Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
November-2017 Volume 14 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2017 Volume 14 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Combined effect of linolenic acid and tobramycin on Pseudomonas aeruginosa biofilm formation and quorum sensing

  • Authors:
    • Warren Chanda
    • Thomson Patrick Joseph
    • Arshad Ahmed Padhiar
    • Xuefang Guo
    • Liu Min
    • Wendong Wang
    • Sainyugu Lolokote
    • Anhong Ning
    • Jing Cao
    • Min Huang
    • Mintao Zhong
  • View Affiliations / Copyright

    Affiliations: Department of Microbiology, College of Basic Medical Sciences, Dalian Medical University, Dalian, Liaoning 116044 P.R. China, Department of Epidemiology and Biostatistics, School of Public Health, Dalian Medical University, Dalian, Liaoning 116044 P.R. China, Laboratory of Pathogen Biology, Experimental Teaching Center for Basic Medical Sciences, Dalian Medical University, Dalian, Liaoning 116044 P.R. China
    Copyright: © Chanda et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 4328-4338
    |
    Published online on: September 5, 2017
       https://doi.org/10.3892/etm.2017.5110
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Pseudomonas aeruginosa is a ubiquitous Gram negative opportunistic pathogen capable of causing severe nosocomial infections in humans, and tobramycin is currently used to treat P. aeruginosa associated lung infections. Quorum sensing regulates biofilm formation which allows the bacterium to result in fatal infections forcing clinicians to extensively use antibiotics to manage its infections leading to emerging multiple drug resistant strains. As a result, tobramycin is also becoming resistant. Despite extensive studies on drug discovery to alleviate microbial drug resistance, the continued microbial evolution has forced researchers to focus on screening various phytochemicals and dietary compounds for antimicrobial potential. Linolenic acid (LNA) is an essential fatty acid that possesses antimicrobial actions on various microorganisms. It was hypothesized that LNA may affect the formation of biofilm on P. aeruginosa and improve the potency of tobramycin. The present study demonstrated that LNA interfered with cell‑to‑cell communication and reduced virulence factor production. It further enhanced the potency of tobramycin and synergistically inhibited biofilm formation through P. aeruginosa quorum sensing systems. Therefore, LNA may be considered as a potential agent for adjunctive therapy and its utilization may decrease tobramycin concentration in combined treatment thereby reducing aminoglycoside adverse effects.

Introduction

Pseudomonas aeruginosa (P. aeruginosa) is a ubiquitous Gram negative bacterium capable of surviving in several environmental niches such as mammals (including humans), insects, nematodes, soil, water and plants (1,2). In humans, P. aeruginosa rarely causes community acquired pneumonia (3,4), but has an increased incidence of causing hospital infections like hospital-acquired pneumonia, sepsis, urinary tract infections, and is prevalent among wound and burn patients (1,5). The bacterium causes severe pulmonary damage and is a leading cause of mortality in cystic fibrosis patients (6–8). This opportunistic pathogen poses a huge challenge in clinical settings as compared to other pathogens because of its highly intrinsic resistance to most antibiotics including β-lactams, fluoroquinolones and aminoglycosides (9–11). Each year, the bacterium is estimated to cause 51,000 healthcare-associated infections out of which 6,000 cases are multidrug resistant with roughly 400 deaths occurring per year in the United States (9). In addition, P. aeruginosa has the ability to switch from free-living (planktonic) to biofilm phenotypic mode of living. This ability contributes to antibiotic resistance and is governed by quorum sensing systems that regulate virulence factor production as well (1,12–14). Unlike other pathogens, P. aeruginosa has a unique virulence potential, its natural resistance to several antibiotics and other resistance mechanisms like antibiotic modification and energy-dependant drug efflux make infections very problematic to control (15,16). Therefore, there is need to search for more compounds with antimicrobial potential to curb P. aeruginosa-related infections.

In the recent past, fatty acids (FA) have received attention because of their antimicrobial and anti-inflammatory properties (17,18). They possess beneficial effects against cancerous cells, body fats, and in conditions such as depression, heart problems, neurodegenerative diseases, joint and bone conditions (19,20). One of the widely discussed fatty acid family based on nutrition and human health benefits is the omega-3 family in which linolenic acid (C18:3n-3, LNA) is a parent fatty acid compound (21). Evidence has shown that LNA and its derivatives, eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) possess antimicrobial properties against many microorganisms (22–26). Thus far, bacterial resistance towards free fatty acids is yet to be reported due to their broader spectrum activities (27). However, the last option of antimicrobial agents for multidrug resistant P. aeruginosa related infections include aminoglycosides and polymyxins, which besides losing their efficacy are also accompanied with side effects such as neurotoxicity, nephrotoxicity and ototoxicity (28–30). Nonetheless, these toxic side effects can be managed with reduced concentration and duration of tobramycin therapy. Besides, some studies have shown that phytochemical compounds can produce synergistic and additive effects with aminoglycosides in various bacterial infections thereby improving their (aminoglycosides) efficacious potential (31).

Despite several reports on the antibacterial activity of LNA and its omega-3 derivatives (EPA and DHA), the anti-biofilm mechanism and their interaction with aminoglycosides on P. aeruginosa pathogens have not been elucidated. Therefore, the present study aimed at assessing the anti-biofilm activity and mechanism of linolenic acid alone and in combination with tobramycin on P. aeruginosa, with the view to evaluating the potency of the compound alone or in combination for treating infections associated with this pathogen.

Materials and methods

Materials

Linolenic acid (Sigma-Aldrich), Azocasein (Sigma-Aldrich), AlarmaBlue cell viability assay kit (KeyGen BioTECH, China), Tobramycin (Solarbio, China), Crystal violet (Solarbio, China), LIVE/DEAD BacLight Bacterial viability kit (Molecular Probes, USA), Biozol Total RNA extraction reagent (BioFlux, China), TransScript Green Two-Step qRT-PCR SuperMix kit (Transgen Biotech, China), Trans2 K DNA ladder (Transgen Biotech, China), 2X Taq PCR MasterMix (TianGen, China), Ethidium bromide (Sigma, China), Cetrimide agar base (Xiya, China), Dimethyl sulfoxide (AMRESCO, Ohio-USA), and any other reagents were of analytical grade.

Bacterial strains

Pseudomonas aeruginosa ATCC 27853 strain, and Pseudomonas aeruginosa clinical strains were collected from the Laboratory of Pathogen Biology, Experimental Teaching Center for Basic Medical Sciences, Dalian Medical University while environmental strains were isolated from beach soil, water pond soil and garden soil in different locations on Dalian Medical University campus.

Primer design

The quantitative real time polymerase chain reaction (qRT-PCR) primers used in this study were designed with an online Primer-Blast tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast/; accessed March 11, 2016) whereas identification primers for P. aeruginosa were those published by Jaffe et al (32) (Table I) and all were synthesized by Invitrogen Biotechnology Co. Ltd, China.

Table I.

Primer list for PCR and RT-qPCR.

Table I.

Primer list for PCR and RT-qPCR.

