Glucose affects cell viability, migration, angiogenesis and cellular adhesion of human retinal capillary endothelial cells via SPARC

Fu,Yang; Tang,Min; Xiang,Xiaoqiong; Liu,Kun; Xu,Xun

doi:10.3892/etm.2018.6970

Glucose affects cell viability, migration, angiogenesis and cellular adhesion of human retinal capillary endothelial cells via SPARC

Authors:
- Yang Fu
- Min Tang
- Xiaoqiong Xiang
- Kun Liu
- Xun Xu
View Affiliations

Affiliations: Department of Ophthalmology, Shanghai General Hospital of Nanjing Medical University, Shanghai 200080, P.R. China, Department of Ophthalmology, Shanghai General Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200080, P.R. China
Published online on: November 14, 2018 https://doi.org/10.3892/etm.2018.6970
Pages: 273-283
Copyright: © Fu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )

Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )

Cited By (CrossRef): 0 citations Loading Articles...

Abstract

The expression of secreted protein acidic and rich in cysteine (SPARC) has been recently identified to be associated with the pathology of diabetic retinopathy. Therefore, the present study aimed to evaluate the regulatory role of SPARC in human retinal capillary endothelial cells (HRCECs), following exposure to a high glucose environment in vitro. The cell viability, migration, angiogenesis, permeability and SPARC expression levels of HRCECs were measured following treatment with different concentrations of glucose (25, 50 or 100 mM). Lentiviral vectors (LV185‑pL_shRNA_mKate2‑SPARC‑543; target sequence, GGATGAGGACAACAACCTTCT) that inhibit the expression of SPARC were constructed, and HRCECs were evaluated when infected by viruses carrying the lentiviral vectors. Cell viability was examined using the Cell Counting Kit‑8 assay. The expression of SPARC in HRCECs increased as the concentration of glucose in the culture medium increased. Relatively high concentrations of glucose significantly inhibited cell proliferation (P<0.05), migration (P<0.05), angiogenesis (P<0.01), and the expression of ZO, occludin, claudin and JAM1 in tight junctions (P<0.01), gap junctions (Cx37 and Cx43; P<0.01) and adherens junctions (VE‑cadherin, CTNNA1 and CTNNB1; P<0.05). However, when SPARC was downregulated by lentiviral vectors, the inhibitions induced by high concentrations of glucose were partially reversed. To conclude, the inhibitory effects on cell viability, migration, angiogenesis and cellular adhesion of HRCECs induced by high concentrations of glucose were reversed once the expression of SPARC was inhibited. These findings suggest that SPARC may serve an important role in pathogenesis of diabetic retinopathy.

