Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
November-2019 Volume 18 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2019 Volume 18 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Puerarin inhibits apoptosis and inflammation in myocardial cells via PPARα expression in rats with chronic heart failure

Retraction in: /10.3892/etm.2025.12916
  • Authors:
    • Le He
    • Tong Wang
    • Bing‑Wei Chen
    • Feng‑Min Lu
    • Jing Xu
  • View Affiliations / Copyright

    Affiliations: Department of Cardiology, Tianjin Chest Hospital, Tianjin 300222, P.R. China, Department of Endocrinology, Tianjin Yellow River Hospital, Tianjin 300110, P.R. China
    Copyright: © He et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 3347-3356
    |
    Published online on: September 6, 2019
       https://doi.org/10.3892/etm.2019.7984
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Chronic heart failure affects myocardial energy metabolism and cardiac function. Puerarin has been reported to improve cardiac function through regulation of energy metabolism in mice with myocardial infarction. The aim of the current study was to determine whether puerarin can improve body weight and reduce inflammation and apoptosis in rats with chronic heart failure. Rats were divided into three groups: Puerarin, PBS and sham group. Transverse aortic constriction was performed to induce chronic heart failure in the puerarin an PBS groups. Cardiac function, apoptosis and inflammation were evaluated following a 4‑week treatment in rats with chronic heart failure. The results demonstrated that puerarin significantly increased the survival rate of rats and improved cardiac function compared with the PBS group. In addition, puerarin decreased lactate dehydrogenase and succinate dehydrogenase activity compared with the PBS group. Puerarin treatment increased the expression levels of glucose transporter type 4 and decreased the expression levels of CD36. Additionally, puerarin decreased the levels inflammatory factors, including tumor necrosis factor α, interleukin (IL)‑1β and IL‑6 in serum and myocardial tissue compared with the PBS group. Puerarin upregulated peroxisome proliferator‑activated receptor α (PPARα) and its downstream target genes nuclear respiratory factor 1, FOS proto‑oncogene, YY1 transcription factor, acetyl‑coenzyme A carboxylase a, Fas cell surface death receptor, L‑type pyruvate kinase and acetyl‑coenzyme A dehydrogenase medium chain in myocardial cells from rats with chronic heart failure. These results demonstrated that puerarin inhibited apoptosis and inflammation in myocardial cells via the PPARα pathway. In conclusion, the present study indicated that puerarin may exhibit antiapoptotic and anti‑inflammatory activity through the PPARα pathway in rats with chronic heart failure.

Introduction

Chronic heart failure is a complex disease caused by structural abnormalities, functional disorders, metabolic disturbance and/or drug stimulation (1–4). Chronic heart failure is the ultimate clinical manifestation of various cardiovascular and inflammatory diseases (5–7). Reports have indicated that chronic heart failure is one of the leading causes of disability and mortality in patients with heart disease worldwide (8–13). Chronic heart failure impairs myocardial energy metabolism, which leads to cardiac dysfunction and damages the circulation (14–16). Despite great advances in prevention and treatment of cardiovascular diseases in current medicine, chronic heart failure remains a therapeutic challenge as no effective treatments are available yet, with the exception of orthotopic heart transplantation (17–19).

Puerarin, which is extracted from P. montana var. lobata, which exhibits therapeutic efficacy for a range of human diseases (20–22). Duan et al (23) demonstrated that puerarin may improve heart function and increase left ventricular ejection fraction. He et al (24) reported that puerarin promotes angiogenic signaling, improved myocardial microcirculation and downregulated the endothelin system, which results in a reversal of aberrant SERCA2a and phospholamban expression. In addition, puerarin has multiple therapeutic effects for neurological dysfunction and inflammation (25). A previous study has provided compelling evidence that puerarin serves a role in inhibiting myocyte loss during heart failure partly through ferroptosis mitigation, which suggests a new mechanism for puerarin as a potential therapeutic agent for heart failure (26). However, the antiapoptotic and anti-inflammatory effects of puerarin on myocardial cells in patients with chronic heart failure are not well understood.

A previous study demonstrated that peroxisome proliferator-activated receptor a (PPARα) may be involved in the apoptosis of myocardial tissue in chronic heart failure (27). In addition, puerarin may improve the clinical heart function, increase the left ventricular ejection and decrease the level of oxidized low-density lipoprotein (23). In the present study, the antiapoptotic and anti-inflammatory efficacy of puerarin was investigated in rats with chronic heart failure. The potential mechanism of puerarin activity in myocardial cells from rats with chronic heart failure was also explored.

Materials and methods

Animals

A total of 30 male Sprague Dawley rats (age, 8–10 weeks; weight, 180–210 g) were purchased from the Experimental Animal Center of Tianjin University. The rats were housed at 24–26°C, 50% humidity with a 12-h light/dark cycle and ad libitum access to food and water. The experiments performed in this study were approved by the Animal Ethics Committee of Tianjin Chest Hospital (Tianjin, China). Rats were anaesthetized by intraperitoneal injection of pentobarbital (35 mg/kg), and chronic heart failure model was established as previously described (28). Following a 1-week adaptation period, the rats were randomly divided into three groups: PBS, puerarin and sham group (subjected to surgery without traverse aortic constriction) (n=10 rats/group). Rats with chronic heart failure received an intraperitoneal injection of puerarin (60 mg/kg; 99.0% purity; Beijing Saisheng Pharmaceutical Co., Ltd.) (29) or an equal volume of PBS (Sigma-Aldrich; Merck KGaA) once a day for 4 weeks. During the same 4-week period, rats in the sham group did not receive any treatments. Humane end points of experimental rats were set according to the OECD Guidance Document on the Recognition, Assessment, and Use of Clinical Signs as Humane End points for Experimental Animals Used in Safety Evaluation (30). Body weight was recorded for each rat on day 30 after treatment. Animals exhibiting signs of humane endpoints were sacrificed.

