Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
January-2018 Volume 15 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2018 Volume 15 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Resveratrol attenuates type 2 diabetes mellitus by mediating mitochondrial biogenesis and lipid metabolism via Sirtuin type 1

  • Authors:
    • Ming‑Ming Cao
    • Xi Lu
    • Guo‑Dong Liu
    • Ying Su
    • Yan‑Bo Li
    • Jin Zhou
  • View Affiliations / Copyright

    Affiliations: Department of Endocrinology, The First Affiliated Hospital of Harbin Medical University, Harbin, Heilongjiang 150001, P.R. China, Department of Gastroenterology, The First Affiliated Hospital of Harbin Medical University, Harbin, Heilongjiang 150001, P.R. China, Department of Hematology, The First Affiliated Hospital of Harbin Medical University, Harbin, Heilongjiang 150001, P.R. China
  • Pages: 576-584
    |
    Published online on: October 30, 2017
       https://doi.org/10.3892/etm.2017.5400
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The rising incidence of type 2 diabetes mellitus (T2DM) is a major public health problem and novel therapeutic strategies are required to prevent and treat T2DM. It has been demonstrated that resveratrol (RSV) may prevent T2DM by targeting Sirtuin type 1 (SIRT1), indicating that SIRT1 may be a novel therapeutic target for T2DM prevention. In the present study, a T2DM rat model was established by administering a high fat diet and streptozotocin (STZ) injections. Measurements of blood glucose and insulin confirmed successful establishment of the T2DM model. RSV was used to treat rats with STZ‑induced T2DM and the results indicated that RSV reversed the STZ‑induced downregulation of peroxisome proliferator‑activated receptor‑γ coactivator‑1α, SIRT1 and forkhead box protein O 3a. Furthermore, RSV modulated the activity of superoxide dismutase and malondialdehyde, which are associated with oxidative stress. In vitro, cells from the insulinoma cell line clone 1E were pretreated with palmitic acid (PA) to simulate a high fat environment. The results of reverse transcription‑quantitative polymerase chain reaction indicated that PA suppressed the expression of SIRT1 in a dose‑ and time‑dependent manner. Furthermore, PA modulated the expression of mitochondrial biogenesis‑associated, lipid metabolism‑associated and β‑cell‑associated genes, whereas RSV treatment ameliorated the PA‑induced changes in the expression of these genes via SIRT1. The results of the present study suggest that RSV participates in the prevention of T2DM by regulating the expression of mitochondrial genes associated with biogenesis, lipid metabolism and β‑cells via SIRT1. The results of the current study provide an insight into the mechanisms by which SIRT1 inhibits T2DM and may be used as a basis for future studies.

Introduction

Due to rapid economic development and continuous improvements in living standards, the prevalence of diabetes is increasing worldwide (1). Type 2 diabetes mellitus (T2DM) is a complex metabolic disorder caused by insulin (INS) resistance and insufficient compensatory INS secretion (2). T2DM greatly increases the risk of chronic kidney disease, cardiovascular disease, myocardial infarction and stroke (3); therefore, more effective treatments and novel prevention strategies for T2DM are required (4). The mechanisms of T2DM action, including lipid metabolism disorders, endothelial dysfunction, chronic inflammation and redox homeostasis imbalance, have previously been described (5). β-cells dysfunction contributes to inadequate INS secretion, which is the ultimate cause of T2DM (6). It has been demonstrated that high levels of free fatty acids or hypertriglyceridemia and lipid ectopic deposition in non adipose tissue are key factors contributing to the development of T2DM (7). Total β-cells function is determined by the number of β-cellss and their functionality. Establishing an effective therapy to decrease β-cells lipid toxicity may be beneficial for the treatment of T2DM.

The progression of T2DM is associated with changes in several factors, including mitochondrial biogenesis, lipid metabolism and β-cells development (5). A number of proteins, including mitochondrial biogenesis-related nuclear respiratory factor (NRF), mitochondrial transcription factor A (mtTFA), lipid metabolism-associated carnitine palmitoyltransferase 1 (CPT-1), acetyl-CoA carboxylase (ACC), long-chain acyl-CoA dehydrogenase (LCAD), β-cells-associated pancreatic duodenal homeobox-1 gene (PDX-1), mid-arm fat area (MAFA) (8) and INS, are associated with T2DM (9). Resveratrol (RSV), a natural polyphenol found in grapes and red wine (10), may potentially attenuate hepatic steatosis and reduce the risk of patients developing T2DM (11). It has previously been demonstrated that RSV activates Sirtuin type 1 (SIRT1) to inhibit the development of T2DM (12). SIRT1 is a nuclear NAD+-dependent class III histone deacetylase that may regulate cell aging, life span and energy metabolism (13) by engaging in the reciprocal co-regulation of different binding partners (14). SIRT1 is able to adjust the deacetylase activity of various transcription factors that control metabolic and endocrine signals and is widely involved in regulating the mammalian cell life span, INS secretion and glucose/lipid metabolism (15). Genetic variation in the SIRT1 gene is associated with INS resistance and may explain the increased risk of T2DM in the Chinese Han population (16). SIRT1 may have a therapeutic effect on metabolic deterioration in T2DM (17) and in the liver, SIRT1-knockout increases plasma glucose levels, reduces INS sensitivity and upregulates free fatty acid and cholesterol levels (18). To explore the association between SIRT1 and mitochondrial biogenesis, it is essential to assess lipid metabolism and β-cells development and identify the underlying mechanisms by which RSV alleviates T2DM.

In the present study, a T2DM rat model was constructed following the administration of a high fat diet and streptozotocin (STZ) injections into the abdominal cavity of rats. It was determined that the T2DM model was successfully constructed following the assessment of glucose and INS levels. The results indicated that RSV treatment effectively modulated glucose and INS levels as well as the expression of SIRT1, peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α), and forkhead box protein O3 (FOXO3a). In addition, the insulinoma cell line clone 1E (INS-1E) was treated with palmitic acid (PA). PA suppressed the expression of SIRT1 in a dose- and time-dependent manner. In PA-induced INS-1E cells, it was demonstrated that RSV modulated the expression of PGC-1α and FOXO3a via SIRT1 and regulated the expression of mitochondrial biogenesis-associated, lipid metabolism-associated and β-cells-associated proteins. These results provide novel evidence that RSV mitigates T2DM via SIRT1 and identified the mechanisms by which SIRT1 inhibits T2DM.

