least 2 ALL samples.

 ADAM6 amplificationADAM3A deletionADAM8 amplificationADAM12 amplificationADAM33 amplification
CharacteristicPresentAbsentPresentAbsentPresentAbsentPresentAbsentPresentAbsent
HR7052253407
SR8109090927
P-value0.3620.004d0.1750.0620.475
≤1 years of age1001010101
>1 to ≤10 years of age12149112211111
>10 years of age2011111112
P-value 1a0.7730.5110.7730.6710.763
P-value 2bNC0.3860.3860.3860.505
P-value 3c0.6840.5910.2570.2540.371
WBC >505023141405
WBC ≤50101381102929
P-value0.4820.9990.5400.9820.541
Leucopenia2002101111
Leucocytosis91551919010
P-value0.6400.4690.1810.31820.166
Leucocytosis91501919010
Normal4004041313
P-value0.5110.007d0.5110.4680.285
Leukopenia2002101111
Normal4004041313
P-valueNCNC0.2000.5400.540
Male7153263508
Female8008080826
P-value0.3010.025d0.4660.2000.466
CT+6116161625
CT-9045182709
P-value0.4370.3070.4660.6860.175

[i] HR, NCI high risk; SR, NCI standard risk; CT+, positive for any gene fusion; CT-, negative for all gene fusions; NC, not calculated.

[ii] aP-value derived from comparison between ≤1 year of age vs. >1 to ≤10 years of age;

[iii] bP-value derived from comparison between ≤1 year of age vs. >10 years of age;

[iv] cP-value derived from comparison between >1 to ≤10 years of age vs. >10 years of age;

[v] dP≤0.05, denotes statistically significant differences between groups with and without aberration.

A total of 5 patients (31%) were hyperdiploid. The majority of the detected chromosomal gains corresponded to trisomies, gain of chromosomes X, 6 and 3 were the most frequent. A hypodiploid patient with loss of chromosomes 2, 3, 9, 11, 12, 18, 19 and 20 was also identified (data not shown). However, no significant results were found associating any numerical chromosomal abnormalities.

Discussion

In the present study, the ADAM genes investigated exhibited a low frequency of CNAs, with the exception of the ADAM6 gene, which was amplified in 94% of the samples and ADAM3A (amplified in 31% and also deleted in 31% of cases) (Table III). This similar frequency between ADAM3A aberrations is probably due the intra- and inter-heterogeneity of malignant cells or the reduced sample size.

The ADAM protein family includes 29 members that are known to play an important role in the regulation of cell adhesion, the activation of oncogenic receptors (Notch and HER2), tumorigenesis, in cell migration and in the production of cytokines and growth factors; however, the specific functions of the majority of ADAM genes are not yet fully understood (11-13).

Concerning other members of ADAM family, overexpression of ADAM28 was found in lung and breast carcinomas, while loss of expression of ADAM23 was found in breast tumors (14). ADAM17 has been shown to be involved in EGFR regulation and their overexpression in astrocytes promotes an increase in cell proliferation and invasion (14).

ADAM3A is located at chromosome 8p11.23, the locus that exhibits a strong association with cancer (13). ADAM3A amplifications have been observed in squamous cell carcinoma of the conjunctiva and in a subtype of B-cell lymphoma (15,16). The amplification of genes located on 8p11.23 has been linked to tumor development and metastasis (17,18); however, in the present study, no significant clinicopathological association with ADAM3A amplification was found.

As regards deletions of ADAM3A, these have been previously identified in high-grade gliomas, cribriform neuroepithelial tumors and extranodal NK/T cell lymphoma of the nasal type (12,14,19). Dun et al (20) found frequent 8p11.23 deletion as secondary genetic abnormalities in cases ETV6-RUNX1-positive leukemia. However, to the best of our knowledge, the present study is the first to describe ADAM3A deletion in leukemia. It is important to note that all samples with ADAM3A deletion investigated herein were negative for the gene fusions ETV6-RUNX1, BCR-ABL1, MLL-AF4 or TCF3-PBX1 (Table I).