Target genePrimer nameSequence (5′-3′)Amplicon (bp)(Refs.)
oprL (PA0973)oprL-ForwardATGGAA ATGCTGAAATTCGGC504(32)
oprL-Reverse CTTCTTCAGCTCGACGCGACG
16SrRNA 16SrRNA-Forward GAGGAAGGTGGGGATGACGT233(32)
16SrRNA-Reverse AGGCCCGGGAACGTATTCAC
lasI (PA1432)LasI-Forward TGAAGCCCAGGTTTTCGGTT131This study
LasI-Reverse AACGGCTGAGTTCCCAGATG
lasR (PA1430)LasR-Forward TCGAACATCCGGTCAGCAAA128This study
LasR-Reverse GTTCACATTGGCTTCCGAGC
rhlI (PA3476)RhlI-Forward CATCCGCAAACCCGCTACAT124This study
RhlI-Reverse GGGTTTCGCTGCACAGGTA
rhlR (PA3477)RhlR-Forward GAAATGGTGGTCTGGAGCGA132This study
RhlR-Reverse GGAAAGCACGCTGAGCAAAT
pilJ (PA0411)pilJ-Forward GACAAGCAGTACATCGGCCA137This study
pilJ-Reverse CGTTTCTCGAAGTCGTTGCG
algU (PA0762)algU-Forward CCATCAACACCGCGAAGAAC148This study
algU-Reverse ATCTCATCCCGCAACATCGC
pqsH (PA2587)pqsH-Forward AGACGCTGATCCTGTTCCAG131This study
pqsH-Reverse GCGAACGAGGGTATTCCTCA
mvfR (PA1003)mvfR-Forward TCGTTCTGCGATACGGTGAG136This study
mvfR-Reverse CGTCGATGGTGATGGCGATA
oprF (PA1777)oprF-Forward CAGTACCCGTCCACTTCCAC146This study
oprF-Reverse TTCACGCGACCACCTTCTAC
oprI (PA2853)oprI-Forward AGAAACCGAAGCTCGTCTGA137This study
oprI-Reverse CGTTAGCCTCGTCAGCAGT
phzR/qscR (PA1898)phzR-Forward GCTGACCGCGCCTAAATATC134This study
phzR-Reverse TCCAGATCAGCGGGGTGTAT
lasB (PA3724)lasB-Forward TGTCCAAACTCCCCAGCAAG149This study
lasB-Reverse GAATTGCTCGTAGCGGGTGA
Culture and identification of bacteria strains

Clinical isolates of P. aeruginosa and the ATCC strain were inoculated on cetrimide agar and incubated at 37°C for 24 h. For environmental strains, 1 g of soil was dissolved in 1 ml PBS, pH 7.4 with vigorous shaking and centrifuged at 5,000 g for one minute then 0.1 ml was inoculated on cetrimide agar and incubated at 37°C for 24 h. A bacterial suspension was prepared by dissolving a single colony from an overnight culture plate into 50 µl PBS pH 7.4 from which, a) 30 µl was added to a 15 ml-tube containing 3 ml fresh LB media for overnight culture at 37°C with 180 rpm shaking, then stored in 8% (v/v) glycerol at −80°C for use in subsequent assays; b) 1 µl was used for identification with duplex colony polymerase chain reaction (PCR).

Duplex colony PCR

The PCR conditions were performed according to Jaffe et al (32) with modifications. Briefly, a 10 µl reaction mixture was prepared to consist of 1 µl bacteria suspension, 0.5 µM forward and reverse primers apiece, 5 µl of 2X Taq PCR MasterMix, 5% Dimethyl sulfoxide (DMSO) and 1.5 µl distilled water to bring the total volume to 10 µl. DMSO was included to improve primer binding specificity during amplification since Pseudomonas species have a high GC content. The thermal cycling conditions were set as follows: Initial denaturation at 94°C for 3 min, a 30 cycle involving denaturation at 94°C for 30 sec, annealing at 58°C for 30 sec and extension at 72°C for 30 sec, and a final extension at 72°C for 45 sec. After thermocycling, 10 µl was then loaded into a 1% (w/v) agarose gel and the electrophoresis was run for 40 min at 70 volts in 1X Tris-acetate-EDTA (TAE) Buffer mixed with 0.2 mM ethidium bromide, then the images were taken by ChemiDoc XRS+ machine (Bio-ad).

Minimum inhibition concentration determination

The minimum inhibition concentration (MIC) of linolenic acid (LNA) and tobramycin (TOB) were performed following CLSI recommendation using the macrodilution (Tube) broth method and broth microdilution method, respectively (33). The stock solution of LNA (100 mg/ml) was prepared in DMSO and a surfactant Tween 20 (2% final concentration) was added for the uniform distribution of LNA and two-fold serial dilutions were made. Firstly, an overnight P. aeruginosa culture was diluted to an optical density (OD) of 0.1 at 600 nm (Multiskan Ascent Microplate Reader, Thermo Scientific) with fresh LB broth (~108 CFU/ml) and 10 µl of bacteria suspension (to achieve a final bacterial concentration of ~106 CFU/ml) was added to the test tubes containing 1 ml media with serial dilutions of LNA, incubated at 37°C for 24 h with gentle shaking at 110 rpm. Similarly, a two-fold dilutions of TOB from 20 mg/ml to 0.0391 mg/ml were prepared in a 96-well plate and incubated at 37°C for 24 h. The highest dilution of LNA or TOB showing visible inhibition of bacterial growth after 24 h of incubation was taken as MIC of the drug. Three independent assays were performed.

Growth curve analysis

To understand the activity of LNA alone or in combination with TOB on the P. aeruginosa, sub-MIC concentrations of both LNA and TOB were selected for this study and were assessed through the growth curve analysis as described by Kalia et al (34). Briefly, overnight bacteria culture was inoculated into 10 ml of LB broth supplemented with five different sub-MIC concentrations of LNA (i.e. 3/4, 5/8, 1/2, 3/8 and 1/4 of MIC) and TOB (1/4 of MIC). The flasks were incubated at 37°C and OD600 was monitored at time intervals 0, 3, 6, 9, 12, 18 and 24 h.

Biofilm control assay

As described elsewhere (34,35), P. aeruginosa biofilm inhibition and biofilm metabolic activity quantification were assessed in the presence/absence of LNA, TOB or in combination (LNA+TOB). Briefly, one microliter of overnight bacteria suspension adjusted to OD600 of 0.1 (~108 CFU/ml) was added to a well in a microtiter plate containing 100 µl of fresh LB media mixed with appropriate doses of drugs, and this plate was incubated at 37°C for 24 h from which subsequent assays were performed as follows:

Biofilm mass quantification

After incubation, the unattached cells were gently aspirated and discarded, and the wells were washed with 0.85% sodium chloride (normal saline) twice and stained with 200 µl of 0.1% crystal violet for 15 min. The stain was discarded, and the wells were washed with distilled water, air dried and the dye was re-solubilized with 160 µl of 33% (v/v) glacial acetic acid (36). The OD was measured at 570 nm using Multiskan Ascent Microplate Reader (Thermo Scientific). Biofilm inhibition was given by:

%BI={(ODC–ODT)/ODC}x100.

where %BI is the percentage of biofilm inhibition, ODC is the 570 nm absorbance value of untreated sample and ODT is the 570 nm absorbance value of treated sample (35).

Biofilm metabolic activity quantification

In order to assess the bacterial activity of biofilm cells, the alamarblue (7-hydroxy-3H-phenoxazin-3-one-10-oxide) cell viability assay was applied as a commended, reliable and reproducible assay for assessing biofilm susceptibility (35,37). After incubation as mentioned above, the supernatant was removed and the wells were gently washed twice with LB media. Then, 200 µl fresh LB media containing 10% (v/v) alarmablue staining reagent was added and incubated at 37°C for 5 h, as recommended by the manufacturer (KeyGen Biotech, China). The absorbance was then measured at 570 nm and Biofilm inactivation was given by:

%BI={(AC–AT)/AC}x100.

where %BI is the percentage of biofilm inactivation, AC is the 570 nm absorbance value of the untreated sample and AT is the 570 nm absorbance value of treated sample (35).

Microscopic analysis

To visualize the effect of biofilm formation in the presence/absence of sub-MIC doses of LNA, TOB or LNA+TOB, microscopic analysis of P. aeruginosa clinical strain C2 biofilms was performed as described previously (11,38,39) with modifications. Briefly, 10 µl of an overnight culture as described above, was added to 1 ml LB media supplemented with appropriate sub-MIC doses in a 24-well plate. Positive control wells contained media supplemented with the greatest concentration of DMSO used (0.75%) while the negative control wells contained media only (for sterility check), and the plate was then incubated at 37°C for 24 h. Afterwards, the wells were gently washed with sterile normal saline and 200 µl of staining solution in LB media containing 2.09 µM of Syto 9 and 12.5 µM of Propidium iodide (PI) using LIVE/DEAD BacLight Bacterial Viability Kit L7012 was added to each well, incubated at room temperature for 15 min in the dark and images were captured with an inverted fluorescence microscope (Olympus IX71).

