Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
May-2021 Volume 21 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2021 Volume 21 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Anti‑inflammatory effects of Fritillaria thunbergii Miquel extracts in LPS‑stimulated murine macrophage RAW 264.7 cells

  • Authors:
    • Jae-Hyun Kim
    • Minsun Kim
    • Sooyeon Hong
    • Boguen Kwon
    • Min Wook Song
    • Kwangchan Song
    • Eun-Young Kim
    • Hyuk-Sang Jung
    • Youngjoo Sohn
  • View Affiliations / Copyright

    Affiliations: Department of Anatomy, College of Korean Medicine, Kyung Hee University, Seoul 02447, Republic of Korea
    Copyright: © Kim et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 429
    |
    Published online on: February 26, 2021
       https://doi.org/10.3892/etm.2021.9846
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The aim of the present study was to demonstrate that Fritillaria thunbergii Miquel extract exerts anti‑inflammatory and antioxidant effects on lipopolysaccharide‑stimulated RAW 264.7 cells. To confirm the inhibitory effect of ethyl acetate fraction of FTM (EAFM) on inflammation, the expression of nitric oxide (NO) and inflammatory cytokines was assessed by performing ELISA. Expression of intracellular mRNA and protein was confirmed by reverse transcription PCR and western blotting. In addition, the anti‑inflammatory and anti‑oxidant mechanisms of NF‑κB, MAPK and heme oxygenase‑1 (HO‑1) were also investigated. EAFM significantly inhibited the expression of inflammatory factors including NO, IL‑6 and TNF‑α at non‑toxic concentrations. EAFM also inhibited the mRNA and protein expression of inducible nitric oxide synthase in a concentration‑dependent manner, but did not alter the expression of cyclooxygenase‑2. Pre‑treatment with EAFM inhibited the nuclear translocation of NF‑κB, and suppressed the phosphorylation of ERK and JNK. In addition, EAFM induced 2,2'‑azino‑bis(3‑ethylbenzothiazoline‑6‑sulfonic acid) radical scavenging activity and an increase in the expression of nuclear factor erythroid 2‑related factor 2 (Nrf2) and HO‑1. The results indicated that EAFM inhibited the expression of pro‑inflammatory cytokines by inhibiting ERK/JNK phosphorylation and NF‑κB translocation. EAFM also exerted antioxidant effects via Nrf2/HO‑1 stimulation. Collectively, the results of the present study indicated that EAFM may be a valuable alternative for the treatment of a variety of inflammatory diseases.

Introduction

Inflammation is an immune response to infections and tissue injury. An appropriate inflammatory response is indispensable in protecting the body from internal and external factors (1). However, excessive and irreversible inflammation causes destruction of normal tissues, which may result in diseases such as cancer, sepsis, atherosclerosis and autoimmunity (2).

Lipopolysaccharide (LPS) is a naturally-derived glycolipid compound that is commonly used to evaluate the anti-inflammatory effects of macrophages in vitro. As one of the cell membrane components of gram-negative bacteria (3), LPS is recognized by toll-like receptor 4 and stimulates mitogen-activated protein kinase (MAPK) and nuclear factor-kappa B (NF-κB) signaling, key pathways of the inflammatory response (4). As a result, LPS signaling promotes the secretion of inflammatory mediators such as inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2) and nitric oxide (NO) and induces the expression of inflammatory cytokines such as interleukin (IL)-6, IL-1β and tumor necrosis factor-alpha (TNF-α) (5). Additionally, the antioxidant effects of upregulating nuclear factor erythroid 2-related factor 2 (Nrf2) and heme oxygenase-1 (HO-1) are known to suppress the expression of various LPS-induced inflammatory factors. HO-1 is a protein associated with stress, ischemia and inflammatory conditions, and primarily exhibits protective, anti-inflammatory, antioxidant and anti-proliferative effects (6). Therefore, the anti-inflammatory mechanisms of MAPKs and NF-κB, and the antioxidant effects of HO-1 expression, are common research targets for the treatment of inflammation.

