Anti‑hepatitis B virus activity of Boehmeria nivea leaf extracts in human HepG2.2.15 cells

  • Authors:
    • Jingchen Wei
    • Lianku Lin
    • Xiaojian Su
    • Shaoyan Qin
    • Qing Xu
    • Zunian Tang
    • Yan Deng
    • Yuehan Zhou
    • Songqing He
  • View Affiliations

  • Published online on: November 22, 2013     https://doi.org/10.3892/br.2013.205
  • Pages:147-151
Metrics: HTML 0 views | PDF 0 views     Cited By (CrossRef): 0 citations

Abstract

Boehmeria nivea (Linn.) Gaudich of the Urticaceae family is a perennial ratoon herbal plant, the root of which is used in traditional Chinese medicine and possesses a variety of pharmacological properties. the 20% ethanol Boehmeria nivea root extract was shown to exert an anti‑hepatitis B virus (HBV) effect in vitro and in vivo; however, whether the Boehmeria nivea leaf (BNL) extract possesses similar properties has not been determined. In this study, we aimed to investigate the anti‑HBV effects of the BNL extract in HepG2.2.15 cells transfected with human HBV DNA. Our results demonstrated that the secretion of HBsAg and HBeAg was reduced in HepG2.2.15 cells treated with the BNL extract, without any recorded cytotoxic effects. In addition, the chloroform fraction (CF) and ethyl acetate fraction (EAF) of BNL were shown to be more potent compared to the other fractions: CF (100 mg̸l) inhibited the secretion of HBsAg by 94.00±1.78% [inhibitory concentration 50 (IC50) = 20.92 mg̸l] and that of HBeAg by 100.19±0.35% (IC50=19.67 mg̸l) after 9 days of treatment. Similarly, EAF (200 mg̸l) inhibited the secretion of HBsAg by 89.95±2.26% (IC50=39.90 mg̸l) and that of HBeAg by 98.90±1.42% (IC50=36.45 mg̸l). Furthermore, we observed that the content of HBV DNA in the medium secreted by the HepG2.2.15 cells was significantly decreased under CF (100 mg̸l) or EAF (200 mg̸l) treatment. Thus, we concluded that the BNL extracts exhibited anti‑HBV activity, with CF and EAF being the most potent among the fractions.

Introduction

Boehmeria nivea (Linn.) Gaudich of the Urticaceae family is a perennial ratoon herbal plant, also referred to as home ramie, white linen or round hemp. The root of this plant is used as a traditional Chinese herbal medicine and possesses a variety of pharmacological properties. Over the last few years, the medicinal value of the Boehmeria nivea (Linn.) Gaudich has attracted increasing attention. It was previously determined that Boehmeria nivea (Linn.) Gaudich contains triterpenes, polyphenols, flavonoids, chlorogenic acid, quercetin, ursolic acid and other ingredients (1), some of which were shown to exert antitumor (24), antiviral (57), antibacterial (8), hepatoprotective, glucose-lowering (9) and antioxidant effects (10). Huang et al(57) reported that the 20% ethanol Boehmeria nivea root extract exhibited anti-hepatitis B virus (HBV) activity in vitro and in vivo; however, whether the Boehmeria nivea leaf (BNL) extract possesses similar properties has not been determined. In this study, we aimed to investigate the anti-HBV effects of the BNL extract in HepG2.2.15 cells transfected with human HBV DNA.

Materials and methods

Reagents

MTT, dimethyl sulfoxide (DMSO) and G418 were purchased from Sigma (St. Louis, MO, USA). The ELISA kit for HBsAg and HbeAg was obtained from the Sino-American Biotechnology Company (Luoyang, China). The HBV DNA extraction and amplification fluorescence assay kit was purchased from Guangzhou Da An Gene Co., Ltd. of Sun Yat-Sen University (Guangzhou, China). High-glucose Dulbecco’s modified Eagles medium (DMEM), trypsin, EDTA, L-glutamine and fetal bovine serum (FBS) were purchased from Gibco-BRL (Carlsbad, CA, USA). Lamivudine, also referred to as 2′-3′deoxy-3′-thiocytidine (3TC), was obtained from GlaxoSmithKline Pharmaceuticals Co., Ltd. (Brentford, UK) and freshly prepared before use.