Materials and methods

Animals

A total of 30 male Sprague-Dawley (SD) rats (6–8 weeks old) weighing 200±20 g were purchased from Hunan SJA Laboratory Animal Co., Ltd. (Changsha, China). Rats were housed at 24±1°C with 40–50% humidity in a clean environment with a 12 h light/dark cycle. All animals had free access to food and purified water. All procedures were approved by the Animal Ethics Committee of the First Affiliated Hospital of Harbin Medical University (Harbin, China). Rats were fed with a high glucose, high fat diet (60% common chow, 10% lard, 10% egg yolk powder and 20% sucrose) for 8 weeks. Rats then received a 40 mg/kg intraperitoneal injection of STZ (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) once. At 72 h following STZ injection, rats with fasting blood glucose ≥16.67 mM (based on tail vein samples) were selected as T2DM animals for use in the following experiments (19). The normal control group (NC, n=10) was administered the same volume of sodium citrate buffer instead of STZ. T2DM rats were randomly assigned to either a diabetic group (DM, n=10) or a diabetic RSV group (DR, n=10). Rats in the DR group were administered once with 30 mg/kg RSV intragastrically (Sigma-Aldrich; Merck KGaA). Rats in the NC and DM groups were administered intragastrically with the same amount of 0.5% carboxymethyl cellulose. At weeks 0, 4 and 8 following induction, fasting and 2 h postprandial blood glucose were measured using the glucose oxidase method on the Beckman Glucose Analyzer II (Beckman Coulter, Inc., Brea, CA, USA) and plasma INS levels were determined using an RIA Assay system (Linco Research, Inc., St. Charles, MO, USA) (20) according to the manufacturer's protocol. Following 8 weeks of different treatments, total RNA was isolated from rat pancreas tissues using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA), and proteins were extracted using radioimmunoprecipitation assay buffer (RIPA; Beyotime Institute of Biotechnology, Haimen, China) for western blot analysis.

Cell culture and grouping

The rat insulinoma cell line clone 1E (INS-1E; provided by Professor Pierre Maechler; CMU; University of Geneva, Geneva, Switzerland) was cultured at 37°C in a humidified atmosphere containing 5% CO2 in RPMI 1640 medium (HyClone; GE Healthcare Life Sciences, Logan, UT, USA) supplemented with 10% fetal bovine serum (FBS; Sigma-Aldrich; Merck KGaA), 11 mM glucose, 10 mM HEPES, 1 mM sodium pyruvate, 50 µM 2-mercaptoethanol (Sigma-Aldrich; Merck KGaA), 50 µg/ml penicillin and 100 µg/ml streptomycin. When density reached 80%, cells were pretreated with PA (0, 0.125, 0.25, 0.5, or 1 mM) for 24 h. INS-1E cells were treated with 0.5 mM PA for 0, 12, 24, 48 or 72 h.

Cell transfection

INS-1E cells were seeded into 6-well plates at a density of 5×105 cells/well and divided into 5 groups: A normal control (NC) group, a high fat (HF) group, a HF+RSV group, a HF+RSV+SIRT small interfering (si)RNA group (HF+RSV+SIRT siRNA) and a HF+RSV+negative control siRNA group (HF+RSV+NC siRNA). To transfect cells with SITR siRNA or NC siRNA, cells in the HF+RSV+SIRT siRNA and HF+RSV+NC siRNA groups were incubated in 1 ml RPMI 1640 with SIRT1 siRNA (5′-CACCCCAGCAACTCAGCATTCATCGAAATGAATGCTGAGTTGCTGG-3′) or NC siRNA (5′-TTCTCCGAACGTGTCACGT-3′), respectively, and Lipofectamine 2000 (Thermo Fisher Scientific, Inc.) without FBS. The final concentrations of siRNA and Lipofectamine 2000 used were 2 and 4 µg/ml, respectively. Following 48 h incubation at 37°C, cells in the HF+RSV, HF+RSV+SIRT siRNA and HF+RSV+NC siRNA groups were treated with 0.5 mM PA+10 µM RSV. The HF group received the same amount of PA and NC cells were treated with the same amount of vehicle. Following 24 h incubation at 37°C, total RNA or proteins were extracted for further experiments.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was isolated from INS-1E cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) following the manufacturer's protocol. The quality of RNA was determined by agarose electrophoresis and the concentration was measured using a NanoDrop ND-2000 spectrophotometer (Thermo Fisher Scientific, Inc., Pittsburgh, PA, USA) at 260 nm and 280 nm. RT was performed using 1 µg total RNA using a reverse transcriptase cDNA synthesis kit (Takara Biotechnology Co., Ltd., Dalian, China) according to the manufacturer's protocol. qPCR was performed using SYBR-Green qPCR SuperMix (Invitrogen; Thermo Fisher Scientific, Inc.) on a real-time RT-PCR system (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The thermocycling conditions were as follows: 94°C for 5 min followed by 35 cycles of 94°C for 30 sec, 56°C for 30 sec and 72°C for 30 sec, with a final elongation step at 72°C for 5 min. All amplification reactions were performed in triplicate and the relative expression of target genes were normalized against β-actin using the 2−∆∆Cq method (21). The primers for RT-qPCR are presented in Table I.

Table I.

Primers used for reverse transcription-quantitative polymerase chain reaction.

Table I.

Primers used for reverse transcription-quantitative polymerase chain reaction.