A variety of diseases share the same underlying pathophysiological mechanisms of inflammation, and research into natural medicines to treat inflammation has gained considerable popularity. Fritillaria thunbergii Miquel (FTM) is located in the stem of Fritillaria thunbergii, a herbal medicine that is commonly used in East Asian regions including Korea, China and Japan. FTM (or ‘Jeol-pae-mo’ in Korean) has traditionally been used to effectively reduce heat, remove phlegm and prevent coughing (7). In a recent study, FTM was shown to inhibit the expression of cytokines following PMA/A23187 stimulation of HMC-1 cells, and to inhibit cytokine expression in an acute inflammatory BALB/c mouse model (8). In addition, peimine and peiminie, the main active ingredients of FTM, were found to improve DNCB-induced atopy (9,10). However, to the best of our knowledge, there are no studies of the LPS-induced inflammatory factors and antioxidant effects of the extract and fractions of FTM in macrophages.

In the present study, the potential anti-inflammatory effects of FTM extract and fractions were investigated through the verification of NO and prostaglandin E2 (PGE2) expression. To improve our understanding of the anti-inflammatory properties of FTM, its effects on the expression of MAPKs, NF-κB, pro-inflammatory cytokines and HO-1 were also investigated.

Materials and methods

Reagents

Dulbecco's modified Eagle's medium (DMEM) was obtained from Welgene, Inc., Gyeongsan, Korea. LPS, dimethylsulfoxide (DMSO), fetal bovine serum (FBS) and penicillin/streptomycin (P/S) were procured from Gibco; Thermo Thermo Fisher Scientific, Inc. C27H45NO3: (3β,5α,6α,22β)-Cevane-3,6,20-triol (peimine) and C27H43NO3 (peiminine) were supplied by Abcam. The Cell Counting Kit-8 (CCK-8) was purchased from Dojindo Molecular Technologies, Inc. Griess reagent, 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) assay kit (cat. no. CS0790), the bicinchoninic acid assay (BCA) kit, protease inhibitor, and phosphatase inhibitor 2 and 3 cocktails were supplied by Sigma-Aldrich (Merck KGaA). IL-1β, IL-6 and TNF-α enzyme-linked immunosorbent assay (ELISA) kits were obtained from BD Biosciences and the PGE2 ELISA kit was supplied by R&D Systems, Inc. The reverse transcriptase and SYBR® Green reagents were purchased from Invitrogen (Thermo Fisher Scientific, Inc.) and Taq polymerase was purchased from Kapa Biosystems (Roche Diagnostics). PCR primers were designed by GenoTech Corp. The anti-iNOS (cat. no. sc-651), anti-COX-2 (cat. no. sc-1746), anti-Nrf2 (cat. no. sc-722), anti-actin (cat. no. sc-8432) and anti-lamin B (cat. no. sc6216) primary antibodies, and the enhanced chemiluminescence (ECL) reagent were supplied by Santa Cruz Biotechnology, Inc. The anti-HO-1 (cat. no. GTX61906) antibody was obtained from GeneTex, Inc. Anti-NF-κB (cat. no. 8242S), anti-extracellular signal-regulated kinase 1/2 (ERK; cat. no. 4695S), anti-c-Jun N-terminal kinase (JNK; cat. no. 9258S), anti-p38 (cat. no. 9212L), anti-phosphorylated (p)-NF-κB (cat. no. 3033S), anti-p-ERK (cat. no. 4370S), anti-p-JNK (cat. no. 4668S) and anti-p-p38 (cat. no. 4511S) antibodies were supplied by Cell Signaling Technology, Inc. Horseradish peroxidase (HRP)-conjugated secondary antibodies (cat. nos. 115-035-062 and 111-035-045) were obtained from Jackson ImmunoResearch Laboratories, Inc. All chemicals and reagents were of cell culture grade.