Cell culture

Myocardial cells were isolated from the rats in each group as described previously (31). Briefly, rats were decapitated after anesthesia (thiopental, 30 mg/kg IV) on day 30. The hearts were removed and placed into a plate using sterile scissors. Myocardial tissues were isolated and settled in Hank's Balanced Salt Solution (Gibco; Thermo Fisher Scientific, Inc.). Myocardial tissues were mechanically stirred and trypsinized with 0.5% trypsin at 37°C for 10 min, followed by centrifugation (6,000 × g for 15 min at 4°C) and suspension with DMEM (Gibco, Thermo Fisher Scientific, Inc.) containing 10% FBS (Gibco, Thermo Fisher Scientific, Inc.). Following cell attachment, the medium was replaced with DMEM supplemented with 0.5 mM glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin (all from Gibco; Thermo Fisher Scientific, Inc.). Myocardial cells were cultured for three days at 37°C in a 5% CO2 incubator. Following culture, the cells were treated with puerarin (2 mmol/l) or PBS for 12 h at 37°C prior to further analysis.

Knockdown of PPARα

Transient knockdown of PPARα was performed using the TranslT-X2 Dynamic Delivery System (Mirus Bio, LLC). In brief, myocardial cells (1×105 cells/well) were plated in six-well plates and cultured for 12 h at 37°C. Following incubation, 25 mM PPARα siRNA (si-PPARα) or siRNA-negative control (si-NC; both supplied by Shanghai GenePharma Co., Ltd.) were transfected into myocardial cells using TranslT-X2 reagent (25 µl) according to the manufacturer's instructions. The sequences of siRNAs were as follow: si-PPARα sense, 5′-AGAGCUACUUUUGUCCGATT-3′ and antisense, 5′-UCCGACAAAAGUUUCCACUCG-3′; si-NC sense, 5′-UUCUCGAACGUGUCACGUTT-3′ and antisense, 5′-ACGUGACACGUUCGGAGAATT-3′. Following incubation for 72 h, the expression of PPARα in myocardial cells was analyzed using western blotting. Subsequently, PPARα-knockdown myocardial cells were treated with puerarin (2 mmol/l) for 12 h at 37°C for further analysis.

Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) assay

Apoptotic rates of myocardial tissue or myocardial cells were analyzed using TUNEL assay (DeadEnd™ Colorimetric Tunel System; Promega Corporation) according to the manufacturer's instructions. For myocardial tissues, tissues were fixed with 5% paraformaldehyde for 12 h at room temperature. 5-µm-thick sections were fixed with 4% paraformaldehyde for 30 min at 37°C and dehydrated in gradient concentrations of ethanol. Tissue sections or myocardial cells (1×104 cells/well) were incubated with TUNEL reagent for 30 min at 37°C. Cells were washed with PBS three times for 5 min at 37°C, followed by incubation with 5% DAPI (Sigma-Aldrich; Merck KGaA) for 15 min at 37°C. Images were captured using a ZEISS LSM 510 confocal microscope using 488 nm excitation fixed in Antifade Mounting Medium. The apoptotic rate was calculated using the Developer XD 1.2 software (Definiens AG).

ELISA

A total of 2 ml peripheral venous blood was obtained from experimental rats after 4 weeks of treatment. Serum was obtained following centrifugation (6,000 × g; 15 min at 4°C). C reactive protein (CRP; cat. no. MCRP00; Bio-Rad Laboratories, Inc.), TNF-α (cat. no. RTA00; Bio-Rad Laboratories, Inc.), IL-6 (cat. no. R6000B; Bio-Rad Laboratories, Inc.), IL-1β (cat. no. DY501; Bio-Rad Laboratories, Inc.), brain natriuretic peptide (BNP; cat. no. MA134237; Thermo Fisher Scientific, Inc.), creatinine (cat. no. KGE005; R&D Systems, Inc.) and troponin T (cat. no. MAB1874; R&D Systems, Inc.) levels were analyzed using ELISA kits according to the manufacturers' instructions.

Determination of cardiac function

Following 4 weeks of treatment, the rats were anesthetized by intraperitoneal injection of pentobarbital (35 mg/kg). Ejection fraction (EF), heart rate (HR), fractional shortening (FS) and cardiac output (CO) in experimental rats were measured using a Vivid I ultrasound (GE Healthcare) equipped with a 12-MHz linear transducer.

Determination of lactate dehydrogenase (LDH) and succinate dehydrogenase (SDH) in serum

Serum was separated from peripheral venous blood as described above. LDH (cat. no. 10127230001; Roche Applied Science) and SDH (cat. no. 10109339001; Roche Applied Science) levels were measured using ELISA kits according to the manufacturer's instructions as previously described (32).

Immunohistochemistry

Myocardial tissues from the experimental rats were fixed with 10% formaldehyde for 1 h at room temperature, embedded in paraffin and cut into 4-µm-thick sections. Antigen retrieval was performed using eBioscience™ IHC Antigen Retrieval Solution (cat no. 00-4955-58; Invitrogen; Thermo Fisher Scientific, Inc.). Sections were washed with PBS with Tween-20 (PBST; Sigma-Aldrich; Merck KGaA), blocked with 5% bovine serum albumin (Sigma-Aldrich; Merck KGaA) for 2 h at room temperature and incubated with rabbit anti-rat glucose transporter type 4 (GLUT4; 1:1,000; cat. no. ab33780; Abcam), CD36 (1:1,000; cat. no. ab64014; Abcam), tumor necrosis factor a (TNF-α; 1:1,000; cat. no. ab6671; Abcam), interleukin (IL)-1β (1:1,000; cat. no. ab200478; Abcam) and IL-6 (1:1,000; cat. no. ab7737; Abcam) for 2 h at 37°C. Following incubation, sections were washed with PBST three times and incubated with Alexa Fluor 488-labeled goat anti-rabbit secondary antibody (1:2,000; cat. no. ab150077; Abcam) for 2 h at 37°C. A diaminobenzidine staining system (3,3′-diaminobenzidine; Sigma-Aldrich; Merck KGaA) was used to detect target protein expression using a LSM-780 confocal microscope (Zeiss AG) according to manufacturer's protocol. Cell counting was performed in six randomly selected fields using Image Pro Analyzer software (version 7.0.0.951; MediaCybernetics) and analyzed using LAS AF software (version 2.0; Leica Microsystems, Inc.).