BNL extraction

The Boehmeria nivea (Linn.) Gaudich used in this study was grown in the suburbs of Guilin (Guangxi, China) and the leaves were collected. The protocol for the extraction of the BNL fractions is summarized in Fig. 1. Briefly, the components of BNL were obtained with reflux extraction from 7 kg of dried leaves with 70–80% ethanol three times. The extracts were then pooled, concentrated by reduced pressure and went through D101 macroporous adsorption resin (Tianjin Science and Technology Co., Ltd, Tianjin, China) followed by water and ethanol elution. The ethanol-eluted fraction was enriched and 240 g of extract was obtained. The extract was then diluted with water and stirred thoroughly to yield a turbid suspension. The suspension was extracted with petroleum ether, chloroform, ethyl acetate and n-butanol, respectively. Finally, 27, 35, 25, 75 and 34 g of petroleum ether, chloroform, ethyl acetate, n-butanol and aqueous extracts, respectively, were harvested.

Qualitative analysis of the chemical compositions of the BNL extracts

Five fractions extracted from BNL [petroleum ether fraction (PEF), chloroform fraction (CF), ethyl acetate fraction (EAR), n-butanol fraction (nBF) and aqueous fraction (AF)]were dissolved in ethanol and their chemical compositions were assayed qualitatively, as described previously (57).

Cell culture and drug treatment

HepG2.2.15 cells transfected with human HBV DNA were provided by the Beijing No. 302 Hospital and maintained in DMEM supplemented with 10% FBS, 1% penicillin/streptomycin and 200 mg/l G418 in a humidified atmosphere of 5% CO2 at 37°C. For treatment, 1×104 cells were seeded in a 96-well plate and cultured for 24 h prior to extract addition. The extracts were dissolved in DMSO and diluted to proper concentrations. The medium was changed three times every 3 days using fresh medium containing the corresponding extracts. At different time points (3, 6 and 9 days), medium was collected and stored at −20°C until use. Under the same conditions, a blank group was used as the negative control and 3TC as the positive control.

MTT assay

In order to investigate the cytotoxic effects of the BNL extracts, the MTT assay was used. Briefly, the HepG2.2.15 cells were seeded in a 96-well plate and treated with the different extracts for 9 days. Following treatment, the medium was replaced with an equal volume of fresh medium containing 5 mg/ml MTT and the plate was incubated for 4 h at 37°C. The MTT was removed and the cells were lysed with DMSO. The dark blue formazan crystals formed in intact cells were solubilized by shaking for 15 min and the absorbance at 570 nm was measured with an Elx800 type ELISA analyzer microplate reader (BioTek Instruments, Inc., Winooski, VT, USA). The cell growth rate was expressed as a percentage of the control.

ELISA

HBsAg and HBeAg in the conditioned medium were quantified using two antibody sandwich ELISA kits (Sino-American Biotechnology Company), according to the protocol provided by the manufacturer.

Quantitative fluorescence polymerase chain reaction (QF-PCR)

The amount of HBV DNA in the cultured medium was measured by QF-PCR. Total RNA was extracted from HepG2.2.15 cells treated with different concentrations of CF (12.5, 25, 50 and 100 mg/l), EAF (25, 50, 100 and 200 mg/l) and 3TC (positive control; 25, 50, 200 mg/l) for 3, 6 and 9 days, using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The primers used in this study were as follows: P1, 5 ‘ATCCTGCTGCTATGCCTCATCTT 3′; P2, 5′ ACAGTGGGGGAAAGCCCTACGAA 3′; fluorescent probe sequence, 5′ GGCTAGTTTACTAGTGCCATTTG 3′. The amplification parameters included predegeneration at 93°C for 2 min, followed by 10 cycles of denaturation at 93°C for 45 sec and annealing at 55°C for 1 min; the condition was then changed to 30 cycles of denaturation at 93°C for 30 sec and annealing at 55°C for 45 sec.