Synergy analysis

The interaction of LNA with TOB was analyzed by a checkerboard method in an 8×8 arrangement using a 96-well plate as previously described (24). Briefly, biofilms were allowed to build up for 24 h and then wells were gently washed with sterile LB medium and later supplemented with LB medium consisting of different combinations of LNA and TOB. The combinations were done in such a way that a fixed dose of one agent and increasing doses of the second agent was put in each column (or row). Then incubated at 37°C for 24 h, washed gently and the biofilm metabolic activity was assessed with alamarblue staining reagent for assessing biofilm susceptibility (35,37). For all the wells with combined drug concentrations, the sum of the fractional inhibitory concentrations (FIC) index was calculated according to the equation below:

FICindex=FICA+FICB=A/MICA+B/MICB.

where A and B are the MICs of LNA (A) and TOB (B) in combination, MICA and MICB are the MICs of LNA and TOB alone, FICA and FICB are the FICs of LNA and TOB, respectively. The FIC index results were interpreted as synergistic effect (FIC index ≤0.5), additive or indifferent effect (FIC index >0.5 and ≤1) and antagonistic effect (FIC index >1) (40).

Inhibition of virulence factors mediated by QS
Swarming assay

The swarming ability of P. aeruginosa C2 strain was investigated in small 35×10 mm plates containing swarming motility media 0.5% (w/v) Bacto agar, 0.5% (w/v) peptone, 0.2% (w/v) yeast extract and 1.0% (w/v) glucose (41). A 2.5 µl aliquot from an overnight culture in the presence/absence of drug was spotted at the center of the agar surface and the plates were incubated at 37°C for 24 h, and later 2 h at room temperature (42) and the diameters were measured. Three independent assays were performed.

Pyocyanin production

As described by Das et al (11) and Kalia et al (34), the pyocyanin production was assayed by collecting supernatants from overnight cultures of P. aeruginosa grown in the presence/absence of sub-MIC doses of LNA, TOB and LNA+TOB at 37°C for 24 h. A 5 ml culture supernatant was extracted with 3 ml of chloroform and then with 1 ml of 0.2 N hydrochloric acid to produce an orange-yellow to a pink colored solution which was measured at 520 nm.

LasA staphylolytic assay

In the presence/absence of LNA, TOB and LNA+TOB drugs, the ability of P. aeruginosa culture supernatants to lyse boiled Staphylococcus aureus cells were determined by LasA protease activity (11). An overnight culture of S. aureus cells (OD595 of 1.0) was centrifuged at 7,000 rpm for 3 min and the pellet was suspended in 0.02 M Tris-HCl (pH 8.5) then boiled for 10 min and diluted with the same buffer to an OD595nm of 0.8. Diluted S. aureus suspension was added to each cell-free culture supernatant of P. aeruginosa in the ratio 9:1 and the absorbance was measured at 595 nm after 0, 15, 30, 45 and 60 min.

Azocasein protease assay

The assay was performed to study the effect of protease production by C2 strain in the presence/absence of LNA, TOB and LNA+TOB. This was performed following methods published elsewhere with minor modifications (11,34). Briefly, cell-free supernatant was collected from centrifuged overnight cultures in the presence/absence of drugs at 10,000 rpm for 5 min. 150 µl of supernatant (in absence/presence of the drug) was added to 1 ml of 0.3% azocasein in 0.05 M Tris-HCl (pH 7.5) and incubated at 37°C for 15 min. The reaction was then stopped with 0.5 ml 10% trichloroacetic acid and the mixture was later centrifuged at 10,000 rpm for 5 min. The clear supernatant was collected and absorbance was measured at 420 nm.

Quantitative real-time polymerase chain reaction (qRT-PCR)

The real-time PCR reactions for quantification of Pseudomonas aeruginosa quorum sensing target genes (lasI, lasR, rhlI, rhlR,), virulence factor-related genes, and the reference gene (16S rRNA) were performed on ABI StepOne analyser using TransScript Green Two-Step qRT-PCR SuperMix kit following the manufacturer's instructions (Transgen Biotech, China) with the primers listed in Table I. Firstly, P. aeruginosa was cultured in the absence/presence of sub-MIC concentrations of LNA, TOB and LNA+TOB for 24 h at 37°C. Total RNA was then extracted using biozol total RNA extraction reagent following the manufacturer's instructions (BioFlux, China) and the concentration was measured with NanoDrop 2000C (Thermo Scientific). One microgram of the respective extracted RNA was used for cDNA synthesis using TransScript Green Two-Step qRT-PCR SuperMix kit as per manufacturer's instructions. Secondly, the synthesized cDNA was diluted ten-fold (1:10 ratio) and one microliter of diluted cDNA was mixed with 0.2 µM forward and reverse primers apiece, 10 µl of 2X TransStart Tip Green qPCR SuperMix, 1X passive reference dye I and water to a total volume of 20 µl as per instructions. The dissociation stage consisted of 94°C for 30 sec, followed by 40 cycles involving 94°C for 5 sec, 58°C for 15 sec, and 72°C for 10 sec. Target gene primers were designed to give products between 120 and 150 bp, and the 16SrRNA gene was used as an internal control. Each qRT-PCR run was performed in triplicate and three independent experiments were performed. The calculated threshold cycle (Ct) was normalized to the Ct of 16SrRNA amplified from the corresponding sample. Finally, the relative quantification of target transcripts were calculated by the comparative 2−ΔΔCt method (43).

Statistical analysis

To gain statistical significance, each experiment was performed at least in triplicate. Data values of experimental results were recorded as mean ± SEM or median with interquartile range. Significance was determined by using analysis of variance (one- and two-way), and cited as P<0.05 (*), P<0.01 (**) and P<0.001 (***). Statistical analyses were performed using GraphPad Prism 5.0 statistical software.

Results

Antimicrobial and anti-biofilm effects of linolenic acid and tobramycin on Pseudomonas aeruginosa isolates

The present study examined five clinical strains, five environmental strains, and one standard (ATCC 27853) strain. The clinical and environmental strains were identified by duplex colony PCR using intragenic primer sets for bacterial 16S rRNA and the peptidoglycan-associated lipoprotein (oprL: PA0973) gene sequences for specific detection of P. aeruginosa (data not shown).

Several reports suggest that FA of the omega-3 family are effective on various pathogenic microorganisms (22,23,25,26,44). We therefore attempted to assess the antimicrobial activity of LNA on P. aeruginosa ATCC 27853, clinical and environmental strains. The median MIC values of LNA and TOB were 1.56 and 0.3125 mg/ml, respectively. Due to this anti-pseudomonas activity, we hypothesized that LNA can affect biofilm formation when used alone or in combination with TOB. Therefore, five sub-MIC doses of LNA (1.17, 0.975, 0.78, 0.585 & 0.39 mg/ml), and 1/4th MIC (0.078 mg/ml) of TOB were selected for this study and their activity on planktonic cells were assessed through the growth curve analysis. The growth curve results showed nonsignificant results on planktonic cells (Fig. 1), but we went on to evaluate the anti-biofilm activities.

Figure 1.

Growth curve evaluation with sub-MIC concentrations on Pseudomonas aeruginosa C2 strain. Media (positive control), DMSO (solvent control), sub-MIC doses of LNA (1.17–0.39 mg/ml), and TOB (0.078 mg/ml). Each value is an average of triplicate experiments where data are presented as mean ± SEM and three independent assays were performed. TOB, tobramycin; LNA, linolenic acid.