Reverse transcription-quantitative PCR (RT-qPCR)

Myocardial cells were lysed and total RNA was extracted using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. Total RNA was quantified with NanoDrop™ (NanoDrop Technologies; Thermo Fisher Scientific, Inc.). RNA (1 µg) was reverse-transcribed using the cDNA Reverse Transcription kit (Takara Bio, Inc.) according to the manufacturer's protocol. qPCR was performed using an Applied Biosystems 7900HT Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) and Premix Ex Taq™ (Probe qPCR, Takara Biotechnology Co., Ltd.). Forward and reverse primers were synthesized by Thermo Fisher Scientific, Inc. and are listed in Table I. The following thermocycling conditions were used: Initial denaturation at 94°C for 2 min; followed by 45 cycles of 95°C for 30 sec, 57.5°C for 30 sec and 72°C for 60 sec; and final extension at 72°C for 10 min. Relative mRNA expression levels were calculated using the 2−ΔΔCq method (25). The results were normalized to β-actin.

Table I.

Primers used for reverse transcription-quantitative PCR.

Table I.

Primers used for reverse transcription-quantitative PCR.

Primer sequence (5′→3′)

Gene nameForwardReverse
Nrf1 ATGGCCCAAACCATCACCGGCAGCA ATGTGCCAGGATCCAGTTTAG
Fos TTGCTGCATAAAGTTTGTGATACAG AGGAAAAGGCATCAGAGAAGTAGC
Yy1 GAAGCCCTTTCAGTGCACGTT ACATAGGGCCTGTCTCCGGTAT
ACC1 CCCAATATTTATCATGAGACTTGCA CAACATTTGAATGAACTCCACG
FAS ATTGCTCAACAACCATGCTG CCAATCCCTTGGAGTTGATG
L-PK GGAAGAAGACCCACAGGAAGCAATA GAGAAGCCTCAAGGTTATGGATG
MCAD TTGGTGACGGAGCTGGTTTCA CATTGCCATTTCAGCCAGCA
β-actin CGGAGTCAACGGATTTGGTC AGCCTTCTCCATGGTCGTGA

[i] Nrf 1, nuclear respiratory factor 1; Fos, FOS proto-oncogene; Yy1, YY1 transcription factor; ACC1, acetyl-coenzyme A carboxylase α; FAS, Fas cell surface death receptor; L-PK, L-type pyruvate kinase; MCAD, acetyl-coenzyme A dehydrogenase medium chain.

Western blotting

The treated myocardial cells (1×108 cells/well) were lysed using RIPA lysis buffer (Thermo Fisher Scientific, Inc.). Protein concentration was measured using a BCA protein assay kit (Thermo Fisher Scientific, Inc.), and 10 µg of proteins were separated using SDS-PAGE (12% gel). Protein was transferred onto a polyvinylidene fluoride membrane (EMD Millipore). Following blocking with 5% bovine serum albumin (BSA; Sigma-Aldrich; Merck KGaA) for 2 h at 37°C, the membranes were incubated with the following primary antibodies: TNF-α (1:1,000; cat. no. ab6671; Abcam), IL-1β (1:1,000; cat. no. ab200478; Abcam), IL-6 (1:1,000; cat. no. ab7737; Abcam), nuclear respiratory factor 1 (Nrf1; 1:1,000; cat. no. ab175932; Abcam), FOS proto-oncogene (Fos; 1:1,000; cat. no. ab208942; Abcam), YY1 transcription factor (Yy1; 1:1,000; cat. no. ab109237; Abcam), acetyl-coenzyme A carboxylase a (ACC1; 1:1,000; cat. no. ab45174; Abcam), Fas cell surface death receptor (FAS; 1:1,000; cat. no. ab15285; Abcam), L-type pyruvate kinase (L-PK; 1:1,000; cat. no. ab202468; Abcam), acetyl-coenzyme A dehydrogenase medium chain (MCAD; 1:1,000; cat. no. ab92461; Abcam) and β-actin (1:2,000; cat. no. ab8226; Abcam) for 12 h at 4°C. Following three washes with PBS, the membranes were incubated with horseradish peroxidase-conjugated anti-rabbit immunoglobulin G antibody (1:2,000; cat. no. PV-6001; OriGene Technologies, Inc.) for 24 h at 4°C. The membranes were washed with PBS and visualized with ECL Western blotting detection reagents (GE Healthcare). The band intensities were analyzed using ImageJ software 2.0 (National Institutes of Health).

Statistical analysis

Data are presented as the mean ± SD. SPSS 19.0 software (IBM Corp.) was used for statistical analysis. The experiments were performed at least three times. Student's t-test was used for comparisons between two groups and one-way analysis of variance followed by Tukey post hoc test was used to evaluate the differences for multiple comparisons. P<0.05 was considered to indicate a statistically significant difference.

Results

Puerarin improves cardiac function and increases survival rates in rats with chronic heart failure

The effects of puerarin on body weight, cardiac function and survival rate were analyzed in rat models of chronic heart failure. Body weight was significantly increased in the puerarin treatment group compared with the PBS group 30 days after treatment (P<0.05; Fig. 1A). Puerarin treatment significantly improved cardiac function, as indicated by increased FS, LVEF, CO and HR compared with the PBS group (all P<0.01; Fig. 1B-E, P<0.01). Puerarin treatment significantly increased the survival rate of rats compared with the PBS group (Fig. 1F, P<0.01). These results indicated that puerarin may improve cardiac function and survival rate of rats with chronic heart failure.