Furthermore, deletions on the short arm of chromosome 8 (8p) are common in different tumor types (20-24), suggesting that tumor suppressor genes on 8p are frequently co-deleted reinforcing the functional role of those genes in carcinogenesis (24).

In the present study, the deletion of ADAM3A was associated with high-risk cases (NCI-risk) and leukocytosis. This finding is consistent with the observation that CNAs in 8p11 (both amplification and deletion) are commonly associated with a more aggressive tumor phenotype (24), which is the case for high-risk ALL patients.

Of note, ADAM3A deletion also exhibited an association with male patients. These results indicate a potential sex-specific association between ADAM3A deletion in the study population of the present study. One explanation could be the fact that males are generally more exposed to carcinogenesis than females (25). However, the exact reasons for this apparent sex-specific association and the risk of leukemia cannot be fully explained.

Leukocytosis typically occurs in response to hematological malignancies and inflammation, among others conditions (25,26). Among the mechanisms that connect inflammation to cancer are intrinsic factors, which include acquired genetic alterations affecting oncogenes, tumor suppressors and genome stability genes that contribute to the activation of the inflammatory pathways (26,27). Several molecular and cellular signaling pathways have been identified as links between inflammatory processes and cancer development (27,28).

Moreover, in different types of cancer, the inflammatory process often determines the development of a tumor and has an impact on the course and prognosis of the disease (28,29). Elevated levels of certain metalloproteinases have been reported in some types of inflammatory responses (29,30). ADAM proteins are expressed among others, by human lymphocytes, and they can interact with adhesion proteins located on the surface of other leukocytes (30,31).

The capacity of certain ADAMs to differentiate immunologically competent cells suggests that they play an important role in immunological processes (31,32). Dendritic cells, B cells and monocyte subpopulations also express these proteins, which indicates the important roles of ADAMs in cancer prognosis (4,32,33).

Thus, it was hypothesized that ADAM3A may act as a tumor suppressor in ALL. It was suggested that ADAM3A deletion, alone or combined with other tumor suppressor genes in this genomic region, plays an important role in leukemic transformation, contributing to the activation of inflammatory pathways.

There are few studies available regarding the role of ADAM6 in cancer; however, they demonstrate a potential association in cancer development, similar to the other members of the ADAM family (34-37).

Studies in vitro on different types of tumor cells (6,38-40) have demonstrated that the biological function of ADAM10 can be cell type-specific, that is, depending on the substrate activated by this gene.

Liu and Chang (41) demonstrated that the protease PILP-1-induced death of leukemia cells was mediated through the downregulation of ADAM17 and the subsequent inactivation of Lyn and Akt. Several studies have focused on the importance of ADAM17 upregulation in tumor malignancy (42-44). Thus, based on these studies, the suppression of ADAM17 protein expression may have potential for cancer therapy.

ADAM28 is overexpressed in several cancer types and is related to cell proliferation and lymph node metastasis (45-48). The overexpression of ADAM28 is asscoiated with relapse and is potentially regulated by the PI3K/Akt pathway, suggesting that ADAM28 may be a novel biomarker for evaluating relapse in B-ALL and as a potential therapeutic target in B-ALL patients (49).

In B-CLL culture, ADAM28 knockdown has been shown to decrease the release of CD200 (a membrane glycoprotein of the immunoglobulin superfamily), indicating that ADAM28 plays a role in the shedding of CD200 from B-cell CLL cells (50).

In conclusion, the present study reinforces that aCGH allows the identification of novel genes associated with cancer and emphasizes the need for including the investigation of submicroscopic aberrations as additional markers for risk stratification. Through this technique, recurrent aberrations in ADAM genes were identified in the present study, particularly in ADAM3A and ADAM6, suggesting that these genes may have important functions in carcinogenesis. Thereby, ADAM3A deletion can be related to leukemic process in patients with high-risk characteristics. Although the sample size was limited, the results of the present study should be considered, taking into account that the associations observed were concordant with those of previous studies mentioned above. There is substantial evidence supporting the involvement of ADAMs in cancer formation or progression. Thus, the effects of the aberration on these genes need to be fully defined in hematological malignancies, particularly in leukemia.