FTM preparation

FTM was obtained from Omniherb and verified by Professor Yungmin Bu of the Herbology Laboratory, College of Korean Medicine, Kyung Hee University (Seoul, Korea); FTM voucher specimens are stored in the medicine storage room of the Anatomy Laboratory, College of Korean Medicine, Kyung Hee University. For extraction with methanol (MtOH), 100 g FTM was stored in 1 l MtOH (80%) for 1 week. The extract was concentrated and lyophilized to obtain 10.1 g of powder (yield ratio, 10.1%). For fractionation, 800 g FTM was immersed in 3 l MtOH (80%) for another week. The extract was filtered using filter paper and subsequently concentrated. The concentrate was sequentially fractionated using hexane, chloroform and ethyl acetate according to the polarity of the solvent. Briefly, 250 ml hexane was added to 500 ml of the water fraction and sufficiently mixed; the water and hexane fractions were separated, and 250 ml hexane was added to the water fraction once again; this sequence was repeated three times. Chloroform and ethyl acetate were then sequentially added to separate and collect each fraction, which was then concentrated, dried and used to assess activity. The hexane fraction was not extracted. Finally, 2.23 g chloroform (yield ratio, 0.28%) and 0.41 g ethyl acetate (yield ratio, 0.05%) were extracted, resulting in a final aqueous solution fraction of 11 g (yield). To extract FTM with ethanol, 100 g FTM was extracted by immersion in 1 L Et-OH (80%) for 1 week. The extract was concentrated and lyophilized to obtain 5.3 g powder (yield ratio, 5.3%). All extracts were stored at -4˚C and dissolved in DMSO prior to use.

High-performance liquid chromatography (HPLC) analysis

To qualitatively evaluate the FTM, HPLC (Waters® 2695/UV detector 2487 system) was performed using peimine and peiminine, constituent compounds of FTM. The XBridge™ C18 column (250x6 mm, 5 µm) was used for analysis, with a flow rate of 1 ml/min and a sample injection volume of 10 µl. H2O and acetonitrile (pH 10) were used as the binary mobile phase, and the detection wavelength of the chromatogram was set to 220 nm.

Cell culture and viability assay

The RAW 264.7 murine macrophage cell line was purchased from the Korean Cell Line Bank (Seoul, Korea). Cells were cultured in DMEM containing 10% FBS and 1% P/S at 37˚C (5% CO2, 95% humidity). To determine the effects of FTM on cellular viability, RAW 264.7 cells (5x104 cells/well) were seeded into 96-well culture plates, and cultured in serum-free medium for 24 h in the presence or absence of FTM (12.5, 25, 50 and 100 µg/ml). Then, 10 µl CCK-8 reagent was added to each well and the plates were incubated for an additional 2 h. Cell viability was determined by absorbance measurement at a wavelength of 450 nm (VersaMax microplate reader; Molecular Devices, LLC). The absorbance values are expressed as a percentage of the non-treated cells, and a value of <90% was considered to indicate cytotoxicity. Serum-free medium was used to eliminate serum-associated interference.

Nitric oxide (NO) production

To determine the effects of FTM on the production of NO, RAW 264.7 the cells (5x104 cells/well) were seeded into 96-well culture plates and cultured for 24 h in the presence or absence of LPS (1 µg/ml) and/or FTM (12.5, 25 and 50 µg/ml). To evaluate the expression of NO, 100 µl Griess reagent was added to 50 µl cell culture supernatant and allowed to react at room temperature for 30 min. The absorbance was measured using an ELISA reader at a wavelength of 540 nm, and NO levels were calculated using a sodium nitrite standard curve.

ELISA

To investigate the effects of FTM on the release of inflammatory cytokines and PGE2, RAW 264.7 cells (2x105 cells/well) were seeded into 24-well culture plates and incubated with or without LPS (1 µg/ml) and/or FTM (12.5, 25 and 50 µg/ml) for 24 h. Inflammatory cytokine (IL-6; cat no. 555240; IL-1β, cat. no. 559603; and TNF-α, cat. no. 555268) and PGE2 (cat. no. 555268; KGE004B) expression levels were measured using the corresponding ELISA kit per the manufacturers' instructions.