Figure 1.

Puerarin improves body weight and cardiac function and increases survival rate of rats with chronic heart failure. (A) Effects of puerarin on body weight of rats. Effects of puerarin on (B) FS, (C) LVEF, (D) CO and (E) HR. (F) Effects of puerarin on the survival rate of rats with chronic heart failure. *P<0.05 and **P<0.01 vs. PBS. FS, fractional shortening; LVEF, left ventricular ejection fraction; CO, cardiac output; HR, heart rate; ns, not significant.

Puerarin decreases LDH and SDH levels in rats with chronic heart failure

The effects of puerarin on LDH and SDH levels were analyzed in serum of a rat chronic heart failure models. The results demonstrated that serum LDH (P<0.05) and SDH (P<0.01) levels were significantly lower in the puerarin-treated group compared with the PBS group (Fig. 2). These results indicated that puerarin may ameliorate chronic heart failure by decreasing LDH and SDH levels.

Figure 2.

Puerarin decreases LDH and SDH levels in rats with chronic heart failure. *P<0.05 and **P<0.01 vs. PBS. LDH, lactate dehydrogenase; SDH, succinate dehydrogenase; ns, not significant.

Puerarin inhibits myocardial apoptosis and inflammation in rats with chronic heart failure

The antiapoptotic and anti-inflammatory effects of puerarin in myocardial tissues were analyzed in a rat chronic heart failure model. The administration of puerarin decreased the number of TUNEL-positive cells in myocardial tissue compared with the PBS group (Fig. 3A, P<0.01). In addition, puerarin treatment increased the expression of GLUT4 and decreased the expression of CD36 compared with the PBS group (Fig. 3B, P<0.01). Of note, compared with the PBS group, the puerarin-treated group exhibited decreased serum levels of BNP, CRP, troponin T and creatinine (Fig. 3C-E, P<0.05 and P<0.01). These results indicated that puerarin may have antiapoptotic and anti-inflammatory efficacy in rats with chronic heart failure.

Figure 3.

Puerarin inhibits myocardial apoptosis and inflammation in rats with chronic heart failure. (A) The percentage of TUNEL-positive cells in myocardial tissue was reduced in the puerarin group compared with the PBS group. (B) Expression of GLUT4 and CD36 in myocardial tissues. Serum levels of (C) BNP and troponin T, (D) CRP and (E) creatinine were reduced in rats with chronic heart failure treated with puerarin compared with the PBS group. *P<0.05 and **P<0.01 vs. PBS. GLUT4, glucose transporter type 4; ns, not significant; CRP, c reactive protein.

Puerarin decreases expression levels of inflammatory markers in a rat chronic heart failure model

Effects of puerarin on inflammatory markers were analyzed in rats with chronic heart failure. Compared with the PBS group, puerarin treatment decreased serum levels of TNF-α, IL-1β and IL-6 in rats with chronic heart failure (Fig. 4A, P<0.01). No significant differences were observed between the puerarin and sham groups following 4-week treatment. Immunohistochemistry demonstrated that puerarin decreased TNF-α, IL-1β and IL-6 expression levels in myocardial tissue in rats with chronic heart failure compared with the PBS group (Fig. 4B, P<0.01). The results indicated that puerarin may effectively inhibit inflammatory markers in rats with chronic heart failure.

Figure 4.

Puerarin inhibits inflammation in a rat chronic heart failure model. Puerarin treatment reduced (A) serum and (B) myocardial tissue levels of TNF-α, IL-1β and IL-6 compared with the PBS group. **P<0.01. TNFα, tumor necrosis factor α; IL, interleukin; ns, not significant.

Puerarin upregulates PPARα and its downstream target genes in myocardial cells in a rat chronic heart failure model

PPARα and its downstream target gene expression levels were analyzed in rat myocardial cells. Puerarin increased PPARα and its downstream target Nrf1, Fos and Yy1 gene and protein expression levels in myocardial cells from rats with chronic heart failure compared with control (Fig. 5A and B, P<0.01). Puerarin also upregulated the expression of PPARα downstream target genes ACC1, FAS, L-PK and MCAD compared with the control group (Fig. 5C and D, P<0.01). These results indicated that puerarin may upregulate PPARα and its downstream target genes in myocardial cells from rats with chronic heart failure.

Figure 5.

Puerarin increases the expression levels of PPARα and its downstream target genes in cardiac cells from rat models of chronic heart failure. Effects of puerarin on PPARα, Nrf1, Fos and Yy1 (A) mRNA and (B) protein expression in myocardial cells. Effects of puerarin on (C) gene and (D) protein expression levels of ACC1, FAS, L-PK and MCAD. **P<0.01 vs. control. PPARα, peroxisome proliferator-activated receptor α; Nrf 1, nuclear respiratory factor 1; Fos, FOS proto-oncogene; Yy1, YY1 transcription factor; ACC1, acetyl-coenzyme A carboxylase α; FAS, Fas cell surface death receptor; L-PK, L-type pyruvate kinase; MCAD, acetyl-coenzyme A dehydrogenase medium chain.

Puerarin suppresses apoptosis and inflammation in myocardial cells

The anti-inflammatory and antiapoptotic efficacy of puerarin was further analyzed in myocardial cells in vitro. Puerarin significantly decreased TNF-α, IL-1β and IL-6 expression in myocardial cells compared with control group (Fig. 6A, P<0.01). In addition, puerarin attenuated apoptosis of myocardial cells compared with the control group (Fig. 6B, P<0.01). These results indicated that puerarin may have anti-inflammatory and antiapoptotic efficacy in myocardial cells.

Figure 6.