Statistical analysis

Data are presented as the means ± standard error of the mean and the Student’s t-test was applied for statistical analysis to determine the statistical significance. P<0.05 was considered to indicate a statistically significant difference.

Results

Inhibitory effect of the BNL extracts on HBsAg and HBeAg secretion by HepG2.2.15 cells

To investigate the effects of the BNL extracts on HBsAg and HBeAg secretion by HepG2.2.15 cells, we first determined the inhibitory concentration 50 (IC50) of the different BNL extracts. As shown in Table I, the CF was the most potent inhibitor of HBsAg and HBeAg secretion, followed by EAF. Of note, the AF was more efficient in inhibiting the HBeAg secretion by HepG2.2.15 cells at the 3-day time point compared to other extracts and other time points. In addition, we observed that CF and EAF inhibited HBsAg (Table II) and HBeAg (Table III) secretion by HepG2.2.15 cells in a concentration- and time-dependent manner. After 9 days of CF treatment (100 mg/l), the secretion of HBsAg was reduced by 94.00±1.78% and that of HBeAg by 100.19±0.35% (Tables II and III, respectively). Furthermore, after 9 days of EAF treatment (200 mg/l), the secretion of HBsAg and HBeAg was reduced by 89.95±2.26 and 98.90±1.42%, respectively (Tables II and III).

Table I

IC50 (mg/l) of extracted BNL fractions on HBsAg and HBeAg secretion from HepG2.2.15 cells.

Table I

IC50 (mg/l) of extracted BNL fractions on HBsAg and HBeAg secretion from HepG2.2.15 cells.

HBsAg (days)HBeAg (days)


Fractions369369
PEF-176.3073.00-130.1094.73
CF-33.4320.9277.9028.0519.67
EAF143.0052.9039.9093.3067.8236.45
nBF--103.10-127.5163.48
AF---21.38133.07157.12
3TC--86.80--29.44

[i] IC50, inhibitory concentration 50; BNL, Boehmeria nivea leaf; PEF, petroleum ether fraction; CF, chloroform fraction; EAF, ethyl acetate fraction; nBF, n-butanol fraction; AF, aqueous fraction; 3TC, 2′-3′deoxy-3′-thiocytidine.

Table II

Effects of CF and EAF from BNL on the inhibition of HBsAg secretion by HepG2.2.15 cells (n=3).

Table II

Effects of CF and EAF from BNL on the inhibition of HBsAg secretion by HepG2.2.15 cells (n=3).

3 days6 days9 days9 days




GroupsConcentration (mg/l)ODInhibition (%)ODInhibition (%)ODInhibition (%)Cell survival (%)
Control1.434±0.249-1.206±0.328-0.549±0.128-100.00
CF1000.822±0.176a44.1±12.710.203±0.079a88.68±6.960.100±0.009b94.00±1.78115.92
501.130±0.22421.92±16.150.511±0.18861.45±16.610.146±0.010b84.37±2.1898.24
251.241±0.09913.94±7.110.690±0.19445.59±14.520.199±0.013b73.14±2.7387.86
12.51.224±0.25115.14±18.131.064±0.23112.56±20.410.457±0.07419.27±15.43129.90
EAF2001.087±0.201b56.81±8.500.253±0.072b84.29±6.390.119±0.011b89.95±2.2697.36
1000.853±0.065a41.86±4.720.460±0.126a65.93±11.100.174±0.036b78.37±7.5374.23
501.041±0.03728.33±2.690.600±0.10453.55±9.160.238±0.01764.97±3.6076.96
251.244±0.15813.67±11.390.910±0.06226.20±5.440.406±0.007a29.80±1.4967.63
3TC2000.910±0.110a37.78±7.970.699±0.062a44.83±5.440.258±0.017a60.92±3.4876.87
1000.974±0.20233.14±14.550.826±0.13633.63±12.070.283±0.07355.62±15.2667.19
501.100±0.19624.08±14.130.962±0.02121.60±1.860.358±0.06239.92±12.9978.54
251.295±0.17710.00±12.791.273±0.111−5.95±9.850.698±0.079−31.18±16.43125.86

{ label (or @symbol) needed for fn[@id='tfn2-br-02-01-0147'] } Data are presented as means ± standard error of the mean.

a P<0.05 and

b P<0.01 vs. control.