Interestingly, the ATCC strain was highly sensitive to TOB and LNA+TOB treatment in comparison with clinical and environmental stains (Fig. 2). An identical dose dependant pattern was exhibited in LNA+TOB and LNA groups with their respective highest median inhibitory percentage being 48 and 38% (Fig. 2A). However, clinical strain C2 was noticed with extreme resistance to TOB dosage used while the rest of the strains were significantly affected (P<0.001, Fig. 2B). The moderate inhibitory effect of LNA alone or in combination (Fig. 2A) provoked further analysis of biofilm cells. We attempted to assess the metabolic effect with alarmablue staining reagent to quantify the viability of cells (37). The assay revealed a significant inactivation of biofilm cells (P<0.001, Fig. 2C); 60% inactivation with LNA+TOB involving 1.17 mg/ml dosage, 50% for LNA (1.17 mg/ml) alone and 42% for TOB alone (Fig. 2C). The slight difference between the two assays (inhibition and inactivated) was probably due to their different staining principles. Unlike alarmablue reagent, crystal violet staining does not differentiate live cells from dead cells but stains every attached biofilm cell whether live, about to die or dead ones, thus giving a slight difference between the two assays. After analyzing the inhibition and inactivation effects, P. aeruginosa clinical strain C2 was seen with more resistance especially with TOB (Fig. 2B and D). Therefore, we hypothesized that understanding the anti-biofilm action of LNA alone or in combination treatment could be better in a strain where TOB is exerting an insignificant effect. Moreover, the ATCC strain very sensitive to the selected sub-MIC doses that further dilution was required to re-establish its MIC doses (data not shown). So, clinical strain C2 was selected for microscopic evaluation, virulence factor production and gene expression with qRT-PCR.

Figure 2.

Biofilm inhibition and inactivation effects of linolenic acid, tobramycin, and LNA+TOB on P. aeruginosa strains. (A) Median inhibition percentages of all strains with respect to sub-MIC doses, (B) the inhibitory effect of TOB alone, (C) the median inactivation percentages of all strains with respect to sub-MIC doses, and (D) the inactivation effect of TOB alone are presented. The data are presented as median with interquartile ranges. LNA, linolenic acid; TOB, tobramycin; ATCC, ATCC 27853 strain; C, clinical strains; E, environmental strain; and ***P<0.001. Three independent assays were performed.

Microscopic visualization was performed with a fluorescence microscope (Olympus IX71). Images of the untreated control showed robust biofilm biomass but slightly reduced in TOB treated cells. LNA treated cells managed to reduce the biofilm formation by disintegrating the biomass while combination treatment exhibited strong inhibitory activity (Fig. 3). This effect reduced significantly in a dose-dependent manner in combined treatment groups. The findings here were in agreement with the biofilm inhibition (Fig. 2A) and inactivation (Fig. 2C) assays which also showed similar effects with reference to drug concentration used. Moreover, the interaction effect between LNA and TOB determined by the FIC index showed additive and synergistic effects on C2 strain (Table II), which could explain the strong attenuation effects of biofilm in combined treatment with reference to untreated control cells.

Figure 3.

Effects of linolenic acid, tobramycin, and LNA+TOB on biofilm formation in a 24-well plate. Biofilm cells were stained with SYTO9/PI staining solution and images were captured with a fluorescence microscope (Olympus IX71). LNA, linolenic acid; TOB, tobramycin.

Table II.

Interaction study between LNA and TOB.

Table II.

Interaction study between LNA and TOB.

P. aeruginosa strainCombined doses (LNA+TOB) (mg/ml)FIC indexInterpretation
C21.17+0.0781.00Additive
C20.78+0.0780.75Additive
C20.39+0.0780.50Synergy
Effect of linolenic acid and tobramycin on virulence factor production

P. aeruginosa is known to produce virulence factors that include pyocyanin and protease production that tends to counteract host defenses and can directly damage host tissues (45). Since virulence factor production and biofilm formation are controlled by the QS systems, we hypothesized that LNA alone or in combination with TOB can attenuate virulent factor production. So we assessed swarming motility, pyocyanin production, lasA and azocasein activities on P. aeruginosa strain C2.

Swarming motility

Swarming motility is the ability of bacteria to move across a semisolid surface and P. aeruginosa uses a flagellar motility (42) and participates in increasing production of virulence factors and antibiotic resistance (46). We found that the treated group in comparison with the untreated control inhibited the swarming movement of P. aeruginosa C2 strain (Fig. 4). Interestingly, all the sub-MIC doses used in combination and single treatment showed significant inhibition effect on swarming motility with reference to the untreated control cells of P. aeruginosa C2 strain (P<0.001, Fig. 4).

Figure 4.

Effect of linolenic acid, tobramycin, and LNA+TOB on the swarming motility of Pseudomonas aeruginosa C2 strain. (A) Each value is an average of triplicate experiments where data are presented as mean ± SEM. (B) One representative data set for three independent experiments is shown. Control, untreated; TOB, tobramycin; LNA, linolenic acid; ***P<0.001.

Virulence factor production

P. aeruginosa virulence and pathogenesis include secretion of virulence factors such as pyocyanin and pyoverdine. Pyocyanin disrupts the redox system and electron transport pathways of a host cell whereas pyoverdine is a siderophore that captures iron usually from iron-binding proteins such as ferritin, lactoferrin, and transferrin (45,47), and are important for virulence and biofilm formation (48). On the other hand, LasA protease possesses a high staphylolytic activity on cleaving the peptide bonds of pentaglycine bridges within the peptidoglycan of S. aureus cells and enhances the activity of LasB elastase in degrading the Gly-Gly peptide bonds in elastin, a component of connective tissue, blood vessels, and lung tissue (49). The effect of these virulence factors were examined in the presence/absence of sub-MIC doses of the drugs. The activity of LNA+TOB was more effective than single dose treatments (Fig. 5A-C). Therefore, combining the phenotypic findings and genotypic expression pattern, we presented the schematic diagram (Fig. 5D) illustrating the suggested targeted sites of LNA+TOB in the QS system.

Figure 5.

Effect of linolenic acid, tobramycin, and LNA+TOB on QS-regulated virulence factor production by Pseudomonas aeruginosa C2 strain. Percentage inhibition of (A) pyocyanin production, (B) LasA staphylolytic activity and (C) Azocasein protease production with respect to untreated control. (D) Schematic presentation of the activity of LNA+TOB on QS-regulated virulence factor production. Control, untreated cells; TOB, tobramycin; LNA, linolenic acid; **P<0.01 and ***P<0.001 vs. untreated control. Three independent assays were performed.

The anti-biofilm mechanism of linolenic acid, tobramycin, and LNA+TOB on P. aeruginosa C2 strain

To analyze the effects of QS genes and virulence factor-related gene expressions by P. aeruginosa C2 strain in the presence/absence of sub-MIC doses of the drugs, quantitative real-time PCR (qRT-PCR) was performed to assess the relative expression of our target genes (lasI, lasR, rhlI, rhlR, pqsH, mvfR, oprF, oprI, pilJ, algU, phzR/qscR, and lasB). For this analysis, 0.39 mg/ml (LNA) and 0.078 mg/ml (TOB) were used in single and combined treatment on C2 strain because these concentrations exhibited synergism in the interaction study as shown by the FIC index (0.5; Table II).