Puerarin inhibits apoptosis and inflammation in myocardial cells. (A) Puerarin treatment downregulated the expression of inflammatory factors TNF-α, IL-1β and IL-6 in myocardial cells. (B) Puerarin attenuated apoptosis in myocardial cells. **P<0.01 vs. control. TNFα, tumor necrosis factor α; IL, interleukin.

Puerarin inhibits apoptosis and inflammation in myocardial cells via the PPARα pathway

The potential mechanism of puerarin activity was analyzed in myocardial cells. The results demonstrated that transfection with si-PPARα decreased the expression level of PPARα and its downstream targets, including Nrf1, Fos and Yy1 compared with the si-mimic group (Fig. 7A; P<0.01). Western blotting results revealed that knockdown of PPARα increased the protein expression of inflammatory factors TNF-α, IL-1β and IL-6 in myocardial cells compared with the si-mimic group; this effect was reversed in myocardial cells treated with puerarin (Fig. 7B; P<0.01). TUNEL assay demonstrated that treatment with puerarin reversed the effect of PPARα knockdown on apoptosis of myocardial cells isolated form experimental rats (Fig. 7C; P<0.05). These results suggested that puerarin may inhibit apoptosis and inflammation in myocardial cells via the PPARα pathway in rats with chronic heart failure.

Figure 7.

Puerarin reverses the pro-apoptotic and pro-inflammatory effects of PPARα knockdown. (A) Effects of PPARα knockdown on the expression levels of PPARα and its downstream target proteins Nrf1, Fos and Yy1 in myocardial cells. (B) Effects of PPARα knockdown on the expression levels of inflammatory factors TNF-α, IL-1β and IL-6 in myocardial cells in the presence or absence of puerarin. (C) Effects of PPARα knockdown and puerarin treatment on apoptosis of myocardial cells. *P<0.05 and **P<0.01 as indicated. PPARα, peroxisome proliferator-activated receptor a; Nrf 1, nuclear respiratory factor 1; Fos, FOS proto-oncogene; Yy1, YY1 transcription factor; si-PPARα, small interfering RNA targeting PPARα; si-mimic, control small interfering RNA; TNFα, tumor necrosis factor α; IL, interleukin; ns, not significant.

Discussion

Previous reports have indicated that the mortality rate of patients with chronic heart failure is increasing and suggested that improving the treatment of chronic heart failure may contribute the survival of patients (33–35). The present study aimed to determine whether puerarin treatment exhibits therapeutic efficacy in rats with chronic heart failure. The results of the present study demonstrated that puerarin treatment significantly improved cardiac function and increased body weight during a 4-week treatment following chronic heart failure model induction. In addition, the levels of inflammatory markers TNF-α, IL-1β and IL-6 were reduced by puerarin compared with PBS treatment in rats. Puerarin increased the expression of PPARα and its downstream target genes GLUT4 and CD36 compared with PBS treatment, which are involved in the cardiac metabolism (36). The results of the present study also demonstrated that puerarin decreased LDH and SDH levels in rats with chronic heart failure compared with PBS.

Increases in TNF-α levels may contribute to the progression of cardiac remodeling and decompensated heart failure (37). TNF-α, IL-1β and IL-6 are the major pro-inflammatory markers identified as contributors to chronic heart failure (38). The results of the present study demonstrated that puerarin decreased serum levels of TNF-α, IL-1β and IL-6 in a rat chronic heart failure model. However, the prognostic value of inflammatory markers TNF-α, IL-1β and IL-6 requires further analysis in patients with chronic heart failure.

Changes in the myocardial activities of LDH and SDH in the experimental models of diabetic and post-infarction damage are parameters used in evaluating abnormal processes of glycolysis and oxidative phosphorylation in rat cardiac mitochondria (39). A previous study has indicated that decreasing the creatine kinase-MB and LDH levels protected the heart against ischemia-reperfusion injury (40). The results of the present study revealed that puerarin attenuated serum LDH and SDH levels in rats with chronic heart failure, which may be one of mechanisms by which puerarin significantly increased the survival rate and improved cardiac function of experimental rats. Additionally, a previous study has reported that puerarin improved cardiac function through regulation of energy metabolism in streptozotocin-nicotinamide induced diabetic mice following myocardial infarction (41). The present study demonstrated that puerarin significantly improved FS, EF, CO and HR compared with PBS-treated in rats with chronic heart failure.

Acute myocardial infarction increases cardiac GLUT4 levels and partially preserves heart function in spontaneously hypertensive rats (42). CD36 mediates the cardiovascular action of growth hormone-releasing peptides in the heart, and the coronary vasoconstrictive response correlates with CD36 expression levels (43). The present study demonstrated that puerarin treatment increased the expression levels of GLUT4 and decreased the expression levels of CD36. PPARs are nuclear hormone receptors that regulate genes involved in energy metabolism and inflammation (44). The results of the present study revealed that puerarin increased the expression of downstream target genes of PPARα involved in a range of metabolic pathways, including Nrf1, Fos, Yy1, ACC1, FAS, L-PK and MCAD, which enhance metabolic plasticity of skeletal muscles (45). In addition, puerarin increased the body weight of rats with chronic heart failure, which indicated that puerarin may regulate energy metabolism in myocardial cells; however, this requires further investigation. The results of the present study demonstrated that puerarin reversed the pro-apoptotic and pro-inflammatory effects of PPARα knockdown in myocardial cells, which suggested that puerarin inhibited apoptosis and inflammation in myocardial cells via the PPARα pathway.

In conclusion, the results of the present study indicated that puerarin exhibited ameliorative properties on myocardial function in a rat chronic heart failure model through the regulation of myocardial cell apoptosis. The results revealed that decreased LDH and SDH levels, as well as decreased expression levels of inflammatory markers, including TNF-α, IL-1β and IL-6, were identified in puerarin-treated rats with chronic heart failure. These data suggest that puerarin may be a promising agent for therapeutic intervention in treating chronic heart failure.

Acknowledgements

Not applicable.