{ label (or @symbol) needed for fn[@id='tfn5-br-02-01-0147'] } OD, optical density; CF, chloroform fraction; EAF, ethyl acetate fraction; BNL, Boehmeria nivea leaf; 3TC, 2′-3′deoxy-3′-thiocytidine.

Table III

Effects of CF and EAF from BNL on the inhibition of HBeAg secretion by HepG2.2.15 cells (n=3).

Table III

Effects of CF and EAF from BNL on the inhibition of HBeAg secretion by HepG2.2.15 cells (n=3).

3 days6 days9 days9 days




GroupsConcentration (mg/l)ODInhibition (%)ODInhibition (%)ODInhibition (%)Cell survival (%)
Control2.948±0.135-2.660±0.315-1.088±0.229-100.00
CF1001.248±0.226a58.77±7.830.323±0.137a89.52±5.250.057±0.004a100.19±0.35115.92
501.901±0.291a36.19±10.060.953±0.256a65.39±9.790.145±0.027a91.67±2.6798.24
252.183±0.102a26.45±3.541.453±0.332a46.24±12.720.253±0.007a81.18±0.7087.86
12.52.410±0.296b18.59±10.232.055±0.33023.18±12.630.930±0.17415.32±16.9129.90
EAF2000.820±0.216a73.57±7.460.340±0.108a88.87±4.130.070±0.015a98.90±1.4297.36
1001.499±0.314a50.09±10.870.988±0.184a64.04±7.030.160±0.050a90.15±4.8674.23
502.120±0.142a28.63±4.911.495±0.139b44.63±5.330.347±0.029b71.98±2.8576.96
252.398±0.182b19.02±6.282.383±0.21910.60±8.390.809±0.07527.15±7.2967.63
3TC2001.752±0.330a41.34±11.401.814±0.151b32.39±5.770.358±0.017b80.69±1.6276.87
1001.901±0.42036.19±14.532.058±0.38423.06±14.720.283±0.07378.23±7.0967.19
502.126±0.47828.42±16.532.203±0.20417.50±7.800.358±0.06270.94±6.0378.54
252.388±0.17619.38±6.072.596±0.1992.44±7.610.698±0.07937.93±7.63125.86

{ label (or @symbol) needed for fn[@id='tfn6-br-02-01-0147'] } Data are presented as means ± standard error of the mean.

a P<0.01 and

b P<0.05 vs. control.

{ label (or @symbol) needed for fn[@id='tfn9-br-02-01-0147'] } OD, optical density; CF, chloroform fraction; EAF, ethyl acetate fraction; BNL, Boehmeria nivea leaf; 3TC, 2′-3′deoxy-3′-thiocytidine.

Effects of CF and EAF on HBV DNA in the medium secreted by HepG2.2.15 cells

In order to determine the effects of CF and EAF on HBV DNA secretion by HepG2.2.15 cells, QF-PCR was performed. As shown in Fig. 2, CF and EAF were shown to significantly reduce the content of HBV DNA in the medium secreted by HepG2.2.15 cells compared to that of the control. These data indicated that CF and EAF inhibited HBV DNA replication. In addition, CF was shown to be more potent compared to EAF (Fig. 2). As a positive control, 3TC (200 mg/ml) reduced the content of HBV DNA in the medium secreted by HepG2.2.15 cells at 3, 6 and 9 days (Fig. 2).

BNL extracts exerted no cytotoxic effects on HepG2.2.15 cells

To determine whether the anti-HBV effects of the BNL extracts were due to cytotoxicity, the effects of BNL extracts on HepG2.2.15 cell proliferation were assessed by the MTT assay. After 9 days of treatment, HepG2.2.15 cell growth was found to be unaffected by CF or EAF treatment (Tables II and III).