Quantitative RT-PCR results showed nonsignificant effects of both LNA and TOB on QS genes but their expressions reduced by −91fold (lasI; PA1432), −20 fold (lasR; PA1430), −29 fold (rhlI; PA3476) and −25 fold (rhlR; PA3477) due to LNA+TOB treatment (P<0.001; Fig. 6A). These genes are the major regulators of Las system (lasI/lasR) and Rhl system (rhlI/rhlR). In spite of these two systems, the bacterium uses another system, the Pseudomonas quinolone signal system. For this system, the activated lasR expresses mvfR that interacts with pqsABCDE loci to control the production of pqsH and 2-heptyl-4-quinolone (HHQ), and the latter is converted into 2-heptyl-3-hydroxy-4-quinolone (PQS) by pqsH (50), as depicted in Fig. 5D. The product, PQS regulates various virulence factor related genes including elastase and pyocyanin coding genes (50). Also, evidence suggests that alterations in mvfR expression disrupt PQS synthesis and pyocyanin production (51,52). In addition, mvfR mutant was shown to reduce virulence in an animal model (53). In the present study, we observed that the expression of pqsH (PA2587; P<0.001) and mvfR (PA1003; P<0.001) were downregulated by LNA+TOB whereas the cells treated with LNA or TOB showed no statistical significance (Fig. 6B). This suggested that LNA had no influence on the expression of our selected genes belonging to the three interrelated QS systems. However, due to the anti-biofilm effects that were exhibited in treatment groups (Fig. 2), we thought to assess the expression levels of oprI (PA2853), oprF (PA1777) and algU (PA0762) genes. OprF is an outer membrane protein that plays a role in maintaining the cell shape and contribute to P. aeruginosa virulence (54,55). The counterpart outer membrane protein oprI also play a part in membrane integrity and normal cell shape (56). A study by Fito-Boncompte et al (55) reported that the absence of OprF disturbs bacterial cell adhesion to animal cells, release of ExoT and ExoS toxins through the type III secretion system (T3SS), and production of the QS-associated virulence factors such as lectin PA-1 L, elastase, pyocyanin, and exotoxin A. In addition, there was reduction and retardation in production of the signalling molecules 3oxoC12HSL and C4HSL respectively in the oprF mutant. In our study, LNA+TOB reduced the expression of oprF (P<0.01) but not the outer membrane lipoprotein precursor (oprI) as compared to the untreated control (Fig. 6C). Moreover, algU is involved in regulating alginate production and inactivation of this gene increased the susceptibility of P. aeruginosa PAO1 killing by chemically generated reactive oxygen species, J774 murine macrophages and human neutrophils (57). Moreover, algU regulates rsmA expression, a posttranscriptional regulator involved in virulence factor production and biofilm formation (58). Interestingly, algU was downregulated by LNA+TOB (P<0.01) but upregulated in LNA or TOB treated groups with similar statistical magnitude (Fig. 6B). Furthermore, we selectively decided to assess the expression levels of pilJ (PA0411), phzR/qscR (PA1898) and lasB (PA3724) that contribute to bacterial virulence. We observed the downregulation of pilJ (PA0411; P<0.001) and phzR/qscR (PA1898; P<0.001) genes in LNA+TOB treated cells while LNA alone upregulated the pilJ (P<0.001) expression (Fig. 6C). Surprisingly, no statistically significant effect was noticed on lasB gene expression in all treatment groups as compared to the untreated control.

Figure 6.

Log2 fold change normalized quantification of QS- and virulence factor-related genes of Pseudomonas aeruginosa C2 strain of untreated and treated cells. (A) Key genes for Las and Rhl systems, (B) key genes for pqs system and virulence factor genes (algU and lasB genes) and (C) selected virulence factor genes. Each value is an average of triplicate experiment where data are presented as the mean ± SEM. Target gene quantification was normalized to 16SrRNA reference gene. **P<0.01, ***P<0.001 vs. untreated control. TOB, tobramycin; LNA, linolenic acid.

Discussion

Pseudomonas aeruginosa is a medically important pathogen that causes nosocomial and serious life threating infections due to its ability to produce biofilm that has contributed to the emergence of drug resistance towards currently utilized antibiotics. Considering the antimicrobial and anti-inflammatory properties of fatty acids (17,18), assessing their biofilm prevention properties on P. aeruginosa may supplement in finding alternative agents for antimicrobial resistance problem. Moreover, evidence suggest that LNA and its derivatives, EPA and DHA possess antimicrobial properties against various pathogenic microorganisms (22–26).

Biofilm formation is an active process that is dependent highly on environmental signals which sensitize a cell to undergo stages of cycle growth. This process involves production of a matrix comprising of polysaccharides, proteins, lipids and extracellular DNA (eDNA) that provide a physiological barrier to antimicrobial diffusion and concentrate secreted extracellular enzymes such as β-lactamases, whereas the limitation of oxygen and nutrients support the anaerobic growth of P. aeruginosa which decelerates cell division (2,10,59). During this stage, the bacterial community develops resistance to various antimicrobial agents, like β-lactam and aminoglycoside antibiotics that target actively and aerobically growing bacterial cells, respectively (59). Our study has shown that LNA, indeed possesses antibacterial and anti-biofilm effect against P. aeruginosa as evidenced by the MIC and biofilm inhibition/inactivation assays. We had observed that LNA alone and in combination with TOB had the ability to disrupt biofilm formation and decrease the metabolic activities of biofilm cells by causing cell death in a dose-dependent manner (Figs. 2 and 3). Besides, the stronger effects exhibited by the combined treatment suggested that LNA did not antagonize the activity of TOB but synergistically and additively exerted their combined effects on biofilm as supported by their FIC index results (Table II).

Furthermore, quorum sensing is a major player in P. aeruginosa virulence factor production and biofilm formation, making it an interesting target for an antipseudomonal compound search. Evidence has shown that inhibiting P. aeruginosa QS system disrupts biofilm formation and virulence factor production (34,60). Our study showed that LNA+TOB had a great impact in downregulating the genes associated with the three interrelated QS systems (Las, Rhl and Pqs systems) (Fig. 6A and B). Since the bacterium uses QS systems to control biofilm formation and virulence factor secretion, attempts were made to analyze some virulence factor associated genes. P. aeruginosa produces outer membrane vesicles (OMV) as a tool for genetic information and toxins dissemination (61), and they require the signaling molecule PQS for their biogenesis which accumulates in the LPS-rich outer leaflet of the outer membrane and causes bleb formation (62). Previous evidence suggests that outer membrane proteins oprI and oprF participate in OMV formation but the absence of these proteins and presence of PQS still increased OMV production by P. aeruginosa (63). This implies that PQS play a major role in OMV biogenesis making it an attractive target for anti-biofilm exploration. We have shown that LNA+TOB is capable of interfering with OMV biogenesis at gene transcription level (Fig. 6B and C). On the other hand, alginate is associated with chronic lung infection though only secreted by a subsection of P. aeruginosa species, as most strains can either secrete Psl (polysaccharide synthesis locus) or Pel (pectate lyase) polysaccharides (64,65). Our study has shown that LNA+TOB is effective in disrupting alginate production (Fig. 6B). This suggests that LNA+TOB can be effective in reducing chronicity resulting from alginate production in lung infections. Moreover, we have shown that LNA+TOB treatment can prevent swarming and twitching motility thereby reducing the spread of infection. Therefore, we can deduce that LNA+TOB is more effective in preventing biofilm formation and virulence factor production than single LNA or TOB in targeting the QS system of P. aeruginosa. This could be due to the additive and synergistic effects that may occur once the two compounds are combined.

Although tobramycin is currently used in cystic fibrosis lung infections, it fails to clear chronic infection associated with P. aeruginosa completely (66). However, various compounds combined with tobramycin had shown synergism in attenuating biofilm formation by this pathogen (67,68). Our study revealed that LNA can improved the efficacy of TOB and could be considered in P. aeruginosa related infections. In spite of the differences in the genotypic and phenotypic assays' outcomes, it is no doubt that LNA is capable of reducing biofilm formation and virulence factor production as shown from our phenotypic analyses such as biofilm, swarming, phenazine, and proteases for being affected by LNA alone. However, the mechanism is definitely not associated with QS system but perhaps utilizing a different route to cause biofilm inhibition. For that, we hypothesized that LNA could be interacting with the cell membrane, increasing the membrane fluidity thereby disrupting its permeability causing the cell to leak out as well as transporting TOB in biofilm cells (17,69), but substantialized analysis is needed. On the other hand, diet supplementation of omega-3 PUFA have been shown to improve the cardiovascular and respiratory conditions (19,70), and was reported to be safe for human use (71), suggesting that LNA supplementation may serve as an immunomodulatory and antibiotic agent.