Acknowledgements

The authors acknowledge all patients who participated in the present study, and the Federal University of Pará, Evandro Chagas Institute for providing technical support and Coordination for Enhancement of Higher Education Personnel (CAPES) for fellowship support (Code 001).

Funding

The present study was partially funded by the Amazon Foundation for Support of Studies and Research of State of Para (FAPESPA), grant no. PPSUS/2013.

Availability of data and materials

The data and material that support the findings of this study are available from the corresponding author upon reasonable request.

Authors' contributions

JABG was involved in the conceptualization and methodology of the study, and in the investigation, writing and preparation of the original draft, and visualization. FARMJr was involved the methodology and investigative aspects of the study. MPCDS was involved in the study methodology. AVW and EHCDO were involved in providing resources, study methodology and visualization. ASK was involved in the conceptualization of the study, study supervision and visualization, and in the writing, reviewing and editing of the manuscript. All authors reviewed and approved the final manuscript.

Ethics approval and consent to participate

The Octávio Lobo Children's Cancer Hospital Ethics Committee approved the present study (CAAE: 00905812.1.0000.00.18). The parents of the patients provided consent to participate in the study by signing a Consent Form allowing the use of biological samples and clinical data.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Hunger SP and Mullighan CG: Acute lymphoblastic leukemia in children. N Engl J Med. 373:1541–1552. 2015.PubMed/NCBI View Article : Google Scholar

2 

Anderson K, Lutz C, van Delft FW, Bateman CM, Guo Y, Colman SM, Kempski H, Moorman AV, Titley I, Swansbury J, et al: Genetic variegation of clonal architecture and propagating cells in leukaemia. Nature. 469:356–361. 2011.PubMed/NCBI View Article : Google Scholar

3 

Moorman AV: New and emerging prognostic and predictive genetic biomarkers in B-cell precursor acute lymphoblastic leukemia. Haematologica. 101:407–416. 2016.PubMed/NCBI View Article : Google Scholar

4 

Zadka L, Kulus MJ and Piatek K: ADAM protein family-its role in tumorigenesis, mechanisms of chemoresistance and potential as diagnostic and prognostic factors. Neoplasma. 65:823–839. 2018.PubMed/NCBI View Article : Google Scholar

5 

Dong F, Eibach M, Bartsch JW, Dolga AM, Schlomann U, Conrad C, Schieber S, Schilling O, Biniossek ML, Culmsee C, et al: The metalloprotease-disintegrin ADAM8 contributes to temozolomide chemoresistance and enhanced invasiveness of human glioblastoma cells. Neuro Oncol. 17:1474–1485. 2015.PubMed/NCBI View Article : Google Scholar

6 

Mullooly M, McGowan PM, Kennedy SA, Madden SF, Crown J, O' Donovan N and Duffy MJ: ADAM10: A new player in breast cancer progression? Br J Cancer. 113:945–951. 2015.PubMed/NCBI View Article : Google Scholar

7 

Richards FM, Tape CJ, Jodrell DI and Murphy G: Anti-tumor effects of a specific anti-ADAM17 antibody in an ovarian cancer model in vivo. PLoS One. 7(e40597)2012.PubMed/NCBI View Article : Google Scholar

8 

Bolger JC and Young LS: ADAM22 as a prognostic and therapeutic drug target in the treatment of endocrine-resistant breast cancer. Vitam Horm. 93:307–321. 2013.PubMed/NCBI View Article : Google Scholar

9 

Saftig P and Reiss K: The ‘a disintegrin and metalloproteases’ ADAM10 and ADAM17: Novel drug targets with therapeutic potential? Eur J Cell Biol. 90:527–535. 2011.PubMed/NCBI View Article : Google Scholar

10 

Smith M, Arthur D, Camitta B, Carroll AJ, Crist W, Gaynon P, Gelber R, Heerema N, Korn EL, Link M, et al: Uniform approach to risk classification and treatment assignment for children with acute lymphoblastic leukemia. J Clin Oncol. 14:18–24. 1996.PubMed/NCBI View Article : Google Scholar