Chemical composition of BNL extracts

In order to determine the chemical composition of the BNL extracts, a qualitative assay was performed as previously described (57). The qualitative assay determined that PEF contained anthraquinones, phenols, volatile oils, steroids, terpenes, amino acids, reducing sugars, polysaccharides and organic acids; CF contained anthraquinones, phenols, steroids, terpenes, amino acids, organic acids, lactones and coumarins; EAF contained flavonoids, anthraquinones, phenols, lactones, coumarins, volatile oils, sterols, terpenes, amino acids, reducing sugars, polysaccharides and organic acids; nBF contained anthraquinones, phenols, lactone, coumarins, amino acids, reducing sugars and polysaccharides; and AF contained flavonoids, phenols, saponins, amino acids, reducing sugars, polysaccharides and organic acids.

Discussion

Boehmeria nivea, a perennial herbal plant with unique properties, contains multiple compounds of medicinal value. The production of Boehmeria nivea in China accounts for >90% of its production worldwide; therefore, Boehmeria nivea is also referred to as ‘China grass’. The bark of the Boehmeria nivea stem is used as a textile raw material (11); however, BNL, accounting for ~40% of the plant’s total weight (12) is wasted in the textile industry.

It was previously reported that the Boehmeria nivea root extract possesses anti-HBV properties (13) and a clinical trial on the anti-HBV effects of the Boehmeria nivea root extract in human subjects is currently underway. However, whether the BNL extract possesses similar properties has not been determined. In this study, the HBV-positive HepG2.2.15 cell line, which was able to secrete HBsAg, HBeAg and HBV DNA into the medium, was used to investigate the anti-HBV effects mediated by certain fractions extracted from BNL by different polarities. Of note, the inhibitory effect of AF extracted from BNL was similar to that of the 20% ethanol Boehmeria nivea root extract (5). Our results demonstrated that CF and EAF extracted from BNL significantly suppressed HBsAg and HBeAg secretion into the medium and inhibited HBV DNA replication in HepG2.2.15 cells, without any recorded cytotoxic effects. However, we were unable to specify which component of the BNL extract was key to the anti-HBV activity observed in this study. Therefore, the elucidation of the precise mechanisms underlying the anti-HBV effects of the BNL extract requires further investigation. The CF and EAF, which exhibited the most potent anti-HBV activity, have several ingredients in common, including phenolic compounds, organic acids and terpenoids. Therefore, we deduced that phenolic compounds, organic acids (14) and terpenoids (15) may be the active components of the BNL extracts responsible for its anti-HBV properties. However, multiple mechanisms may be involved in this anti-HBV activity and future investigations should isolate, purifiy and identify the structure of the active compounds in the BNL extracts.

Acknowledgements

This study was supported in part by grants from the Traditional Medical Science and Technology Foundation from the Administration of Chinese Traditional Medicine of Guangxi Province (no. GZKZ-Z1107); the Open Fund of the Medical Scientific Research Center of Guangxi Medical University (nos. KFJJ2010-49 and KFJJ2011-06); the Lijiang Scholarship Foundation and the Science and Technology Planning Project of Guilin City (no. 20110119-1-8); the Natural Science Foundation of Guangxi Province (no. 2013GXNSFCA019012) and the National Natural Science Foundation of China (nos. 31370917 and 30972797). This study was also supported by a direct grant from the Guilin Medical University. The authors would like to thank Dr Junfei Jin for reviewing the manuscript.

Abbreviations:

BNL

Boehmeria nivea leaf

HBV

hepatitis B virus

PEF

petroleum ether fraction

CF

chloroform fraction

EAF

ethyl acetate fraction

nBF

n-butanol fraction

AF

aqueous fraction

References

1 

Zhang GG, Zhao LN and Cheng JH: Medicinal value and development prospects of Ramie. Plant Fiber Sci China. 24:2002.(In Chinese).