GenesForward primers (5′-3′)Reverse primers (5′-3′)
SIRT1 GCTGACGACTTCGACGACG TCGGTCAAGAGGAGGTTGTCT
PGC1α TATGGAGTGACATAGAGTGTGCT GTCGCTACACCACTTCAATCC
NRF CGGAAACGGCCTCATGTGT CGCGTCGTGTACTCATCCAA
FOXO3a TCTTACGCCGACCTCATCAC ACGCTCTTGACCATCCACT
INS CCCTGTTGGTGCACTTCCT TCCCAGCTCCAGTTGTTCC
mtTFA TATTAGAATTTGTTAAATTTTGGGGAAT ACAAACAATCCTACATCCAAAACC
ACC CACATCATGAAGGAGGAGG GCTATCACACAGCCTGGGTC
CPT-1 ACGGGTGGATGTTCGAGATG GGCAGTGACGTTTGGAAGCT
LCAD TTCGTGTCCTGAGCG GAGGCTAATGCCATG
PDX-1 GTTCATCTCCCTTTCCCGTGG GGTGGTGGCTTTGGCAATG
MAFA AAAGCGGTGCTGGAGGAT GGTTCAGGTGGTGCTGGTA
β-actin CCTCTATGCCAACACAGTGC GTACTCCTGCTTGCTGATCC

[i] SIRT1, Sirtuin 1; PGC1α, peroxisome proliferator-activated receptor-γ coactivator-1α; NRF, nuclear respiratory factor; FOXO3a, forkhead box O3a; INS, insulin; mtTFA, mitochondrial transcription factor A; ACC, acetyl-CoA carboxylase; CPT-1, lipid metabolism-related carnitine palmitoyltransferase 1; LCAD, long-chain acyl-CoA dehydrogenase; PDX-1, pancreatic duodenal homeobox-1; MAFA, mid-arm fat area.

Western blotting

Proteins were extracted from rat pancreatic tissues or INS-1E cells using RIPA buffer (Beyotime Institute of Biotechnology, Haimen, China) and centrifuged at 15,000 × g for 30 min at 4°C. The concentration of proteins was determined using a bicinchoninic acid kit (Pierce; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. Equal amounts of protein (25 µg/lane) were subjected to 12.5% SDS-PAGE. Proteins were subsequently electrotransferred to a polyvinylidene fluoride membrane and blocked with 5% non-fat milk in Tris-buffered saline with 0.05% Tween-20 (TBST) for 1 h at room temperature. The membrane was incubated with mouse anti-SIRT1 (sc-15404), anti-FOXO3a (sc-20680), anti-PGC-1α (sc-13067) and anti-β-actin (sc-1616) antibodies (all 1:1,000 dilution; all from Santa Cruz Biotechnology, Inc., Dallas, TX, USA) overnight at 4°C. Following three washes with TBST, the membrane was incubated with horseradish peroxidase-conjugated rabbit anti-mouse secondary antibody (1:2,000; sc-203; Santa Cruz Biotechnology, Inc.) for 1 h at room temperature. Membrane bands were developed using an enhanced chemiluminescence kit (Pierce; Thermo Fisher Scientific, Inc.). The relative densities of target protein bands were normalized against β-actin using Quantity One software v4.4 (Bio-Rad Laboratories, Inc.).

Detection of serum superoxide dismutase (SOD) and malondialdehyde (MDA)

Total heart blood was harvested from rats following 8 weeks of different treatments and centrifuged at 3,500 × g for 15 min at 4°C to separate the serum. Serum SOD (cat. no. SES134Hu) and MDA (cat. no. CEA597Ge) levels were detected using a commercially available sandwich ELISA kit (Cloud-Clone Corp., Katy, TX, USA) according to the manufacturer's protocol. Absorbance was measured at 450 nm on Bio-Rad 680 Microplate reader (Bio-Rad Laboratories, Inc.). The quantity of SOD and MDA in the serum was estimated using a constructed calibration curve.

Statistical analysis

All statistical analyses were performed using SPSS 17.0 (SPSS, Inc., Chicago, IL, USA). All results are presented as the mean ± standard error of the mean. Significant differences in mean values were evaluated using one-way analysis of variance with Tukey's post hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

RSV treatment decreases blood glucose and INS levels in rats with STZ-induced DM

To confirm that the diabetic rat model was successfully established, blood glucose levels were measured following STZ injection. No significant differences in blood glucose levels were observed in the NC group at weeks 0, 4 or 8 (Table II). Compared with the NC group, fasting glucose levels in the DM group were significantly higher at week 8 (P<0.05; Table II). However, the administration of RSV significantly attenuated the STZ-induced increase in fasting glucose (P<0.05; Table II). The 2 h postprandial blood glucose levels were subsequently assessed. At weeks 4 and 8 post-induction, postprandial blood glucose was significantly higher in the DM group compared with the NC group (P<0.01; Table II); however, in the DR group, this increase was significantly attenuated (P<0.01; Table II).

Table II.

Fasting and 2 h postprandial blood glucose levels at weeks 0, 4 and 8 following induction of diabetes.

Table II.

Fasting and 2 h postprandial blood glucose levels at weeks 0, 4 and 8 following induction of diabetes.

Blood glucose (mM)

GroupTime (weeks)Fasting2 h postprandial
NC0 5.86±0.51 6.14±0.62
4 5.91±0.64 6.24±0.64
8 5.74±0.49 6.05±0.59
DM0 5.79±0.41 6.11±0.61
4 6.45±0.62 15.98±0.71b
8 7.97±0.71a 22.36±1.14b
DR0 5.84±0.47 6.31±0.61
4 6.24±0.59 12.36±0.89d
8 7.01±0.68c 13.59±0.97d

a P<0.05

b P<0.01 vs. NC group

c P<0.05

d P<0.01 vs. DM group. NC, normal control group; DM, streptozotocin-induced diabetic group; DR, RSV treated streptozotocin-induced diabetic group.

The fasting and 2 h postprandial levels of INS were also assessed. Compared with the NC group, fasting and 2 h postprandial blood INS levels were significantly elevated in the DM group at weeks 4 and 8 (P<0.05; Table III). However, INS levels in the DR group were significantly lower at week 8 compared with the DM group (P<0.05; Table III). Taken together, these results suggest that STZ injection successfully induced DM in rats and that RSV administration modulated glucose and INS levels in rats with STZ-induced DM.

Table III.

Fasting and 2 h postprandial blood insulin levels at weeks 0, 4 and 8 following induction of diabetes.

Table III.

Fasting and 2 h postprandial blood insulin levels at weeks 0, 4 and 8 following induction of diabetes.