11 

Schwarz J, Schmidt S, Will O, Koudelka T, Köhler K, Boss M, Rabe B, Tholey A, Scheller J, Schmidt-Arras D, et al: Polo-like kinase 2, a novel ADAM17 signaling component, regulates tumor necrosis factor α ectodomain shedding. J Biol Chem. 289:3080–3093. 2014.PubMed/NCBI View Article : Google Scholar

12 

Gessi M, Japp AS, Dreschmann V, Zur Mühlen A, Goschzik T, Dörner E and Pietsch T: High-resolution genomic analysis of cribriform neuroepithelial tumors of the central nervous system. J Neuropathol Exp Neurol. 74:970–974. 2015.PubMed/NCBI View Article : Google Scholar

13 

You B, Gu M, Cao X, Li X, Shi S, Shan Y and You Y: Clinical significance of ADAM10 expression in laryngeal carcinoma. Oncol Lett. 13:1353–1359. 2017.PubMed/NCBI View Article : Google Scholar

14 

Barrow J, Adamowicz-Brice M, Cartmill M, MacArthur D, Lowe J, Robson K, Brundler MA, Walker DA, Coyle B and Grundy R: Homozygous loss of ADAM3A revealed by genome-wide analysis of pediatric high-grade glioma and diffuse intrinsic pontine gliomas. Neuro Oncol. 13:212–222. 2011.PubMed/NCBI View Article : Google Scholar

15 

Liu Z, Piao L, Zhuang M, Qiu X, Xu X, Zhang D, Liu M and Ren D: Silencing of histone methyltransferase NSD3 reduces cell viability in osteosarcoma with induction of apoptosis. Oncol Rep. 38:2796–2802. 2017.PubMed/NCBI View Article : Google Scholar

16 

Asnaghi L, Alkatan H, Mahale A, Othman M, Alwadani S, Al-Hussain H, Jastaneiah S, Yu W, Maktabi A, Edward DP and Eberhart CG: Identification of multiple DNA copy number alterations including frequent 8p11.22 amplification in conjunctival squamous cell carcinoma. Invest Ophthalmol Vis Sci. 55:8604–8613. 2014.PubMed/NCBI View Article : Google Scholar

17 

Flossbach L, Holzmann K, Mattfeldt T, Buck M, Lanz K, Held M, Möller P and Barth TF: High-resolution genomic profiling reveals clonal evolution and competition in gastrointestinal marginal zone B-cell lymphoma and its large cell variant. Int J Cancer. 132:E116–E127. 2013.PubMed/NCBI View Article : Google Scholar

18 

Saloura V, Vougiouklakis T, Zewde M, Kiyotani K, Park JH, Gao G, Karrison T, Lingen M, Nakamura Y and Hamamoto R: WHSC1L1 drives cell cycle progression through transcriptional regulation of CDC6 and CDK2 in squamous cell carcinoma of the head and neck. Oncotarget. 7:42527–42538. 2016.PubMed/NCBI View Article : Google Scholar

19 

Sun L, Li M, Huang X, Xu J, Gao Z and Liu C: High-resolution genome-wide analysis identified recurrent genetic alterations in NK/T-cell lymphoma, nasal type, which are associated with disease progression. Med Oncol. 31(71)2014.PubMed/NCBI View Article : Google Scholar

20 

Dun KA, Vanhaeften R, Batt TJ, Riley LA, Diano G and Williamson J: BCR-ABL1 gene rearrangement as a subclonal change in ETV6-RUNX1-positive B-cell acute lymphoblastic leukemia. Blood Adv. 1:132–138. 2016.PubMed/NCBI View Article : Google Scholar

21 

Cai Y, Crowther J, Pastor T, Abbasi Asbagh L, Baietti MF, De Troyer M, Vazquez I, Talebi A, Renzi F, Dehairs J, et al: Loss of chromosome 8p governs tumor progression and drug response by altering lipid metabolism. Cancer Cell. 29:751–766. 2016.PubMed/NCBI View Article : Google Scholar

22 

Kluth M, Amschler NN, Galal R, Möller-Koop C, Barrow P, Tsourlakis MC, Jacobsen F, Hinsch A, Wittmer C, Steurer S, et al: Deletion of 8p is an independent prognostic parameter in prostate cancer. Oncotarget. 8:379–392. 2017.PubMed/NCBI View Article : Google Scholar