View Figures

View References

1	Smith-Morris C, Bresnick GH, Cuadros J, Bouskill KE and Pedersen ER: Diabetic retinopathy and the cascade into vision loss. Med Anthropol. 17:1–14. 2018. View Article : Google Scholar
2	Gella L, Raman R, Pal SS, Ganesan S and Sharma T: Incidence, progression, and associated risk factors of posterior vitreous detachment in type 2 diabetes mellitus: Sankara nethralaya diabetic retinopathy epidemiology and molecular genetic study (SN-DREAMS II, Report No. 7). Semin Ophthalmol. 32:191–197. 2017. View Article : Google Scholar : PubMed/NCBI
3	Raman R, Ganesan S, Pal SS, Gella L, Kulothungan V and Sharma T: Incidence and progression of diabetic retinopathy in urban India: Sankara nethralaya-diabetic retinopathy epidemiology and molecular genetics study (SN-DREAMS II), Report 1. Ophthalmic Epidemiol. 24:294–302. 2017. View Article : Google Scholar : PubMed/NCBI
4	Capitão M and Soares R: Angiogenesis and inflammation crosstalk in diabetic retinopathy. J Cell Biochem. 117:2443–2453. 2016. View Article : Google Scholar : PubMed/NCBI
5	Zhou L, Zhang T, Lu B, Yu Z, Mei X, Abulizi P and Ji L: Lonicerae Japonicae Flos attenuates diabetic retinopathy by inhibiting retinal angiogenesis. J Ethnopharmacol. 189:117–125. 2016. View Article : Google Scholar : PubMed/NCBI
6	Tanaka M, Takagi T, Naito Y, Uchiyama K, Hotta Y, Toyokawa Y, Ushiroda C, Hirai Y, Aoi W, Higashimura Y, et al: Secreted protein acidic and rich in cysteine functions in colitis via IL17A regulation in mucosal CD4+ T cells. J Gastroenterol Hepatol. 33:671–680. 2018. View Article : Google Scholar : PubMed/NCBI
7	Toyota K, Murakami Y, Kondo N, Uemura K, Nakagawa N, Takahashi S and Sueda T: Impact of secreted protein acidic and rich in cysteine (SPARC) expression on prognosis after surgical resection for biliary carcinoma. J Gastrointest Surg. 21:990–999. 2017. View Article : Google Scholar : PubMed/NCBI
8	Kos K and Wilding JP: SPARC: A key player in the pathologies associated with obesity and diabetes. Nat Rev Endocrinol. 6:225–235. 2010. View Article : Google Scholar : PubMed/NCBI
9	Xu L, Ping F, Yin J, Xiao X, Xiang H, Ballantyne CM, Wu H and Li M: Elevated plasma SPARC levels are associated with insulin resistance, dyslipidemia, and inflammation in gestational diabetes mellitus. PLoS One. 8:e816152013. View Article : Google Scholar : PubMed/NCBI
10	Wu D, Li L, Yang M, Liu H and Yang G: Elevated plasma levels of SPARC in patients with newly diagnosed type 2 diabetes mellitus. Eur J Endocrinol. 165:597–601. 2011. View Article : Google Scholar : PubMed/NCBI
11	Jandeleit-Dahm K, Rumble J, Cox AJ, Kelly DJ, Dziadek M, Cooper ME and Gilbert RE: SPARC gene expression is increased in diabetes-related mesenteric vascular hypertrophy. Microvasc Res. 59:61–71. 2000. View Article : Google Scholar : PubMed/NCBI
12	Zufferey R, Nagy D, Mandel RJ, Naldini L and Trono D: Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotechnol. 15:871–875. 1997. View Article : Google Scholar : PubMed/NCBI
13	Huang W, Yan Z, Li D, Ma Y, Zhou J and Sui Z: Antioxidant and anti-inflammatory effects of blueberry anthocyanins on high glucose-induced human retinal capillary endothelial cells. Oxid Med Cell Longev. 2018:18624622018. View Article : Google Scholar : PubMed/NCBI
14	Farjo KM, Farjo RA, Halsey S, Moiseyev G and Ma JX: Retinol-binding protein 4 induces inflammation in human endothelial cells by an NADPH oxidase- and nuclear factor kappa B-dependent and retinol-independent mechanism. Mol Cell Biol. 32:5103–5115. 2012. View Article : Google Scholar : PubMed/NCBI
15	Francescone RA III, Faibish M and Shao R: A Matrigel-based tube formation assay to assess the vasculogenic activity of tumor cells. J Vis Exp. 2011. View Article : Google Scholar : PubMed/NCBI
16	Landt S, Heidecke H, Korlach S, Reuter C, Schwidde I, Barinoff J, Thill M, Sehouli J and Kümmel S: In vitro vascular tube formation testing as a tool for treatment individualisation in patients with cervical cancer. Anticancer Res. 31:2609–2615. 2011.PubMed/NCBI
17	Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI
18	Chlenski A, Dobratic M, Salwen HR, Applebaum M, Guerrero LJ, Miller R, DeWane G, Solomaha E, Marks JD and Cohn SL: Secreted protein acidic and rich in cysteine (SPARC) induces lipotoxicity in neuroblastoma by regulating transport of albumin complexed with fatty acids. Oncotarget. 7:77696–77706. 2016. View Article : Google Scholar : PubMed/NCBI
19	Kao SC, Kirschner MB, Cooper WA, Tran T, Burgers S, Wright C, Korse T, van den Broek D, Edelman J, Vallely M, et al: A proteomics-based approach identifies secreted protein acidic and rich in cysteine as a prognostic biomarker in malignant pleural mesothelioma. Br J Cancer. 114:524–531. 2016. View Article : Google Scholar : PubMed/NCBI
20	Abe T, Takahashi S and Suzuki N: Oxidative metabolism in cultured rat astroglia: Effects of reducing the glucose concentration in the culture medium and of D-aspartate or potassium stimulation. J Cereb Blood Flow Metab. 26:153–160. 2006. View Article : Google Scholar : PubMed/NCBI
21	Norose K, Lo WK, Clark JI, Sage EH and Howe CC: Lenses of SPARC-null mice exhibit an abnormal cell surface-basement membrane interface. Exp Eye Res. 71:295–307. 2000. View Article : Google Scholar : PubMed/NCBI
22	Bornstein P: Diversity of function is inherent in matricellular proteins: An appraisal of thrombospondin 1. J Cell Biol. 130:503–506. 1995. View Article : Google Scholar : PubMed/NCBI
23	Bailey-Serres J, Sorenson R and Juntawong P: Getting the message across: Cytoplasmic ribonucleoprotein complexes. Trends Plant Sci. 14:443–453. 2009. View Article : Google Scholar : PubMed/NCBI
24	Watanabe K, Okamoto F, Yokoo T, Iida KT, Suzuki H, Shimano H, Oshika T, Yamada N and Toyoshima H: SPARC is a major secretory gene expressed and involved in the development of proliferative diabetic retinopathy. J Atheroscler Thromb. 16:69–76. 2009. View Article : Google Scholar : PubMed/NCBI
25	Song SJ, Han K, Choi KS, Ko SH, Rhee EJ, Park CY, Park JY, Lee KU and Ko KS: Task Force Team for Diabetes Fact Sheet of the Korean Diabetes Association: Trends in diabetic retinopathy and related medical practices among type 2 diabetes patients: Results from the National Insurance Service Survey 2006–2013. J Diabetes Investig. 9:173–178. 2017. View Article : Google Scholar : PubMed/NCBI
26	Wang FH, Sun XD, Zhang X, Xu X, Zhu Q, Huang JN, Fan Y, Gu Q and Liu HY: Role of pigment epithelium-derived factor on proliferation and migration of choroidal capillary endothelium induced by vascular endothelial growth factor in vitro. Chin Med J (Engl). 120:1534–1538. 2007.PubMed/NCBI
27	Wang X, Wang G and Wang Y: Intravitreous vascular endothelial growth factor and hypoxia-inducible factor 1a in patients with proliferative diabetic retinopathy. Am J Ophthalmol. 148:883–889. 2009. View Article : Google Scholar : PubMed/NCBI
28	Rubsam A, Parikh S and Fort PE: Role of inflammation in diabetic retinopathy. Int J Mol Sci. 19:pii: E942. 2018. View Article : Google Scholar : PubMed/NCBI
29	Rivera LB, Bradshaw AD and Brekken RA: The regulatory function of SPARC in vascular biology. Cell Mol Life Sci. 68:3165–3173. 2011. View Article : Google Scholar : PubMed/NCBI
30	Zhang JL, Chen GW, Liu YC, Wang PY, Wang X, Wan YL, Zhu J, Gao HQ, Yin J, Wang W and Tian ML: Secreted protein acidic and rich in cysteine (SPARC) suppresses angiogenesis by down-regulating the expression of VEGF and MMP-7 in gastric cancer. PLoS One. 7:e446182012. View Article : Google Scholar : PubMed/NCBI
31	Boyineni J, Tanpure S, Gnanamony M, Antony R, Fernández KS, Lin J, Pinson D and Gondi CS: SPARC overexpression combined with radiation retards angiogenesis by suppressing VEGF-A via miR410 in human neuroblastoma cells. Int J Oncol. 49:1394–1406. 2016. View Article : Google Scholar : PubMed/NCBI
32	Rahimi N: Defenders and challengers of endothelial barrier function. Front Immunol. 8:18472018. View Article : Google Scholar
33	Klaassen I, Van Noorden CJ and Schlingemann RO: Molecular basis of the inner blood-retinal barrier and its breakdown in diabetic macular edema and other pathological conditions. Prog Retin Eye Res. 34:19–48. 2013. View Article : Google Scholar : PubMed/NCBI
34	Tan GS, Cheung N, Simo R, Cheung GC and Wong TY: Diabetic macular oedema. Lancet Diabetes Endocrinol. 5:143–155. 2017. View Article : Google Scholar : PubMed/NCBI