Blood insulin (ng/ml)

GroupTime (weeks)Fasting2 h postprandial
NC0 1.21±0.14 1.14±0.07
4 1.24±0.14 1.16±0.09
8 1.29±0.49 1.15±0.09
DM0 1.25±0.11 1.11±0.06
4 1.45±0.12a 1.37±0.11a
8 1.56±0.11a 1.47±0.14a
DR0 1.24±0.07 1.17±0.09
4 1.32±0.09 1.35±0.09
8 1.35±0.08b 1.37±0.07b

a P<0.05 vs. NC group

b P<0.05 vs. DM group. NC, normal control group; DM, streptozotocin-induced diabetic group; DR, RSV treated streptozotocin-induced diabetic group.

RSV modulates the expression of PGC-1α, SIRT1 and FOXO3a in the pancreatic tissues of rats with STZ-induced DM

To investigate the mechanism by which RSV functions in DM, levels of PGC-1α, SIRT1 and FOXO3a mRNA and protein were assessed using RT-qPCR and western blotting, respectively. Compared with the NC group, levels of PGC-1α, SIRT1 and FOXO3a mRNA and protein were significantly suppressed in the DM group (P<0.01; Fig. 1A and B). However, pretreatment with RSV significantly attenuated these decreases (P<0.05; Fig. 1A and B). These data suggest that RSV administration upregulates PGC-1α, SIRT1 and FOXO3a expression in mice with STZ-induced DM.

Figure 1.

(A) RSV modulates PGC-1α, SIRT1 and FOXO3a (A) mRNA and (B) protein levels as assessed by reverse transcription-quantitative polymerase chain reaction and western blotting, respectively. β-actin was used as an internal control. Pretreatment with RSV affected the activity of (C) SOD and (D) MDA as analyzed using ELISA. *P<0.05 and **P<0.01. RSV, resveratrol; PGC1α, peroxisome proliferator-activated receptor-γ coactivator-1α; SIRT1, Sirtuin 1; FOXO3a, forkhead box O3a; SOD, superoxide dismutase; MDA, malondialdehyde; NC, normal control group; DM, streptozotocin-induced diabetic group; DR, RSV treated streptozotocin-induced diabetic group; RSV, resveratrol.

It has been reported that oxidaωtive stress due to the excessive production of reactive oxygen species (ROS) and mitochondrial dysfunction are major factors in the development of INS resistance in T2DM (22). ELISA assays were used to analyze the activity of SOD and MDA to evaluate oxidative stress. SOD activity was significantly suppressed in the DM group compared with the NC group (P<0.01; Fig. 1C). However, RSV treatment significantly increased SOD activity in the DR group compared with the DM group (P<0.05; Fig. 1C). By contrast, MDA activity was significantly upregulated in the DM group compared with the NC group (P<0.01; Fig. 1D). In the DR group, pretreatment with RSV significantly attenuated the DM-induced increase in MDA activity (P<0.05; Fig. 1D). These data suggest that RSV regulates the activity of SOD and MDA in rats with STZ-induced DM.

PA inhibits the expression of SIRT1 in a dose- and time-dependent manner

It has been demonstrated that PA serves a role in the development of obesity and T2DM (17). Varying concentrations of PA were used to treat INS-1E cells and the results indicated that PA significantly suppressed SIRT1 mRNA in a dose-dependent manner (P<0.01; Fig. 2A). The association between SIRT1 expression and PA induction time was subsequently investigated and the results indicate that PA treatment also significantly reduced SIRT1 mRNA expression in a time-dependent manner (P<0.01; Fig. 2B).

Figure 2.

PA suppressed the expression of SIRT1 in a dose- and time-dependent manner. (A) INS-1E cells were treated with 0, 0.125, 0.25, 0.5 and 1 mM PA for 24 h and the expression of SIRT1 mRNA was assessed using RT-qPCR. **P<0.01 vs. 0 mM PA (B) INS-1E cells were pretreated with 0.5 mM PA for 0, 12, 24, 48 and 72 h, respectively and SIRT1 mRNA was measured using RT-qPCR. β-actin was used as an internal control. **P<0.01 vs. 0 h. PA, palmitic acid; SIRT1, Sirtuin 1; INS-1E, insulinoma cell line clone 1E; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.

RSV affects the expression of PGC-1α and FOXO3a via SIRT1 in PA-induced INS-1E cells

To further investigate the role of RSV in vitro, levels of PGC-1α, SIRT1 and FOXO3a in INS-1E cells were evaluated. PA significantly suppressed the levels of PGC-1α, SIRT1 and FOXO3a mRNA and protein compared with the NC group (P<0.01; Fig. 3A-C); however, administration of RSV significantly attenuated this effect (P<0.01; Fig. 3A-C). Furthermore, transfection with SIRT1 siRNA in conjunction with PA significantly reduced the expression of PGC-1α, SIRT1 and FOXO3a compared with the HF+RSV+NC siRNA group (P<0.01; Fig. 3A-C). These data suggest that RSV mitigates the HF-induced inhibition of PGC-1α and FOXO3a expression via SIRT1.

Figure 3.

RSV modulates the expression of mitochondrial biogenesis-related, lipid metabolism-related and β-cells-related genes via SIRT1 in INS-1E cells. (A) mRNA and (B) protein levels of PGC-1α and FOXO3a in INS-1E cells. (C) The relative densities of target protein bands were normalized against β-actin. **P<0.01. SIRT1, Sirtuin 1; PGC1α, peroxisome proliferator-activated receptor-γ coactivator-1α; FOXO3a, forkhead box O3a; NC, normal INS-1E cells pretreated with vehicle; HF, INS-1E cells incubated with 0.5 mM PA for 24 h; HF+RSV, INS-1E cells incubated with 0.5 mM PA and 10 µM RSV for 24 h; HF+RSV+SIRT siRNA, INS-1E cells transfected with SIRT1 siRNA for 48 h and incubated with PA 0.5 µM and 10 µM RSV for 24 h; HF+RSV+NC siRNA, INS-1E cells transfected with negative control siRNA for 48 h and incubated with PA 0.5 mM and 10 µM RSV for 24 h.