Western blot analysis

To investigate the effects of ethyl acetate fraction of FTM (EAFM) on the expression of NF-κB and MAPKs, RAW 264.7 cells (2x106 cells/well) were seeded into 60π dishes and incubated with or without LPS (1 µg/ml) and/or EAFM (12.5, 25 and 50 µg/ml) for 30 min. To confirm the effect of EAFM on the expression of iNOS and COX-2, RAW 264.7 cells (2x106 cells/well) were seeded into 6-well culture plates and incubated with or without LPS (1 µg/ml) and/or EAFM (12.5, 25 and 50 µg/ml) for 24 h. The cytoplasmic and nuclear proteins of RAW 264.7 cells were extracted using NE-PER™ Nuclear and Cytoplasmic Extraction Reagents (Invitrogen; Thermo Fisher Scientific, Inc.). The cells were lysed in RIPA buffer (composition: 50 mM Tris-Cl, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate and 0.1% SDS), and protease inhibitor and phosphatase inhibitor 2 and 3 cocktails were added to the extraction solutions. The protein concentration was quantified (30 µg) using a BCA assay kit with a bovine serum albumin standard. Equal amounts of protein was separated by 10% SDS-PAGE and electrotransferred onto nitrocellulose membranes. The membranes were blocked with 5% skim milk and incubated with primary antibodies at 4˚C for 24 h (iNOS, dilution ratio: 1:1,000, 130 kDa; COX-2, dilution ratio: 1:200, 70 kDa; β-actin, dilution ratio: 1:1,000, 42 kDa; p-ERK, dilution ratio: 1:1,000, 44, 42 kDa; ERK, dilution ratio: 1:1,000, 44, 42 kDa; p-JNK, dilution ratio: 1:1,000, 54, 46 kDa; JNK, dilution ratio: 1:1,000, 54, 46 kDa; p-p38, dilution ratio: 1:1,000, 40 kDa; p38, dilution ratio: 1:1,000, 40 kDa; NF-κB, dilution ratio: 1:500, 65 kDa; p-NF-κB, dilution ratio: 1:500, 65 kDa; Lamin B, dilution ratio: 1:1,000, 67 kDa; Nrf2, dilution ratio: 1:400, 120 kDa; HO-1, dilution ratio: 1:2,000, 33 kDa). HRP-conjugated secondary antibodies were then added and the membranes were incubated for 1 h at room temperature. Protein expression was visualized with an ECL reagent. The density of the bands was evaluated using the ImageJ software (version 1.51j8; National Institutes of Health) and the expression level of each protein was normalized to that of β-actin.

Reverse transcription PCR

To investigate the effects of EAFM on the expression of iNOS, COX-2 and pro-inflammatory cytokines, RAW 264.7 cells (2x106 cells/well) were seeded into 6-well culture plates and incubated with or without LPS (1 µg/ml) and/or EAFM (12.5, 25, 50 µg/ml) for 6 h. The expression of HO-1 was treated with EAFM (12.5, 25 and 50 µg/ml) for 24 h. Total cellular RNA was extracted using RNAiso (Total RNA extraction reagent; Takara Bio, Inc.) according to the manufacturers' protocol, and cDNA was synthesized using reverse transcriptase. PCR was conducted using a C1000 Touch™ Thermal Cycler (Bio-Rad Laboratories, Inc.). The PCR cycles were as follows: 35-40 cycles of 1 min at 94˚C (denaturation), 30 sec at 55-58˚C (annealing) and a 1 min 72˚C (extension), using Taq polymerase. The sequences of the primers are displayed in Table I. PCR products were electrophoresed on a SYBR® Green stained agarose gel; the band density was evaluated using ImageJ software and mRNA expression was normalized to that of β-actin.

Table I

Primer sequences used for reverse transcription PCR.

Table I

Primer sequences used for reverse transcription PCR.

Gene nameSequence (5'-3')Accession no.Annealing temperature, ˚CCyclesBase pairs
Nos2 (iNOS)F: CACCTTGGAGTTCACCCAGTNM_010927.45830170
 R: ACCACTCGTACTTGGGATGCNM_001313921.1   
  NM_001313922.1   
Ptgs2 (COX-2)F: AGAAGGAAATGGCTGCAGAANM_011198.45535194
 R: GCTCGGCTTCCAGTATTGAG    
Il6 (IL-6)F: AGTTGCCTTCTTGGGACTGANM_001314054.15830223
 R: TTCTGCAAGTGCATCATCGT    
Tnf (TNF-α)F: GCAGAAGAGGCACTCCCCCANM_001278601.15830280
 R: GATCCATGCCGTTGGCCAGG    
Il1b (IL-1β)F: GGCTGTGGAGAAGCTGTGGCNM_008361.45530386
 R: GGGTGGGTGTGCCGTCTTTC    
Hmox1 (HO-1)F: GAGAATGCTGAGTTCATNM_010442.25825548
 R: ATGTTGAGCAGGAAGGC    
Actb (β-actin)F: TTCTACAATGAGCTGCGTGTNM_0073935830456
 R: CTCATAGCTCTTCTCCAGGG    

[i] iNOS, inducible nitric oxide synthase; COX-2, cyclooxygenase-2; HO-1, heme oxygenase 1; F, forward; R, reverse.