23 

Lebok P, Mittenzwei A, Kluth M, Özden C, Taskin B, Hussein K, Möller K, Hartmann A, Lebeau A, Witzel I, et al: 8p deletion is strongly linked to poor prognosis in breast cancer. Cancer Biol Ther. 16:1080–1087. 2015.PubMed/NCBI View Article : Google Scholar

24 

Moelans CB, van Maldegem CMG, van der Wall E and van Diest PJ: Copy number changes at 8p11-12 predict adverse clinical outcome and chemo- and radiotherapy response in breast cancer. Oncotarget. 9:17078–17092. 2018.PubMed/NCBI View Article : Google Scholar

25 

Kadekar S, Peddada S, Silins I, French JE, Högberg J and Stenius U: Gender differences in chemical carcinogenesis in national toxicology program 2-year bioassays. Toxicol Pathol. 40:1160–1168. 2012.PubMed/NCBI View Article : Google Scholar

26 

Bonilla MA and Menell JS: Disorders of white blood cells. In: Lanzkowsky's manual of pediatric hematology and oncology. 6th edition. Lanzkowsky P, Lipton JL and Fish JD (eds). Academic Press. pp209–238. 2016.

27 

Krawczyk J, O'Dwyer M, Swords R, Freeman C and Giles FJ: The role of inflammation in leukaemia. In: Inflammation and cancer. Advances in Experimental Medicine and Biology. Vol 816:Springer, Basel. 2014.PubMed/NCBI View Article : Google Scholar

28 

Aggarwal BB and Gehlot P: Inflammation and cancer: How friendly is the relationship for cancer patients? Curr Opin Pharmacol. 9:351–369. 2009.PubMed/NCBI View Article : Google Scholar

29 

Dubey S, Vanveldhuizen P, Holzbeierlein J, Tawfik O, Thrasher JB and Karan D: Inflammation-associated regulation of the macrophage inhibitory cytokine (MIC-1) gene in prostate cancer. Oncol Lett. 3:1166–1170. 2012.PubMed/NCBI View Article : Google Scholar

30 

Matsuno O, Miyazaki E, Nureki S, Ueno T, Ando M, Ito K, Kumamoto T and Higuchi Y: Elevated soluble ADAM8 in bronchoalveolar lavage fluid in patients with eosinophilic pneumonia. Int Arch Allergy Immunol. 142:285–290. 2007.PubMed/NCBI View Article : Google Scholar

31 

Bridges LC, Sheppard D and Bowditch RD: ADAM disintegrin-like domain recognition by the lymphocyte integrins alpha4beta1 and alpha4beta7. Biochem J. 387:101–108. 2005.PubMed/NCBI View Article : Google Scholar

32 

Namba K, Nishio M, Mori K, Miyamoto N, Tsurudome M, Ito M, Kawano M, Uchida A and Ito Y: Involvement of ADAM9 in multinucleated giant cell formation of blood monocytes. Cell Immunol. 213:104–113. 2001.PubMed/NCBI View Article : Google Scholar

33 

Richens J, Fairclough L, Ghaemmaghami AM, Mahdavi J, Shakib F and Sewell HF: The detection of ADAM8 protein on cells of the human immune system and the demonstration of its expression on peripheral blood B cells, dendritic cells and monocyte subsets. Immunobiology. 212:29–38. 2007.PubMed/NCBI View Article : Google Scholar

34 

Seabra AD, Araújo TM, Mello Junior FA, Di Felipe Ávila Alcântara D, De Barros AP, De Assumpção PP, Montenegro RC, Guimarães AC, Demachki S, Burbano RM and Khayat AS: High-density array comparative genomic hybridization detects novel copy number alterations in gastric adenocarcinoma. Anticancer Res. 34:6405–6415. 2014.PubMed/NCBI

35 

Chiu CG, Nakamura Y, Chong KK, Huang SK, Kawas NP, Triche T, Elashoff D, Kiyohara E, Irie RF, Morton DL and Hoon DS: Genome-wide characterization of circulating tumor cells identifies novel prognostic genomic alterations in systemic melanoma metastasis. Clin Chem. 60:873–885. 2014.PubMed/NCBI View Article : Google Scholar