To examine the mechanism by which SIRT1 functions, the expression of a cascade of genes was investigated, including mitochondrial biogenesis-associated NRF and mtTFA, lipid metabolism-associated CPT-1, ACC and LCAD, and β-cells-associated PDX-1, MAFA and INS. PA treatment significantly suppressed mRNA levels of SIRT1, NRF, mtTFA, CPT-1, LCAD, PDX-1, MAFA and INS mRNA, whereas it significantly upregulated the expression of ACC mRNA compared with the NC group (P<0.01; Fig. 4). Treatment with RSV significantly attenuated these PA-induced alterations in gene expression (P<0.01; Fig. 4). However, SIRT1 knockdown significantly attenuated the PA-induced increases in SIRT1, NRF, mtTFA, CPT-1, LCAD, PDX-1, MAFA and INS expression as well as the PA-induced decrease in ACC expression compared with the HF+RSV+NC siRNA group (P<0.01; Fig. 4). These data suggest that RSV modulates the expression of NRF, mtTFA, CPT-1, LCAD, PDX-1, MAFA and INS via SIRT1 in PA-induced INS-1E cells.

Figure 4.

RSV regulated the levels of mitochondrial biogenesis-associated, lipid metabolism-associated and β-cells-associated genes via SIRT1. **P<0.01. SIRT1, Sirtuin 1; INS-1E, insulinoma cell line clone 1E; PGC1α, peroxisome proliferator-activated receptor-γ coactivator-1α; FOXO3a, forkhead box O3a; NC, normal INS-1E cells pretreated with vehicle; HF, INS-1E cells incubated with 30 mM PA for 24 h; HF+RSV, INS-1E cells incubated with 30 mM PA and 10 µm RSV for 24 h; HF+RSV+SIRT siRNA, INS-1E cells transfected with SIRT1 siRNA for 48 h and incubated with PA 30 mM and 10 µm RSV for 24 h; HF+RSV+NC siRNA, INS-1E cells transfected with negative control siRNA for 48 h and incubated with PA 30 mM and 10 µm RSV for 24 h; NRF, nuclear respiratory factor; mtTFA, mitochondrial transcription factor A; ACC, acetyl-CoA carboxylase; CPT-1, lipid metabolism-related carnitine palmitoyltransferase 1; LCAD, long-chain acyl-CoA dehydrogenase; PDX-1, pancreatic duodenal homeobox-1; MAFA, mid-arm fat area; INS, insulin; siRNA, small interfering RNA.

RSV affects the expression of SOD and MDA via SIRT1 in PA-induced INS-1E cells

The expression of SOD and MDA mRNA in INS-1E cells following SIRT1 knockdown was assessed to determine the effect of SIRT1 on oxidative stress. Compared with the NC group, PA significantly suppressed SOD mRNA expression (P<0.01; Fig. 5A) and RSV treatment significantly reversed this effect (P<0.01; Fig. 5A). However, SIRT1 knockdown significantly decreased SOD expression compared with the HF+RSV+NC siRNA group (P<0.01; Fig. 5A). The administration of PA significantly increased MDA expression compared with the NC group (P<0.01; Fig. 5B) and RSV significantly attenuated this upregulation (P<0.01; Fig. 5B). SIRT1 knockdown significantly upregulated MDA mRNA expression compared with the HF+RSV+NC siRNA group (P<0.01; Fig. 5B). These data indicate that RSV regulates SOD and MDA levels via SIRT1 in PA-treated INS-1E cells.

Figure 5.

RSV regulates SOD and MDA mRNA levels via SIRT1 in INS-1E cells. The relative expression of (A) SOD and (B) MDA was normalized to β-actin in PA-induced INS-1E cells. **P<0.01. RSV, resveratrol; SOD, superoxide dismutase; MDA, malondialdehyde; SIRT1, Sirtuin 1; INS-1E, insulinoma cell line clone 1E; NC, normal INS-1E cells pretreated with vehicle; HF, INS-1E cells incubated with 30 mM PA for 24 h; HF+RSV, INS-1E cells incubated with 30 mM PA and 10 µm RSV for 24 h; HF+RSV+SIRT siRNA, INS-1E cells transfected with SIRT1 siRNA for 48 h and incubated with PA 30 mM and 10 µm RSV for 24 h; HF+RSV+NC siRNA, INS-1E cells transfected with negative control siRNA for 48 h and incubated with PA 30 mM and 10 µm RSV for 24 h; siRNA, small interfering RNA.

Discussion

Over the past few decades, the incidence and prevalence of DM have increased worldwide, primarily due to the increased incidence of T2DM (17). As such, there is a need to develop additional treatments and novel prevention strategies for T2DM. In the present study, a rat model of STZ-induced DM was constructed and the therapeutic effects of RSV were assessed. Furthermore, PA-induced INS-1E cells were assessed in vitro to investigate the underlying molecular mechanisms of T2DM. The results of the present study indicate that RSV mitigates the development of T2DM via SIRT1 by modulating mitochondrial biogenesis, lipid metabolism and β-cells development.

Abdominal injection of STZ is a widely used technique for DM modeling (23). In the present study, glucose and INS levels were assessed following STZ administration. It was demonstrated that glucose and INS levels were significantly upregulated, indicating that the DM model was constructed successfully. The administration of RSV attenuated the DM-induced alterations in glucose and INS levels, suggesting that RSV mitigates T2DM. These data were similar to those obtained from a previous study (11) and support the use of RSV as a potential glucose-lowering agent in T2DM. Furthermore, the results of an in vivo study indicated that RSV increases SIRT1 expression and stimulates PGC-1a activity in skeletal muscle (24). The results of the present study demonstrate that RSV is able to mitigate the STZ-induced inhibition of SIRT1, PGC-1α and FOXO3a, which is in accordance with previous results (25–27). A number of previous studies have reported that INS resistance is associated with mitochondrial dysfunction (22) and these results may be caused by oxidative stress (28). PGC-1α stimulates mitochondrial biogenesis and electron transport activity to suppress ROS production and ROS levels are also affected by MDA. Furthermore, FOXO3a serves a central role in controlling oxidative stress (29). SOD is an antioxidant enzyme and to a certain extent, SOD levels represent the level of oxidative stress (30). The results of the present study indicated that MDA activity in rats with DM was higher compared with the NC group; however, treatment with RSV reversed this effect. The opposite trend was observed in SOD activity. These data indicate that there is an association between DM and oxidative stress and that RSV is able to successfully attenuate these conditions.