Funding

This study was supported by the Science and Technology Fund of Tianjin Municipal Commission of Health and Family Planning, Tianjin, China (grant no. 2015KY32) and the Science and Technology Fund of Tianjin Chest Hospital, Tianjin, China (grant no. 2018XKZ06).

Availability of data and materials

The analyzed datasets generated during the study are available from the corresponding author on reasonable request.

Authors' contributions

LH and TW performed the experiments. BWC and FML prepared and analyzed experimental data. JX designed the study.

Ethics approval and consent to participate

The present study was approved by the Ethics Committee of Tianjin Chest Hospital.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Wang Y, Li X, Li Z, Zhang Y and Wang D: YiQiFuMai injection for chronic heart failure: Protocol for a systematic review and meta-analysis. Medicine (Baltimore). 97:e99572018. View Article : Google Scholar : PubMed/NCBI

2 

Taylor KS, Verbakel JY, Feakins BG, Price CP, Perera R, Bankhead C and Plüddemann A: Diagnostic accuracy of point-of-care natriuretic peptide testing for chronic heart failure in ambulatory care: Systematic review and meta-analysis. BMJ. 361:k14502018. View Article : Google Scholar : PubMed/NCBI

3 

Neubauer S, Zeidler J, Schilling T, Engel S, Linder R, Verheyen F, Haverich A and von der Schulenburg JG: Suitability and usability of claims data for review of guidelines for the treatment of chronic heart failure. Gesundheitswesen. 78:e135–e144. 2016.PubMed/NCBI

4 

McCormack PL: Sacubitril/valsartan: A review in chronic heart failure with reduced ejection fraction. Drugs. 76:387–396. 2016. View Article : Google Scholar : PubMed/NCBI

5 

Carvalho VO: Aerobic exercise prescription in patients with chronic heart failure: A review in the beta-blocker era. J Cardiovasc Med (Hagerstown). 13:570–574. 2012. View Article : Google Scholar : PubMed/NCBI

6 

Augustin U and Henschke C: Does telemonitoring lead to health and economic benefits in patients with chronic heart failure? -a systematic review. Gesundheitswesen. 74:e114–121. 2012.(In German). PubMed/NCBI

7 

Zhang X, Ma LL, Yao DK and Wang LX: Prediction values of T wave alternans for sudden cardiac death in patients with chronic heart failure: A brief review. Congest Heart Fail. 17:152–156. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Antoniadis AP, Sieniewicz B, Gould J, Porter B, Webb J, Claridge S, Behar JM and Rinaldi CA: Updates in cardiac resynchronization therapy for chronic heart failure: Review of multisite pacing. Curr Heart Fail Rep. 14:376–383. 2017. View Article : Google Scholar : PubMed/NCBI

9 

Antoniadis AP, Sieniewicz B, Gould J, Porter B, Webb J, Claridge S, Behar JM and Rinaldi CA: Erratum to: Updates in cardiac resynchronization therapy for chronic heart failure: Review of multisite pacing. Curr Heart Fail Rep. 14:3842017. View Article : Google Scholar : PubMed/NCBI

10 

Health Quality Ontario: Effect of early follow-up after hospital discharge on outcomes in patients with heart failure or chronic obstructive pulmonary disease: A systematic review. Ont Health Technol Assess Ser. 17:1–37. 2017.

11 

Wang W, Jiang T, Li C, Chen J, Cao K, Qi LW, Li P, Zhu W, Zhu B and Chen Y: Will testosterone replacement therapy become a new treatment of chronic heart failure? A review based on 8 clinical trials. J Thorac Dis. 8:E269–E277. 2016. View Article : Google Scholar : PubMed/NCBI

12 

Vongmany J, Hickman LD, Lewis J, Newton PJ and Phillips JL: Anxiety in chronic heart failure and the risk of increased hospitalisations and mortality: A systematic review. Eur J Cardiovasc Nurs. 15:478–485. 2016. View Article : Google Scholar : PubMed/NCBI

13 

Siouta N, van Beek K, Preston N, Hasselaar J, Hughes S, Payne S, Garralda E, Centeno C, van der Eerden M, Groot M, et al: Towards integration of palliative care in patients with chronic heart failure and chronic obstructive pulmonary disease: A systematic literature review of European guidelines and pathways. BMC Palliat Care. 15:182016. View Article : Google Scholar : PubMed/NCBI

14 

Webb N, Cowie MR, Taylor M, Briggs A, Cohen A, de Pouvourville G, Haroun R, Trueman D and Deschaseaux C: The cost-effectiveness of treatment for chronic heart failure: A systematic review. Value Health. 18:A3912015. View Article : Google Scholar

15 

Kane PM, Murtagh FE, Ryan K, Mahon NG, McAdam B, McQuillan R, Ellis-Smith C, Tracey C, Howley C, Raleigh C, et al: The gap between policy and practice: A systematic review of patient-centred care interventions in chronic heart failure. Heart Fail Rev. 20:673–687. 2015. View Article : Google Scholar : PubMed/NCBI

16 

Macdonald PS: Combined angiotensin receptor/neprilysin inhibitors: A review of the new paradigm in the management of chronic heart failure. Clin Ther. 37:2199–2205. 2015. View Article : Google Scholar : PubMed/NCBI

17 

Shochat MK, Shotan A, Blondheim DS, Kazatsker M, Dahan I, Asif A, Rozenman Y, Kleiner I, Weinstein JM, Frimerman A, et al: Non-invasive lung IMPEDANCE-guided preemptive treatment in chronic heart failure patients: A randomized controlled trial (IMPEDANCE-HF Trial). J Card Fail. 22:713–722. 2016. View Article : Google Scholar : PubMed/NCBI

18 

Kervadec A, Bellamy V, El Harane N, Arakélian L, Vanneaux V, Cacciapuoti I, Nemetalla H, Périer MC, Toeg HD, Richart A, et al: Cardiovascular progenitor-derived extracellular vesicles recapitulate the beneficial effects of their parent cells in the treatment of chronic heart failure. J Heart Lung Transplant. 35:795–807. 2016. View Article : Google Scholar : PubMed/NCBI