36 

Li L, Peng M, Xue W, Fan Z, Wang T, Lian J, Zhai Y, Lian W, Qin D and Zhao J: Integrated analysis of dysregulated long non-coding RNAs/microRNAs/mRNAs in metastasis of lung adenocarcinoma. J Transl Med. 16(372)2018.PubMed/NCBI View Article : Google Scholar

37 

Colaprico A, Olsen C, Bailey MH, Odom GJ, Terkelsen T, Silva TC, Olsen AV, Cantini L, Zinovyev A, Barillot E, et al: Interpreting pathways to discover cancer driver genes with moonlight. Nat Commun. 11(69)2020.PubMed/NCBI View Article : Google Scholar

38 

Ma S, Xu J, Wang X, Wu QY, Cao J, Li ZY, Zeng LY, Chen C and Xu KL: Effect of ADAM10 inhibitor GI254023X on proliferation and apoptosis of acute T-lymphoblastic leukemia jurkat cells in vitro and its possible mechanisms. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 23:950–955. 2015.(In Chinese). PubMed/NCBI View Article : Google Scholar

39 

Mullooly M, McGowan PM, Crown J and Duffy MJ: The ADAMs family of proteases as targets for the treatment of cancer. Cancer Biol Ther. 17:870–880. 2016.PubMed/NCBI View Article : Google Scholar

40 

Fu L, Liu N, Han Y, Xie C, Li Q and Wang E: ADAM10 regulates proliferation, invasion, and chemoresistance of bladder cancer cells. Tumour Biol. 35:9263–9268. 2014.PubMed/NCBI View Article : Google Scholar

41 

Liu WH and Chang LS: Suppression of ADAM17-mediated Lyn/Akt pathways induces apoptosis of human leukemia U937 cells: Bungarus multicinctus protease inhibitor-like protein-1 uncovers the cytotoxic mechanism. J Biol Chem. 285:30506–30515. 2010.PubMed/NCBI View Article : Google Scholar

42 

Blanchot-Jossic F, Jarry A, Masson D, Bach-Ngohou K, Paineau J, Denis MG, Laboisse CL and Mosnier JF: Up-regulated expression of ADAM17 in human colon carcinoma: Co-expression with EGFR in neoplastic and endothelial cells. J Pathol. 207:156–163. 2005.PubMed/NCBI View Article : Google Scholar

43 

Tanaka Y, Miyamoto S, Suzuki SO, Oki E, Yagi H, Sonoda K, Yamazaki A, Mizushima H, Maehara Y, Mekada E and Nakano H: Clinical significance of heparin-binding epidermal growth factor-like growth factor and a disintegrin and metalloprotease 17 expression in human ovarian cancer. Clin Cancer Res. 11:4783–4792. 2005.PubMed/NCBI View Article : Google Scholar

44 

Ringel J, Jesnowski R, Moniaux N, Lüttges J, Ringel J, Choudhury A, Batra SK, Klöppel G and Löhr M: Aberrant expression of a disintegrin and metalloproteinase 17/tumor necrosis factor-alpha converting enzyme increases the malignant potential in human pancreatic ductal adenocarcinoma. Cancer Res. 66:9045–9053. 2006.PubMed/NCBI View Article : Google Scholar

45 

Takamune Y, Ikebe T, Nagano O and Shinohara M: Involvement of NF-kappaB-mediated maturation of ADAM-17 in the invasion of oral squamous cell carcinoma. Biochem Biophys Res Commun. 365:393–398. 2008.PubMed/NCBI View Article : Google Scholar

46 

Fourie AM, Coles F, Moreno V and Karlsson L: Catalytic activity of ADAM8, ADAM15, and MDC-L (ADAM28) on synthetic peptide substrates and in ectodomain cleavage of CD23. J Biol Chem. 278:30469–30477. 2003.PubMed/NCBI View Article : Google Scholar

47 

Mitsui Y, Mochizuki S, Kodama T, Shimoda M, Ohtsuka T, Shiomi T, Chijiiwa M, Ikeda T, Kitajima M and Okada Y: ADAM28 is overexpressed in human breast carcinomas: Implications for carcinoma cell proliferation through cleavage of insulin-like growth factor binding protein-3. Cancer Res. 66:9913–9920. 2006.PubMed/NCBI View Article : Google Scholar