INS secretion from pancreatic islet β-cells is regulated by a number of factors; an increase in blood glucose is the predominant trigger; however, fatty and amino acids may also act as direct or indirect stimuli (31). It has been reported that PA induces lipotoxicity in rat INS-producing cells (32). In the present study, PA was used to induce INS secretion in INS-1E cells. The results demonstrated that PA suppressed the expression of SIRT1 in a dose- and time-dependent manner, suggesting that SIRT1 serves an important role in the regulation of lipid metabolism. Furthermore, PA inhibited PGC-1α and FOXO3a expression. SIRT1 knockdown attenuated the effects of RSV on PA-inhibited PGC-1a and FOXO3a expression. It has previously been reported that SIRT1 mediates the deacetylation of certain targets, including PGC-1α, FOXO3a and p53, in mitochondrial biogenesis, lipid metabolism and inflammation (33). The results of the present study suggest that RSV functions via SIRT1 in PA-induced INS-1E cells. SIRT1 regulates a range of cellular functions affecting metabolic homeostasis and the link between metabolism and INS secretion depends on mitochondrial function (34). PGC-1α is a mitochondrial regulator that serves an essential role in cellular energy metabolism and the ectopic expression of PGC-1α induces the expression of NRFs and mtTFA prior to mitochondrial biogenesis (35). The results of the present study demonstrate that SIRT1 knockdown modulates NRFs and mtTFA levels in cells treated with PA and RSV. These data suggest that RSV functions via SIRT1 to modulate mitochondrial biogenesis.

It has been suggested that INS resistance occurs following disturbances in lipid metabolism (36). Therefore, the current study investigated whether RSV affects lipid metabolism. It was demonstrated that SIRT1 knockdown altered the effect of RSV on ACC, CPT-1 and LCDA expression. A previous study reported that SIRT1 suppresses the expression of ACC to reduce lipogenesis and upregulates CPT1 and LCAD to increase normal β-oxidation activities (37). Furthermore, it was demonstrated that RSV modulates ACC, CPT-1 and LCDA activity in lipid metabolism via SIRT1, suggesting a novel link between RSV, T2DM and lipid metabolism. PDX-1, MAFA and INS contribute to pancreas development, β-cells differentiation and the maintenance of mature β-cells function (38). In the present study, SIRT1 knockdown regulated levels of PDX-1, MAFA and INS mRNA. These results suggest that RSV may affect β-cells functionality via SIRT1.

In conclusion, the results of the present study suggest that RSV modulates the expression of SIRT1, PGC-1α and FOXO3a in a rat model of STZ-injected DM. In vitro, RSV significantly affected levels of PGC-1α and FOXO3a via SIRT1. RSV promoted mitochondrial biogenesis to stimulate INS secretion and enhanced fatty acid β-oxidation activity to reduce ectopic lipid deposition and promote INS expression. The present study provides an insight into the mechanism by which RSV prevents T2DM via SIRT1 and provides evidence that RSV may be used as a clinical treatment to prevent the development of T2DM.

Acknowledgements

The present study was supported by the Research Fund for Clinical Medicine, Chinese Medical Association (grant no. 13050770462), the Heilongjiang Postdoctoral Science Foundation (grant no. LBH-Z15159), the Health Department of Heilongjiang Province (grant no. 2016–022), the Scientific Foundation of the First Affiliated Hospital of Harbin Medical University (grant nos. 2016B008 and 2017B001), the Technology Innovation Program of Harbin City (grant no. 2016RAQXJ167), the National Natural Science Foundation of China (grant no. 81370929)) and the Innovative Science Research Project of Harbin Medical University (grant nos. 2016LCZX40 and 2016LCZX51).

Glossary

Abbreviations

Abbreviations:

T2DM

type 2 diabetes mellitus

NRF

nuclear respiratory factor

mtTFA

mitochondrial transcription factor A

CPT-1

lipid metabolism-related carnitine palmitoyltransferase 1

ACC

acetyl-CoA carboxylase

LCAD

long-chain acyl-CoA dehydrogenase

PDX-1

pancreatic duodenal homeobox-1 gene

MAFA

mid-arm fat area

INS

insulin

RSV

resveratrol

STZ

streptozotocin

INS-1E

insulinoma cell line clone 1E

SIRT1

Sirtuin type 1

PGC-1α

peroxisome proliferator-activated receptor-γ coactivator-1α

FOXO

forkhead box O

PA

palmitic acid

References

1 

Franz MJ, Boucher JL, Rutten-Ramos S and VanWormer JJ: Lifestyle weight-loss intervention outcomes in overweight and obese adults with type 2 diabetes: A systematic review and meta-analysis of randomized clinical trials. J Acad Nutr Diet. 115:1447–1463. 2015. View Article : Google Scholar : PubMed/NCBI

2 

Galling B, Roldan A, Nielsen RE, Nielsen J, Gerhard T, Carbon M, Stubbs B, Vancampfort D, De Hert M, Olfson M, et al: Type 2 diabetes mellitus in youth exposed to antipsychotics: A systematic review and meta-analysis. JAMA Psychiatry. 73:247–259. 2016. View Article : Google Scholar : PubMed/NCBI

3 

Dart AB, Martens PJ, Rigatto C, Brownell MD, Dean HJ and Sellers EA: Earlier onset of complications in youth with type 2 diabetes. Diabetes Care. 37:436–443. 2014. View Article : Google Scholar : PubMed/NCBI

4 

Liberopoulos EN, Tsouli S, Mikhailidis DP and Elisaf MS: Preventing type 2 diabetes in high risk patients: An overview of lifestyle and pharmacological measures. Curr Drug Targets. 7:211–228. 2006. View Article : Google Scholar : PubMed/NCBI

5 

Lotfy M, Adeghate J, Kalasz H, Singh J and Adeghate E: Chronic complications of diabetes mellitus: A mini review. Curr Diabetes Rev. 13:3–10. 2017. View Article : Google Scholar : PubMed/NCBI

6 

Saisho Y: β-cell dysfunction: Its critical role in prevention and management of type 2 diabetes. World J Diabetes. 6:109–124. 2015. View Article : Google Scholar : PubMed/NCBI

7 

Lomonaco R, Bril F, Portillo-Sanchez P, Ortiz-Lopez C, Orsak B, Biernacki D, Lo M, Suman A, Weber MH and Cusi K: Metabolic impact of nonalcoholic steatohepatitis in obese patients with type 2 diabetes. Diabetes Care. 39:632–638. 2016. View Article : Google Scholar : PubMed/NCBI