In conclusion, the present study demonstrates that linolenic acid has the capacity to interfere with P. aeruginosa biofilm formation and virulence factor production though experimented on the C2 strain. This strain exhibited stronger resistance to the selected doses than any other strain used in this study. It is therefore not acceptable to generalize the findings of one strain with the rest. However, it is imperative to note that these findings have shown the effectiveness of a combination therapy (LNA+TOB), which should stimulate critical analysis for antimicrobial consideration. Moreover, the combination therapy has shown strong synergism in disrupting the P. aeruginosa quorum sensing systems and decreasing its virulence factor production. Therefore, it can be deduced that linolenic acid used alone can attenuate the formation of biofilm and can improve the action of tobramycin in targeting the quorum sensing systems. This may decrease tobramycin concentration when in fact treated in combination with linolenic acid (in the form of dietary supplements) thereby reducing the adverse effects of aminoglycosides. However, this study is only based on in vitro investigations that may not mimic the clinical settings. Thus, the findings here may not be conclusive but stimulate interest in considering such compounds for adjunctive therapy. Hence more studies are required, especially in vivo studies with model systems that can simulate the clinical settings to substantiate our findings.

Acknowledgements

We would like to convey our appreciation to Mr. Richardson Joseph (Ph.D. Fellow), Mr. Emeka Okoye (Ph.D. Fellow) and Dr. Brian Ayuka (MD) for reviewing this manuscript. We would like to also thank the Chinese Scholarship Council for their financial support.

References

1 

Bai AJ and Rai VR: Quorum-Sensing Systems in PseudomonasQuorum Sensing vs Quorum Quenching: A Battle with No End in Sight. Kalia VC: Springer; India: pp. 73–84. 2015

2 

Sharma G, Rao S, Bansal A, Dang S, Gupta S and Gabrani R: Pseudomonas aeruginosa biofilm: Potential therapeutic targets. Biologicals. 42:1–7. 2014. View Article : Google Scholar : PubMed/NCBI

3 

Takajo D, Iwaya K, Katsurada Y, Miyai K, Takasu A, Matsubara O, Sakamoto T, Tamai S and Tsuda H: Community-acquired lobar pneumonia caused by Pseudomonas aeruginosa infection in Japan: A case report with histological and immunohistochemical examination. Pathol Int. 64:224–230. 2014. View Article : Google Scholar : PubMed/NCBI

4 

Gharabaghi MA, Abdollahi SM, Safavi E and Abtahi SH: Community acquired Pseudomonas pneumonia in an immune competent host. BMJ Case Rep. 2012:pii: bcr0120125673. 2012. View Article : Google Scholar

5 

Stryjewski M and Sexton D: Pseudomonas aeruginosa infections in specific types of patients and clinical settingsSevere infections caused by Pseudomonas aeruginosa. Hauser AR and Rello J: Kluwer Academic Publishers; Boston: pp. 1–15. 2003, View Article : Google Scholar

6 

Caron E, Desseyn JL, Sergent L, Bartke N, Husson MO, Duhamel A and Gottrand F: Impact of fish oils on the outcomes of a mouse model of acute Pseudomonas aeruginosa pulmonary infection. Br J Nutr. 113:191–199. 2015. View Article : Google Scholar

7 

Kollef MH, Chastre J, Fagon JY, François B, Niederman MS, Rello J, Torres A, Vincent JL, Wunderink RG, Go KW and Rehm C: Global prospective epidemiologic and surveillance study of ventilator-associated pneumonia due to Pseudomonas aeruginosa. Crit Care Med. 42:2178–2187. 2014. View Article : Google Scholar

8 

Bodey GP, Bolivar R, Fainstein V and Jadeja L: Infections caused by Pseudomonas aeruginosa. Rev Infect Dis. 5:279–313. 1983. View Article : Google Scholar

9 

CDC: Antibiotic Resistance Threats in the United States, 2013. Journal. 69–70. 2013.

10 

Breidenstein EB, de la Fuente-Núñez C and Hancock RE: Pseudomonas aeruginosa: All roads lead to resistance. Trends Microbiol. 19:419–426. 2011. View Article : Google Scholar

11 

Das MC, Sandhu P, Gupta P, Rudrapaul P, De UC, Tribedi P, Akhter Y and Bhattacharjee S: Attenuation of Pseudomonas aeruginosa biofilm formation by Vitexin: A combinatorial study with azithromycin and gentamicin. Sci Rep. 6:233472016. View Article : Google Scholar

12 

Antunes LC, Ferreira RB, Buckner MM and Finlay BB: Quorum sensing in bacterial virulence. Microbiology. 156:2271–2282. 2010. View Article : Google Scholar

13 

Juhas M, Eberl L and Tümmler B: Quorum sensing: The power of cooperation in the world of Pseudomonas. Environ Microbiol. 7:459–471. 2005. View Article : Google Scholar

14 

Winzer K, Falconer C, Garber NC, Diggle SP, Camara M and Williams P: The Pseudomonas aeruginosa lectins PA-IL and PA-IIL are controlled by quorum sensing and by RpoS. J Bacteriol. 182:6401–6411. 2000. View Article : Google Scholar

15 

Lyczak JB, Cannon CL and Pier GB: Establishment of Pseudomonas aeruginosa infection: Lessons from a versatile opportunist. Microbes Infect. 2:1051–1060. 2000. View Article : Google Scholar

16 

Hancock RE and Speert DP: Antibiotic resistance in Pseudomonas aeruginosa. Mechanisms and impact on treatment. Drug Resist Updat. 3:247–255. 2000. View Article : Google Scholar

17 

Desbois AP and Smith VJ: Antibacterial free fatty acids: Activities, mechanisms of action and biotechnological potential. Appl Microbiol Biotechnol. 85:1629–1642. 2010. View Article : Google Scholar

18 

Desbois AP: Potential applications of antimicrobial fatty acids in medicine, agriculture and other industries. Recent Pat Antiinfect Drug Discov. 7:111–122. 2012. View Article : Google Scholar

19 

Olveira G, Olveira C, Acosta E, Espíldora F, Garrido-Sánchez L, García-Escobar E, Rojo-Martínez G, Gonzalo M and Soriguer F: Fatty acid supplements improve respiratory, inflammatory and nutritional parameters in adults with cystic fibrosis. Arch Bronconeumol. 46:70–77. 2010.(In English, Spanish). View Article : Google Scholar

20 

Nieuwenhove CPV, Terán V and González SN: Conjugated Linoleic and Linolenic Acid Production by Bacteria: Development of Functional FoodsProbiotics. Rigobelo EC: INTECH; 2012

21 

WHO and FAO joint consultation: fats and oils in human nutrition. Nutr Rev. 53:202–205. 1995.

22 

Sun M, Zhou Z, Dong J, Zhang J, Xia Y and Shu R: Antibacterial and antibiofilm activities of docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA) against periodontopathic bacteria. Microb Pathog. 99:196–203. 2016. View Article : Google Scholar

23 

Correia M, Michel V, Matos AA, Carvalho P, Oliveira MJ, Ferreira RM, Dillies MA, Huerre M, Seruca R, Figueiredo C, et al: Docosahexaenoic acid inhibits Helicobacter pylori growth in vitro and mice gastric mucosa colonization. PLoS One. 7:e350722012. View Article : Google Scholar

24 

Huang CB, George B and Ebersole JL: Antimicrobial activity of n-6, n-7 and n-9 fatty acids and their esters for oral microorganisms. Arch Oral Biol. 55:555–560. 2010. View Article : Google Scholar

25 

Desbois AP and Lawlor KC: Antibacterial activity of long-chain polyunsaturated fatty acids against Propionibacterium acnes Staphylococcus aureus. Mar Drugs. 11:4544–4557. 2013. View Article : Google Scholar

26 

Mil-Homens D, Bernardes N and Fialho AM: The antibacterial properties of docosahexaenoic omega-3 fatty acid against the cystic fibrosis multiresistant pathogen Burkholderia cenocepacia. FEMS Microbiol Lett. 328:61–69. 2012. View Article : Google Scholar