19 

Markgren R, Brännström M, Lundgren C and Boman K: Impacts of person-centred integrated chronic heart failure and palliative home care on pharmacological heart failure treatment: A substudy of a randomised trial. BMJ Support Palliat Care. 9:e102016. View Article : Google Scholar : PubMed/NCBI

20 

Zhang H, Liu Y, Lao M, Ma Z and Yi X: Puerarin protects Alzheimer's disease neuronal cybrids from oxidant-stress induced apoptosis by inhibiting pro-death signaling pathways. Exp Gerontol. 46:30–37. 2011. View Article : Google Scholar : PubMed/NCBI

21 

Zhu G, Wang X, Chen Y, Yang S, Cheng H, Wang N and Li Q: Puerarin protects dopaminergic neurons against 6-hydroxydopamine neurotoxicity via inhibiting apoptosis and upregulating glial cell line-derived neurotrophic factor in a rat model of Parkinson's disease. Planta Med. 76:1820–1826. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Qin F, Huang X, Zhang HM and Ren P: Pharmacokinetic comparison of puerarin after oral administration of Jiawei-Xiaoyao-San to healthy volunteers and patients with functional dyspepsia: Influence of disease state. J Pharm Pharmacol. 61:125–129. 2009. View Article : Google Scholar : PubMed/NCBI

23 

Duan S, Li YF and Luo XL: Effect of puerarin on heart function and serum oxidized-LDL in the patients with chronic cardiac failure. Hunan Yi Ke Da Xue Xue Bao. 25:176–178. 2000.(In Chinese). PubMed/NCBI

24 

He H, Shi M, Yang J, Zeng X, Qiao H, Wu L and Li L: The correlation between angiogenesis and abnormal expression of SERCA2a, phospholamban and the endothelin pathway in heart failure, and improvement by puerarin. Phytother Res. 22:948–956. 2008. View Article : Google Scholar : PubMed/NCBI

25 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

26 

Liu B, Zhao C, Li H, Chen X, Ding Y and Xu S: Puerarin protects against heart failure induced by pressure overload through mitigation of ferroptosis. Biochem Biophys Res Commun. 497:233–240. 2018. View Article : Google Scholar : PubMed/NCBI

27 

Zhirov IV, Zaseeva AV, Masenko VP and Tereshchenko SN: Peroxisome proliferator-activated receptors-alpha (PPAR-alpha) and chronic heart failure: Is there a reason to discuss the metabolic strategy of treatment? Ter Arkh. 86:78–82. 2014.(In Russian). PubMed/NCBI

28 

Fu YH, Lin QX, Li XH, Fei HW, Shan ZX, Huang XZ, Liu XY, Yang M, Lin SG, Zhou SF, et al: A novel rat model of chronic heart failure following myocardial infarction. Methods Find Exp Clin Pharmacol. 31:367–373. 2009.PubMed/NCBI

29 

Zhao W, Liu L, Wang Y, Mao T and Li J: Effects of a combination of puerarin, baicalin and berberine on the expression of proliferator-activated receptor-γ and insulin receptor in a rat model of nonalcoholic fatty liver disease. Exp Ther Med. 11:183–190. 2016. View Article : Google Scholar : PubMed/NCBI

30 

Kirk RGW: Recovering the principles of humane experimental technique: The 3Rs and the human essence of animal research. Sci Technol Human Values. 43:622–648. 2018. View Article : Google Scholar : PubMed/NCBI

31 

Dergilev KV, Tsokolaeva ZI, Rubina KA, Sysoeva VY, Makarevich PI, Boldyreva MA, Beloglazova IB, Zubkova ES, Sharonov GV, Akchurin RS and Parfyonova YV: Isolation and characterization of cardiac progenitor cells obtaining from myocardial right atrial appendage tissue. Tsitologiia. 58:340–348. 2016.(In English, Russian). PubMed/NCBI

32 

Sun WP, Lu YX, Zhang XY, Tang WW and Huang QY: Effects of cocaine on activities of ATPase, LDH and SDH in mouse splenocytes. Fa Yi Xue Za Zhi. 26:81–83. 2010.(In Chinese). PubMed/NCBI

33 

Lin MH, Yuan WL, Huang TC, Zhang HF, Mai JT and Wang JF: Clinical effectiveness of telemedicine for chronic heart failure: A systematic review and meta-analysis. J Investig Med. 65:899–911. 2017. View Article : Google Scholar : PubMed/NCBI

34 

Yohannes AM, Chen W, Moga AM, Leroi I and Connolly MJ: Cognitive impairment in chronic obstructive pulmonary disease and chronic heart failure: A systematic review and meta-analysis of observational studies. J Am Med Dir Assoc. 18:451 e451–451 e411. 2017. View Article : Google Scholar

35 

Crowley MJ, Diamantidis CJ, McDuffie JR, Cameron CB, Stanifer JW, Mock CK, Wang X, Tang S, Nagi A, Kosinski AS and Williams JW Jr: Clinical outcomes of metformin use in populations with chronic kidney disease, congestive heart failure, or chronic liver disease: A systematic review. Ann Intern Med. 166:191–200. 2017. View Article : Google Scholar : PubMed/NCBI

36 

Heather LC, Pates KM, Atherton HJ, Cole MA, Ball DR, Evans RD, Glatz JF, Luiken JJ, Griffin JL and Clarke K: Differential translocation of the fatty acid transporter, FAT/CD36, and the glucose transporter, GLUT4, coordinates changes in cardiac substrate metabolism during ischemia and reperfusion. Circ Heart Fail. 6:1058–1066. 2013. View Article : Google Scholar : PubMed/NCBI