8 

Lin YL, Lai YH, Wang CH, Kuo CH, Liou HH and Hsu BG: Triceps skinfold thickness is associated with lumbar bone mineral density in peritoneal dialysis patients. Ther Apher Dial. 21:102–107. 2017. View Article : Google Scholar : PubMed/NCBI

9 

Morino K, Petersen KF, Dufour S, Befroy D, Frattini J, Shatzkes N, Neschen S, White MF, Bilz S, Sono S, et al: Reduced mitochondrial density and increased IRS-1 serine phosphorylation in muscle of insulin-resistant offspring of type 2 diabetic parents. J Clin Invest. 115:3587–3593. 2005. View Article : Google Scholar : PubMed/NCBI

10 

Hausenblas HA, Schoulda JA and Smoliga JM: Resveratrol treatment as an adjunct to pharmacological management in type 2 diabetes mellitus-systematic review and meta-analysis. Mol Nutr Food Res. 59:147–159. 2015. View Article : Google Scholar : PubMed/NCBI

11 

Wicklow B, Wittmeier K, T' Jong GW, McGavock J, Robert M, Duhamel T and Dolinsky VW: Proposed trial: Safety and efficacy of resveratrol for the treatment of non-alcoholic fatty liver disease (NAFLD) and associated insulin resistance in adolescents who are overweight or obese adolescents-rationale and protocol. Biochem Cell Biol. 93:522–530. 2015. View Article : Google Scholar : PubMed/NCBI

12 

Szkudelski T and Szkudelska K: Resveratrol and diabetes: From animal to human studies. Biochim Biophys Acta. 1852:1145–1154. 2015. View Article : Google Scholar : PubMed/NCBI

13 

Guarente L and Picard F: Calorie restriction-the SIR2 connection. Cell. 120:473–482. 2005. View Article : Google Scholar : PubMed/NCBI

14 

McBurney MW, Clark-Knowles KV, Caron AZ and Gray DA: SIRT1 is a highly networked protein that mediates the adaptation to chronic physiological Stress. Genes Cancer. 4:125–134. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Song R, Xu W, Chen Y, Li Z, Zeng Y and Fu Y: The expression of Sirtuins 1 and 4 in peripheral blood leukocytes from patients with type 2 diabetes. Eur J Histochem. 55:e102011. View Article : Google Scholar : PubMed/NCBI

16 

Han J, Wei M, Wang Q, Li X, Zhu C, Mao Y, Wei L, Sun Y and Jia W: Association of genetic variants of SIRT1 with type 2 diabetes mellitus. Gene Expr. 16:177–185. 2015. View Article : Google Scholar : PubMed/NCBI

17 

Kitada M and Koya D: SIRT1 in type 2 diabetes: Mechanisms and therapeutic potential. Diabetes Metab J. 37:315–325. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Lovis P, Gattesco S and Regazzi R: Regulation of the expression of components of the exocytotic machinery of insulin-secreting cells by microRNAs. Biol Chem. 389:305–312. 2008. View Article : Google Scholar : PubMed/NCBI

19 

Nathan DM, Buse JB, Davidson MB, Heine RJ, Holman RR, Sherwin R and Zinman B: Professional Practice Committee, American Diabetes Association; European Association for the Study of Diabetes: Management of hyperglycaemia in type 2 diabetes: A consensus algorithm for the initiation and adjustment of therapy. A consensus statement from the American Diabetes Association and the European Association for the Study of Diabetes. Diabetologia. 49:1711–1721. 2006. View Article : Google Scholar : PubMed/NCBI

20 

Banin RM, Hirata BK, Andrade IS, Zemdegs JC, Clemente AP, Dornellas AP, Boldarine VT, Estadella D, Albuquerque KT, Oyama LM, et al: Beneficial effects of Ginkgo biloba extract on insulin signaling cascade, dyslipidemia, and body adiposity of diet-induced obese rats. Braz J Med Biol Res. 47:780–788. 2014. View Article : Google Scholar : PubMed/NCBI

21 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

22 

Tangvarasittichai S: Oxidative stress, insulin resistance, dyslipidemia and type 2 diabetes mellitus. World J Diabetes. 6:456–480. 2015. View Article : Google Scholar : PubMed/NCBI

23 

Marangoni MN, Brady ST, Chowdhury SA and Piano MR: The co-occurrence of myocardial dysfunction and peripheral insensate neuropathy in a streptozotocin-induced rat model of diabetes. Cardiovasc Diabetol. 13:112014. View Article : Google Scholar : PubMed/NCBI

24 

Goh KP, Lee HY, Lau DP, Supaat W, Chan YH and Koh AF: Effects of resveratrol in patients with type 2 diabetes mellitus on skeletal muscle SIRT1 expression and energy expenditure. Int J Sport Nutr Exerc Metab. 24:2–13. 2014. View Article : Google Scholar : PubMed/NCBI

25 

Huang XZ, Wen D, Zhang M, Xie Q, Ma L, Guan Y, Ren Y, Chen J and Hao CM: Sirt1 activation ameliorates renal fibrosis by inhibiting the TGF-β/Smad3 pathway. J Cell Biochem. 115:996–1005. 2014. View Article : Google Scholar : PubMed/NCBI

26 

Higashida K, Kim SH, Jung SR, Asaka M, Holloszy JO and Han DH: Effects of resveratrol and SIRT1 on PGC-1α activity and mitochondrial biogenesis: A reevaluation. PLoS Biol. 11:e10016032013. View Article : Google Scholar : PubMed/NCBI

27 

Song X, Yang B, Qiu F, Jia M and Fu G: High glucose and free fatty acids induce endothelial progenitor cell senescence via PGC-1α/SIRT1 signaling pathway. Cell Biol Int. 41:1146–1159. 2017. View Article : Google Scholar : PubMed/NCBI

28 

Zhang HH, Ma XJ, Wu LN, Zhao YY, Zhang PY, Zhang YH, Shao MW, Liu F, Li F and Qin GJ: SIRT1 attenuates high glucose-induced insulin resistance via reducing mitochondrial dysfunction in skeletal muscle cells. Exp Biol Med (Maywood). 240:557–565. 2015. View Article : Google Scholar : PubMed/NCBI