27 

Desbois AP, Mearns-Spragg A and Smith VJ: A fatty acid from the diatom Phaeodactylum tricornutum is antibacterial against diverse bacteria including multi-resistant Staphylococcus aureus (MRSA). Mar Biotechnol (NY). 11:45–52. 2009. View Article : Google Scholar

28 

Kaushik KS, Stolhandske J, Shindell O, Smyth HD and Gordon VD: Tobramycin and bicarbonate synergise to kill planktonic Pseudomonas aeruginosa, but antagonise to promote biofilm survival. NPJ Biofilms Microbiomes. 2:160062016. View Article : Google Scholar

29 

Zobell JT, Young DC, Waters CD, Ampofo K, Stockmann C, Sherwin CM and Spigarelli MG: Optimization of anti-pseudomonal antibiotics for cystic fibrosis pulmonary exacerbations: VI. Executive summary. Pediatr Pulmonol. 48:525–537. 2013. View Article : Google Scholar

30 

Hirsch EB and Tam VH: Impact of multidrug-resistant Pseudomonas aeruginosa infection on patient outcomes. Expert Rev Pharmacoecon Outcomes Res. 10:441–451. 2010. View Article : Google Scholar

31 

Morais-Braga MF, Souza TM, Santos KK, Guedes GM, Andrade JC, Tintino SR, Sobral-Souza CE, Costa JG, Saraiva AA and Coutinho HD: Phenolic compounds and interaction between aminoglycosides and natural products of Lygodium venustum SW against multiresistant bacteria. Chemotherapy. 58:337–340. 2012. View Article : Google Scholar

32 

Jaffe RI, Lane JD and Bates CW: Real-time identification of Pseudomonas aeruginosa direct from clinical samples using a rapid extraction method and polymerase chain reaction (PCR). J Clin Lab Anal. 15:131–137. 2001. View Article : Google Scholar

33 

CLSI: Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically; Approved Standard. 9th edition. CLSI document M07-A9. 29:17–19. 2012.

34 

Kalia M, Yadav VK, Singh PK, Sharma D, Pandey H, Narvi SS and Agarwal V: Effect of cinnamon oil on quorum sensing-controlled virulence factors and biofilm formation in Pseudomonas aeruginosa. PLoS One. 10:e01354952015. View Article : Google Scholar

35 

Borges A, Simões LC, Saavedra MJ and Simões M: The action of selected isothiocyanates on bacterial biofilm prevention and control. Int Biodeterior Biodegrad. 86:25–33. 2014. View Article : Google Scholar

36 

Stepanovic S, Vukovic D, Dakic I, Savic B and Svabic-Vlahovic M: A modified microtiter-plate test for quantification of staphylococcal biofilm formation. J Microbiol Methods. 40:175–179. 2000. View Article : Google Scholar

37 

Pettit RK, Weber CA and Pettit GR: Application of a high throughput Alamar blue biofilm susceptibility assay to Staphylococcus aureus biofilms. Ann Clin Microbiol Antimicrob. 8:282009. View Article : Google Scholar

38 

Musken M, Di Fiore S, Römling U and Häussler S: A 96-well-plate-based optical method for the quantitative and qualitative evaluation of Pseudomonas aeruginosa biofilm formation and its application to susceptibility testing. Nat Protoc. 5:1460–1469. 2010. View Article : Google Scholar

39 

Johnson MB and Criss AK: Fluorescence microscopy methods for determining the viability of bacteria in association with mammalian cells. J Vis Exp. Sep 5–2013.doi: 10.3791/50729. View Article : Google Scholar

40 

Konaté K, Mavoungou JF, Lepengué AN, Aworet-Samseny RR, Hilou A, Souza A, Dicko MH and M'batchi B: Antibacterial activity against β-lactamase producing Methicillin and Ampicillin-resistants Staphylococcus aureus. Fractional inhibitory concentration index (FICI) determination. Ann Clin Microbiol Antimicrob. 11:182012. View Article : Google Scholar

41 

Krishnan T, Yin WF and Chan KG: Inhibition of quorum sensing-controlled virulence factor production in Pseudomonas aeruginosa PAO1 by Ayurveda spice clove (Syzygium aromaticum) bud extract. Sensors (Basel). 12:4016–4030. 2012. View Article : Google Scholar

42 

Ha DG, Kuchma SL and O'Toole GA: Plate-based assay for swarming motility in Pseudomonas aeruginosa. Methods Mol Biol. 1149:67–72. 2014. View Article : Google Scholar

43 

Schmittgen TD and Livak KJ: Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 3:1101–1108. 2008. View Article : Google Scholar : PubMed/NCBI

44 

Cheng CL, Huang SJ, Wu CL, Gong HY, Ken CF, Hu SY and Wu JL: Transgenic expression of omega-3 PUFA synthesis genes improves zebrafish survival during Vibrio vulnificus infection. J Biomed Sci. 22:1032015. View Article : Google Scholar : PubMed/NCBI

45 

Gellatly SL and Hancock RE: Pseudomonas aeruginosaNew insights into pathogenesis and host defenses. Pathog Dis. 67:159–173. 2013. View Article : Google Scholar : PubMed/NCBI

46 

Overhage J, Bains M, Brazas MD and Hancock RE: Swarming of Pseudomonas aeruginosa is a complex adaptation leading to increased production of virulence factors and antibiotic resistance. J Bacteriol. 190:2671–2679. 2008. View Article : Google Scholar : PubMed/NCBI

47 

Smith KD: Iron metabolism at the host pathogen interface: Lipocalin 2 and the pathogen-associated iroA gene cluster. Int J Biochem Cell Biol. 39:1776–1780. 2007. View Article : Google Scholar : PubMed/NCBI

48 

Lamont IL, Konings AF and Reid DW: Iron acquisition by Pseudomonas aeruginosa in the lungs of patients with cystic fibrosis. Biometals. 22:53–60. 2009. View Article : Google Scholar : PubMed/NCBI

49 

Andrejko M, Zdybicka-Barabas A, Janczarek M and Cytryńska M: Three Pseudomonas aeruginosa strains with different protease profiles. Acta Biochim Pol. 60:83–90. 2013.PubMed/NCBI

50 

Diggle SP, Cornelis P, Williams P and Cámara M: 4-quinolone signalling in Pseudomonas aeruginosa: Old molecules, new perspectives. Int J Med Microbiol. 296:83–91. 2006. View Article : Google Scholar : PubMed/NCBI

51 

Gallagher LA, McKnight SL, Kuznetsova MS, Pesci EC and Manoil C: Functions required for extracellular quinolone signaling by Pseudomonas aeruginosa. J Bacteriol. 184:6472–6480. 2002. View Article : Google Scholar : PubMed/NCBI

52 

Déziel E, Lépine F, Milot S, He J, Mindrinos MN, Tompkins RG and Rahme LG: Analysis of Pseudomonas aeruginosa 4-hydroxy-2-alkylquinolines (HAQs) reveals a role for 4-hydroxy-2-heptylquinoline in cell-to-cell communication. Proc Natl Acad Sci USA. 101:1339–1344. 2004. View Article : Google Scholar : PubMed/NCBI

53 

Déziel E, Gopalan S, Tampakaki AP, Lépine F, Padfield KE, Saucier M, Xiao G and Rahme LG: The contribution of MvfR to Pseudomonas aeruginosa pathogenesis and quorum sensing circuitry regulation: Multiple quorum sensing-regulated genes are modulated without affecting lasRI, rhlRI or the production of N-acyl-L-homoserine lactones. Mol Microbiol. 55:998–1014. 2005. View Article : Google Scholar : PubMed/NCBI

54 

Rawling EG, Brinkman FS and Hancock RE: Roles of the carboxy-terminal half of Pseudomonas aeruginosa major outer membrane protein OprF in cell shape, growth in low-osmolarity medium, and peptidoglycan association. J Bacteriol. 180:3556–3562. 1998.PubMed/NCBI