37 

Tziakas D, Chalikias G, Parissis JT, Hatzinikolaou H, Stakos D, Papadopoulou E, Kortsaris A and Hatseras D: Prolonged activation of tumor necrosis factor (TNF)-alpha and its soluble receptors in chronic heart failure patients both in the compensated and decompensated state. Interplay between their levels and metalloproteinase-3. Eur Cytokine Netw. 15:231–239. 2004.PubMed/NCBI

38 

Adamopoulos S, Parissis JT and Kremastinos DT: A glossary of circulating cytokines in chronic heart failure. Eur J Heart Fail. 3:517–526. 2001. View Article : Google Scholar : PubMed/NCBI

39 

Afanasiev SA, Egorova MV, Kondratyeva DS, Batalov RE and Popov SV: Comparative analysis of changes of myocardial angiogenesis and energy metabolism in postinfarction and diabetic damage of rat heart. J Diabetes Res. 2014:8278962014. View Article : Google Scholar : PubMed/NCBI

40 

Amani M, Jeddi S, Ahmadiasl N, Usefzade N and Zaman J: Effect of HEMADO on level of CK-MB and LDH enzymes after ischemia/reperfusion injury in isolated rat heart. Bioimpacts. 3:101–104. 2013.PubMed/NCBI

41 

Cheng W, Wu P, Du Y, Wang Y, Zhou N, Ge Y and Yang Z: Puerarin improves cardiac function through regulation of energy metabolism in Streptozotocin-Nicotinamide induced diabetic mice after myocardial infarction. Biochem Biophys Res Commun. 463:1108–1114. 2015. View Article : Google Scholar : PubMed/NCBI

42 

Schaun MI, Marschner RA, Peres TR, Markoski MM and Lehnen AM: Aerobic training prior to myocardial infarction increases cardiac GLUT4 and partially preserves heart function in spontaneously hypertensive rats. Appl Physiol Nutr Metab. 42:334–337. 2017. View Article : Google Scholar : PubMed/NCBI

43 

Bodart V, Febbraio M, Demers A, McNicoll N, Pohankova P, Perreault A, Sejlitz T, Escher E, Silverstein RL, Lamontagne D and Ong H: CD36 mediates the cardiovascular action of growth hormone-releasing peptides in the heart. Circ Res. 90:844–849. 2002. View Article : Google Scholar : PubMed/NCBI

44 

Haemmerle G, Moustafa T, Woelkart G, Büttner S, Schmidt A, van de Weijer T, Hesselink M, Jaeger D, Kienesberger PC, Zierler K, et al: ATGL-mediated fat catabolism regulates cardiac mitochondrial function via PPAR-α and PGC-1. Nat Med. 17:1076–1085. 2011. View Article : Google Scholar : PubMed/NCBI

45 

Muoio DM, MacLean PS, Lang DB, Li S, Houmard JA, Way JM, Winegar DA, Corton JC, Dohm GL and Kraus WE: Fatty acid homeostasis and induction of lipid regulatory genes in skeletal muscles of peroxisome proliferator-activated receptor (PPAR) alpha knock-out mice. Evidence for compensatory regulation by PPAR delta. J Biol Chem. 277:26089–26097. 2002. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
He L, Wang T, Chen BW, Lu FM and Xu J: Puerarin inhibits apoptosis and inflammation in myocardial cells via PPARα expression in rats with chronic heart failure Retraction in /10.3892/etm.2025.12916. Exp Ther Med 18: 3347-3356, 2019.
APA
He, L., Wang, T., Chen, B., Lu, F., & Xu, J. (2019). Puerarin inhibits apoptosis and inflammation in myocardial cells via PPARα expression in rats with chronic heart failure Retraction in /10.3892/etm.2025.12916. Experimental and Therapeutic Medicine, 18, 3347-3356. https://doi.org/10.3892/etm.2019.7984
MLA
He, L., Wang, T., Chen, B., Lu, F., Xu, J."Puerarin inhibits apoptosis and inflammation in myocardial cells via PPARα expression in rats with chronic heart failure Retraction in /10.3892/etm.2025.12916". Experimental and Therapeutic Medicine 18.5 (2019): 3347-3356.
Chicago
He, L., Wang, T., Chen, B., Lu, F., Xu, J."Puerarin inhibits apoptosis and inflammation in myocardial cells via PPARα expression in rats with chronic heart failure Retraction in /10.3892/etm.2025.12916". Experimental and Therapeutic Medicine 18, no. 5 (2019): 3347-3356. https://doi.org/10.3892/etm.2019.7984
Copy and paste a formatted citation
x
Spandidos Publications style
He L, Wang T, Chen BW, Lu FM and Xu J: Puerarin inhibits apoptosis and inflammation in myocardial cells via PPARα expression in rats with chronic heart failure Retraction in /10.3892/etm.2025.12916. Exp Ther Med 18: 3347-3356, 2019.
APA
He, L., Wang, T., Chen, B., Lu, F., & Xu, J. (2019). Puerarin inhibits apoptosis and inflammation in myocardial cells via PPARα expression in rats with chronic heart failure Retraction in /10.3892/etm.2025.12916. Experimental and Therapeutic Medicine, 18, 3347-3356. https://doi.org/10.3892/etm.2019.7984
MLA
He, L., Wang, T., Chen, B., Lu, F., Xu, J."Puerarin inhibits apoptosis and inflammation in myocardial cells via PPARα expression in rats with chronic heart failure Retraction in /10.3892/etm.2025.12916". Experimental and Therapeutic Medicine 18.5 (2019): 3347-3356.
Chicago
He, L., Wang, T., Chen, B., Lu, F., Xu, J."Puerarin inhibits apoptosis and inflammation in myocardial cells via PPARα expression in rats with chronic heart failure Retraction in /10.3892/etm.2025.12916". Experimental and Therapeutic Medicine 18, no. 5 (2019): 3347-3356. https://doi.org/10.3892/etm.2019.7984
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team