29 

Brunet A, Sweeney LB, Sturgill JF, Chua KF, Greer PL, Lin Y, Tran H, Ross SE, Mostoslavsky R, Cohen HY, et al: Stress-dependent regulation of FOXO transcription factors by the SIRT1 deacetylase. Science. 303:2011–2015. 2004. View Article : Google Scholar : PubMed/NCBI

30 

Liu H, Sheng M, Liu Y, Wang P, Chen Y, Chen L, Wang W and Li B: Expression of SIRT1 and oxidative stress in diabetic dry eye. Int J Clin Exp Pathol. 8:7644–7653. 2015.PubMed/NCBI

31 

Tan C, Voss U, Svensson S, Erlinge D and Olde B: High glucose and free fatty acids induce beta cell apoptosis via autocrine effects of ADP acting on the P2Y(13) receptor. Purinergic Signal. 9:67–79. 2013. View Article : Google Scholar : PubMed/NCBI

32 

Plotz T, Hartmann M, Lenzen S and Elsner M: The role of lipid droplet formation in the protection of unsaturated fatty acids against palmitic acid induced lipotoxicity to rat insulin-producing cells. Nutr Metab (Lond). 13:162016. View Article : Google Scholar : PubMed/NCBI

33 

Ghinis-Hozumi Y, González-Dávalos L, Antaramian A, Villarroya F, Piña E, Shimada A, Varela-Echavarría A and Mora O: Effect of resveratrol and lipoic acid on sirtuin-regulated expression of metabolic genes in bovine liver and muscle slice cultures. J Anim Sci. 93:3820–3831. 2015. View Article : Google Scholar : PubMed/NCBI

34 

Wiederkehr A and Wollheim CB: Mitochondrial signals drive insulin secretion in the pancreatic β-cell. Mol Cell Endocrinol. 353:128–137. 2012. View Article : Google Scholar : PubMed/NCBI

35 

Chen CH, Nagayama K, Enomoto N, Miyasaka Y, Kurosaki M, Sakamoto N, Maekawa S, Kakinuma S, Ikeda T, Izumi N, et al: Enhancement of mitochondrial gene expression in the liver of primary biliary cirrhosis. Hepatol Res. 31:24–30. 2005. View Article : Google Scholar : PubMed/NCBI

36 

Chen S, Zhao X, Ran L, Wan J, Wang X, Qin Y, Shu F, Gao Y, Yuan L, Zhang Q and Mi M: Resveratrol improves insulin resistance, glucose and lipid metabolism in patients with non-alcoholic fatty liver disease: A randomized controlled trial. Dig Liver Dis. 47:226–232. 2015. View Article : Google Scholar : PubMed/NCBI

37 

Chen LL, Zhang HH, Zheng J, Hu X, Kong W, Hu D, Wang SX and Zhang P: Resveratrol attenuates high-fat diet-induced insulin resistance by influencing skeletal muscle lipid transport and subsarcolemmal mitochondrial β-oxidation. Metabolism. 60:1598–1609. 2011. View Article : Google Scholar : PubMed/NCBI

38 

Kaneto H, Miyatsuka T, Kawamori D, Yamamoto K, Kato K, Shiraiwa T, Katakami N, Yamasaki Y, Matsuhisa M and Matsuoka TA: PDX-1 and MafA play a crucial role in pancreatic beta-cell differentiation and maintenance of mature beta-cell function. Endocr J. 55:235–252. 2008. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Cao MM, Lu X, Liu GD, Su Y, Li YB and Zhou J: Resveratrol attenuates type 2 diabetes mellitus by mediating mitochondrial biogenesis and lipid metabolism via Sirtuin type 1. Exp Ther Med 15: 576-584, 2018.
APA
Cao, M., Lu, X., Liu, G., Su, Y., Li, Y., & Zhou, J. (2018). Resveratrol attenuates type 2 diabetes mellitus by mediating mitochondrial biogenesis and lipid metabolism via Sirtuin type 1. Experimental and Therapeutic Medicine, 15, 576-584. https://doi.org/10.3892/etm.2017.5400
MLA
Cao, M., Lu, X., Liu, G., Su, Y., Li, Y., Zhou, J."Resveratrol attenuates type 2 diabetes mellitus by mediating mitochondrial biogenesis and lipid metabolism via Sirtuin type 1". Experimental and Therapeutic Medicine 15.1 (2018): 576-584.
Chicago
Cao, M., Lu, X., Liu, G., Su, Y., Li, Y., Zhou, J."Resveratrol attenuates type 2 diabetes mellitus by mediating mitochondrial biogenesis and lipid metabolism via Sirtuin type 1". Experimental and Therapeutic Medicine 15, no. 1 (2018): 576-584. https://doi.org/10.3892/etm.2017.5400
Copy and paste a formatted citation
x
Spandidos Publications style
Cao MM, Lu X, Liu GD, Su Y, Li YB and Zhou J: Resveratrol attenuates type 2 diabetes mellitus by mediating mitochondrial biogenesis and lipid metabolism via Sirtuin type 1. Exp Ther Med 15: 576-584, 2018.
APA
Cao, M., Lu, X., Liu, G., Su, Y., Li, Y., & Zhou, J. (2018). Resveratrol attenuates type 2 diabetes mellitus by mediating mitochondrial biogenesis and lipid metabolism via Sirtuin type 1. Experimental and Therapeutic Medicine, 15, 576-584. https://doi.org/10.3892/etm.2017.5400
MLA
Cao, M., Lu, X., Liu, G., Su, Y., Li, Y., Zhou, J."Resveratrol attenuates type 2 diabetes mellitus by mediating mitochondrial biogenesis and lipid metabolism via Sirtuin type 1". Experimental and Therapeutic Medicine 15.1 (2018): 576-584.
Chicago
Cao, M., Lu, X., Liu, G., Su, Y., Li, Y., Zhou, J."Resveratrol attenuates type 2 diabetes mellitus by mediating mitochondrial biogenesis and lipid metabolism via Sirtuin type 1". Experimental and Therapeutic Medicine 15, no. 1 (2018): 576-584. https://doi.org/10.3892/etm.2017.5400
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team