55 

Fito-Boncompte L, Chapalain A, Bouffartigues E, Chaker H, Lesouhaitier O, Gicquel G, Bazire A, Madi A, Connil N, Véron W, et al: Full virulence of Pseudomonas aeruginosa requires OprF. Infect Immun. 79:1176–1186. 2011. View Article : Google Scholar : PubMed/NCBI

56 

Lin YM, Wu SJ, Chang TW, Wang CF, Suen CS, Hwang MJ, Chang MD, Chen YT and Liao YD: Outer membrane protein I of Pseudomonas aeruginosa is a target of cationic antimicrobial peptide/protein. J Biol Chem. 285:8985–8994. 2010. View Article : Google Scholar : PubMed/NCBI

57 

Yu H, Boucher JC, Hibler NS and Deretic V: Virulence properties of Pseudomonas aeruginosa lacking the extreme-stress sigma factor AlgU (sigmaE). Infect Immun. 64:2774–2781. 1996.PubMed/NCBI

58 

Stacey SD and Pritchett CL: Pseudomonas aeruginosa AlgU contributes to posttranscriptional activity by increasing rsma expression in a mucA22 strain. J Bacteriol. 198:1812–1826. 2016. View Article : Google Scholar : PubMed/NCBI

59 

Prince AS: Biofilms, antimicrobial resistance, and airway infection. N Engl J Med. 347:1110–1111. 2002. View Article : Google Scholar : PubMed/NCBI

60 

Kim HS, Lee SH, Byun Y and Park HD: 6-Gingerol reduces Pseudomonas aeruginosa biofilm formation and virulence via quorum sensing inhibition. Sci Rep. 5:86562015. View Article : Google Scholar : PubMed/NCBI

61 

Gujrati VB and Jon S: Bioengineered bacterial outer membrane vesicles: What is their potential in cancer therapy? Nanomedicine (Lond). 9:933–935. 2014. View Article : Google Scholar : PubMed/NCBI

62 

Schertzer JW and Whiteley M: A bilayer-couple model of bacterial outer membrane vesicle biogenesis. MBio. 3:pii: e00297. –11. 2012. View Article : Google Scholar : PubMed/NCBI

63 

Wessel AK, Liew J, Kwon T, Marcotte EM and Whiteley M: Role of Pseudomonas aeruginosa peptidoglycan-associated outer membrane proteins in vesicle formation. J Bacteriol. 195:213–219. 2013. View Article : Google Scholar : PubMed/NCBI

64 

Ramsey DM and Wozniak DJ: Understanding the control of Pseudomonas aeruginosa alginate synthesis and the prospects for management of chronic infections in cystic fibrosis. Mol Microbiol. 56:309–322. 2005. View Article : Google Scholar : PubMed/NCBI

65 

Franklin MJ, Nivens DE, Weadge JT and Howell PL: Biosynthesis of the Pseudomonas aeruginosa Extracellular Polysaccharides, Alginate, Pel, and Psl. Front Microbiol. 2:1672011. View Article : Google Scholar : PubMed/NCBI

66 

Price KE, Orazi G, Ruoff KL, Hebert WP, O'Toole GA and Mastoridis P: Mannitol does not enhance tobramycin killing of Pseudomonas aeruginosa in a cystic fibrosis model system of biofilm formation. PLoS One. 10:e01411922015. View Article : Google Scholar : PubMed/NCBI

67 

Furiga A, Lajoie B, El Hage S, Baziard G and Roques C: Impairment of Pseudomonas aeruginosa biofilm resistance to antibiotics by combining the drugs with a new quorum-sensing inhibitor. Antimicrob Agents Chemother. 60:1676–1686. 2015. View Article : Google Scholar : PubMed/NCBI

68 

Anderson GG, Kenney TF, Macleod DL, Henig NR and O'Toole GA: Eradication of Pseudomonas aeruginosa biofilms on cultured airway cells by a fosfomycin/tobramycin antibiotic combination. Pathog Dis. 67:39–45. 2013. View Article : Google Scholar : PubMed/NCBI

69 

Lawrence GD: The Fats of Life: Essential Fatty Acids in Health and Disease. Rutgers University Press; 2010

70 

Pontes-Arruda A, Martins LF, de Lima SM, Isola AM, Toledo D, Rezende E, Maia M and Magnan GB: Investigating Nutritional Therapy with EPA, GLA and Antioxidants Role in Sepsis Treatment (INTERSEPT) Study Group: Enteral nutrition with eicosapentaenoic acid, γ-linolenic acid and antioxidants in the early treatment of sepsis: Results from a multicenter, prospective, randomized, double-blinded, controlled study: The INTERSEPT study. Crit Care. 15:R1442011. View Article : Google Scholar : PubMed/NCBI

71 

Chen W, Jiang H, Zhou ZY, Tao YX, Cai B, Liu J, Yang H, Lu CD and Zeng J: Is omega-3 fatty acids enriched nutrition support safe for critical ill patients? A systematic review and meta-analysis. Nutrients. 6:2148–2164. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Chanda W, Joseph TP, Padhiar AA, Guo X, Min L, Wang W, Lolokote S, Ning A, Cao J, Huang M, Huang M, et al: Combined effect of linolenic acid and tobramycin on Pseudomonas aeruginosa biofilm formation and quorum sensing. Exp Ther Med 14: 4328-4338, 2017.
APA
Chanda, W., Joseph, T.P., Padhiar, A.A., Guo, X., Min, L., Wang, W. ... Zhong, M. (2017). Combined effect of linolenic acid and tobramycin on Pseudomonas aeruginosa biofilm formation and quorum sensing. Experimental and Therapeutic Medicine, 14, 4328-4338. https://doi.org/10.3892/etm.2017.5110
MLA
Chanda, W., Joseph, T. P., Padhiar, A. A., Guo, X., Min, L., Wang, W., Lolokote, S., Ning, A., Cao, J., Huang, M., Zhong, M."Combined effect of linolenic acid and tobramycin on Pseudomonas aeruginosa biofilm formation and quorum sensing". Experimental and Therapeutic Medicine 14.5 (2017): 4328-4338.
Chicago
Chanda, W., Joseph, T. P., Padhiar, A. A., Guo, X., Min, L., Wang, W., Lolokote, S., Ning, A., Cao, J., Huang, M., Zhong, M."Combined effect of linolenic acid and tobramycin on Pseudomonas aeruginosa biofilm formation and quorum sensing". Experimental and Therapeutic Medicine 14, no. 5 (2017): 4328-4338. https://doi.org/10.3892/etm.2017.5110
Copy and paste a formatted citation
x
Spandidos Publications style
Chanda W, Joseph TP, Padhiar AA, Guo X, Min L, Wang W, Lolokote S, Ning A, Cao J, Huang M, Huang M, et al: Combined effect of linolenic acid and tobramycin on Pseudomonas aeruginosa biofilm formation and quorum sensing. Exp Ther Med 14: 4328-4338, 2017.
APA
Chanda, W., Joseph, T.P., Padhiar, A.A., Guo, X., Min, L., Wang, W. ... Zhong, M. (2017). Combined effect of linolenic acid and tobramycin on Pseudomonas aeruginosa biofilm formation and quorum sensing. Experimental and Therapeutic Medicine, 14, 4328-4338. https://doi.org/10.3892/etm.2017.5110
MLA
Chanda, W., Joseph, T. P., Padhiar, A. A., Guo, X., Min, L., Wang, W., Lolokote, S., Ning, A., Cao, J., Huang, M., Zhong, M."Combined effect of linolenic acid and tobramycin on Pseudomonas aeruginosa biofilm formation and quorum sensing". Experimental and Therapeutic Medicine 14.5 (2017): 4328-4338.
Chicago
Chanda, W., Joseph, T. P., Padhiar, A. A., Guo, X., Min, L., Wang, W., Lolokote, S., Ning, A., Cao, J., Huang, M., Zhong, M."Combined effect of linolenic acid and tobramycin on Pseudomonas aeruginosa biofilm formation and quorum sensing". Experimental and Therapeutic Medicine 14, no. 5 (2017): 4328-4338. https://doi.org/10.3892/etm.2017.5110
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team