48 

Ohtsuka T, Shiomi T, Shimoda M, Kodama T, Amour A, Murphy G, Ohuchi E, Kobayashi K and Okada Y: ADAM28 is overexpressed in human non-small cell lung carcinomas and correlates with cell proliferation and lymph node metastasis. Int J Cancer. 118:263–273. 2006.PubMed/NCBI View Article : Google Scholar

49 

Zhang XH, Wang CC, Jiang Q, Yang SM, Jiang H, Lu J, Wang QM, Feng FE, Zhu XL, Zhao T and Huang XJ: ADAM28 overexpression regulated via the PI3K/Akt pathway is associated with relapse in de novo adult B.cell acute lymphoblastic leukemia. Leuk Res, 2015 (Epub ahead of print).

50 

Twito T, Chen Z, Khatri I, Wong K, Spaner D and Gorczynski R: Ectodomain shedding of CD200 from the B-CLL cell surface is regulated by ADAM28 expression. Leuk Res. 37:816–821. 2013.PubMed/NCBI View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
Copy and paste a formatted citation
Spandidos Publications style
Batista‑Gomes JA, Mello Jr FA, De Souza MP, Wanderley AV, De Oliveira EH and Khayat AS: <em>ADAM3A</em> deletion is associated with high‑risk features in acute lymphoblastic leukemia. World Acad Sci J 2: 15, 2020.
APA
Batista‑Gomes, J.A., Mello Jr, F.A., De Souza, M.P., Wanderley, A.V., De Oliveira, E.H., & Khayat, A.S. (2020). <em>ADAM3A</em> deletion is associated with high‑risk features in acute lymphoblastic leukemia. World Academy of Sciences Journal, 2, 15. https://doi.org/10.3892/wasj.2020.56
MLA
Batista‑Gomes, J. A., Mello Jr, F. A., De Souza, M. P., Wanderley, A. V., De Oliveira, E. H., Khayat, A. S."<em>ADAM3A</em> deletion is associated with high‑risk features in acute lymphoblastic leukemia". World Academy of Sciences Journal 2.5 (2020): 15.
Chicago
Batista‑Gomes, J. A., Mello Jr, F. A., De Souza, M. P., Wanderley, A. V., De Oliveira, E. H., Khayat, A. S."<em>ADAM3A</em> deletion is associated with high‑risk features in acute lymphoblastic leukemia". World Academy of Sciences Journal 2, no. 5 (2020): 15. https://doi.org/10.3892/wasj.2020.56
Copy and paste a formatted citation
x
Spandidos Publications style
Batista‑Gomes JA, Mello Jr FA, De Souza MP, Wanderley AV, De Oliveira EH and Khayat AS: <em>ADAM3A</em> deletion is associated with high‑risk features in acute lymphoblastic leukemia. World Acad Sci J 2: 15, 2020.
APA
Batista‑Gomes, J.A., Mello Jr, F.A., De Souza, M.P., Wanderley, A.V., De Oliveira, E.H., & Khayat, A.S. (2020). <em>ADAM3A</em> deletion is associated with high‑risk features in acute lymphoblastic leukemia. World Academy of Sciences Journal, 2, 15. https://doi.org/10.3892/wasj.2020.56
MLA
Batista‑Gomes, J. A., Mello Jr, F. A., De Souza, M. P., Wanderley, A. V., De Oliveira, E. H., Khayat, A. S."<em>ADAM3A</em> deletion is associated with high‑risk features in acute lymphoblastic leukemia". World Academy of Sciences Journal 2.5 (2020): 15.
Chicago
Batista‑Gomes, J. A., Mello Jr, F. A., De Souza, M. P., Wanderley, A. V., De Oliveira, E. H., Khayat, A. S."<em>ADAM3A</em> deletion is associated with high‑risk features in acute lymphoblastic leukemia". World Academy of Sciences Journal 2, no. 5 (2020): 15. https://doi.org/10.3892/wasj.2020.56
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team