2 

Cai XF, Jin X, Lee D, et al: Phenanthroquinolizidine alkaloids from the roots of Boehmeria pannosa potently inhibit hypoxia-inducible factor-1 in AGS human gastric cancer cells. J Nat Prod. 69:1095–1097. 2006.PubMed/NCBI

3 

Yan J, Luo D, Luo Y, et al: Induction of G1 arrest and differentiation in MDA-MB-231 breast cancer cell by boehmeriasin A, a novel compound from plant. Int J Gynecol Cancer. 16:165–170. 2006. View Article : Google Scholar : PubMed/NCBI

4 

Luo Y, Liu Y, Luo D, et al: Cytotoxic alkaloids from Boehmeria siamensis. Planta Med. 69:842–845. 2003. View Article : Google Scholar : PubMed/NCBI

5 

Huang KL, Lai YK, Lin CC, et al: Inhibition of hepatitis B virus production by Boehmeria nivea root extract in HepG2 2.2.15 cells. World J Gastroenterol. 12:5721–5725. 2006.PubMed/NCBI

6 

Huang KL, Lai YK, Lin CC, et al: Involvement of GRP78 in inhibition of HBV secretion by Boehmeria nivea extract in human HepG2 2.2.15 cells. J Viral Hepat. 16:367–375. 2009. View Article : Google Scholar : PubMed/NCBI

7 

Chang JM, Huang KL, Yuan TT, et al: The anti-hepatitis B virus activity of Boehmeria nivea extract in HBV-viremia SCID mice. Evid Based Complement Alternat Med. 7:189–195. 2010. View Article : Google Scholar : PubMed/NCBI

8 

Semwal DK, Rawat U, Semwal R, et al: Chemical constituents from the leaves of Boehmeria rugulosa with antidiabetic and antimicrobial activities. J Asian Nat Prod Res. 11:1045–1055. 2009.PubMed/NCBI

9 

Sancheti S, Sancheti S and Seo SY: Evaluation of antiglycosidase and anticholinesterase activities of Boehmeria nivea. Pak J Pharm Sci. 23:236–240. 2010.PubMed/NCBI

10 

Lin CC, Yen MH, Lo TS, et al: Evaluation of the hepatoprotective and antioxidant activity of Boehmeria nivea var. nivea and B. nivea var. tenacissima. J Ethnopharmacol. 60:9–17. 1998. View Article : Google Scholar

11 

Cheng XW: The history, status and future of ramie textile industry in China. Plant Fiber Sci China. 29(Suppl 1): S77–S85. 2007.(In Chinese).

12 

Cao DH: Development and utilization of Ramie leaf. Spec Econ Anim Plant. 4:192001.(In Chinese).

13 

Li LZ, Zhang XF and Li CY: Drug treatment of liver diseases with plant extracts[P] CN: 1634964. 2005

14 

Zhang JF, Tan J, Liu YH, et al: Advance in the research of herbs and natural products on antiviral against hepatitis B virus. Nat Prod Res Dev. 14:88–91. 2002.(In Chinese).

15 

Liu HJ, Hu JH, Sun LN, et al: Inhibition effects of oleanolic acid from Chaenomeles lagenaria on hepatitis B virus in vitro. Pharm J Chin People’s Liberation Army. 18:272–274. 2002.(In Chinese).

Related Articles

Journal Cover

January 2014
Volume 2 Issue 1

Print ISSN: 2049-9434
Online ISSN:2049-9442

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Wei, J., Lin, L., Su, X., Qin, S., Xu, Q., Tang, Z. ... He, S. (2014). Anti‑hepatitis B virus activity of Boehmeria nivea leaf extracts in human HepG2.2.15 cells. Biomedical Reports, 2, 147-151. https://doi.org/10.3892/br.2013.205
MLA
Wei, J., Lin, L., Su, X., Qin, S., Xu, Q., Tang, Z., Deng, Y., Zhou, Y., He, S."Anti‑hepatitis B virus activity of Boehmeria nivea leaf extracts in human HepG2.2.15 cells". Biomedical Reports 2.1 (2014): 147-151.
Chicago
Wei, J., Lin, L., Su, X., Qin, S., Xu, Q., Tang, Z., Deng, Y., Zhou, Y., He, S."Anti‑hepatitis B virus activity of Boehmeria nivea leaf extracts in human HepG2.2.15 cells". Biomedical Reports 2, no. 1 (2014): 147-151. https://doi.org/10.3892/br.2013.205