ABTS radical scavenging activity

To investigate the effects of EAFM on ABTS radical scavenging activity, RAW 264.7 cells (2x106 cells/well) were seeded into 6-well culture plates and incubated with or without FTM (12.5, 25 and 50 µg/ml) for 24 h. The experiment was carried out according to the manufacturer's protocol. The ABTS latical scavenging ability was analyzed compared to RAW 264.7 cells without treatment.

Statistical analysis

All experiments were independently conducted at least three times. All data are expressed as the mean ± standard error of the mean (SEM) and were analyzed using GraphPad prism software (version 5.01; GraphPad Software, Inc.). The significance of the experimental results was analyzed using one-way ANOVA test, followed by Tukeys's multiple comparison post hoc analysis.

Results

Qualitative analysis of FTM

Peimine and peiminine are bioactive marker compounds of FTM (11,12). As shown in Fig. 1A and B, FTM Mt-OH extract revealed a number of chromatogram peaks for 0-30 min, and peimine and peiminie were identified at the same time points as for the standard; 19.607 and 26.316 min, respectively. As a result of examining the chromatogram peak of EAFM, peimine was detected at 19.353 min, but peiminine was not. (Fig. 1C).

Figure 1

Quantitative analysis results of FTM and EAFM using HPLC. Chromatogram peak of (A) peimine, peiminine, (B) FTM and (C) EAFM. Standard peaks for peimine and peiminine were detected at 220 nm. FTM, Fritillaria thunbergii Miquel; EAFM, ethyl acetate fraction of Fritillaria thunbergii Miquel; AU, arbitrary units.

EAFM significantly inhibits NO production

Prior to experimentation, the cytotoxicity of FTM was verified using a CCK-8 kit. FTM extract and all fractions showed no significant cytotoxicity at concentrations of 12.5, 25 and 50 µg/ml (Fig. 2A). As a result, concerns regarding FTM cytotoxicity were eliminated. The inhibitory effects of the FTM extract and fractions on NO expression were then assessed using Griess reagent and ELISA. EAFM was found to inhibit the generation of NO in a concentration-dependent manner (Fig. 2B); none of the other extracts and fractions had a significant effect on NO expression. Furthermore, none of the extracts and fractions (including those of FTM) significantly altered the expression of PGE2 (Fig. 2C).

Figure 2

Effects of FTM extract and fractions on cytotoxicity and NO expression. (A) RAW 264.7 cells were treated with FTM extract at different fractions for 24 h, and the effects on cell survival were verified using a Cell Counting Kit-8 assay. (B) Inhibitory effects of FTM on NO expression following LPS treatment were verified using Griess reagent. (C) Inhibitory effects of FTM on prostaglandin E2 were assessed using an ELISA kit. All experiments were repeated at least three times. ##P<0.01 vs. the non-treated group. **P<0.01 vs. the LPS-treated control. FTM, Fritillaria thunbergii Miquel; LPS, lipopolysaccharides; NO, nitric oxide; PGE2, prostaglandin E2.

EAFM inhibits the expression of iNOS and inflammatory cytokines

To investigate the anti-inflammatory effects of EAFM, iNOS and COX-2 expression were verified at the mRNA and protein levels. LPS stimulation of RAW 264.7 cells induced the expression of iNOS and COX-2. EAFM suppressed iNOS expression in a concentration-dependent manner, but increased the expression of COX-2 (Fig. 3A and B). IL-6, TNF-α and IL-1β are representative pro-inflammatory cytokines expressed in macrophages. To confirm the inflammatory potential of EAFM, the protein levels of these cytokines in the RAW 264.7 cell culture medium, as well as the mRNA expression levels, were investigated. As shown in Fig. 3C-E, LPS stimulation upregulated the expression of IL-6, TNF-α and IL-1β in RAW 264.7 cells. IL-6 and TNF-α mRNA expression was subsequently suppressed by EAFM in a concentration-dependent manner (Fig. 3C and D). However, EAFM did not significantly affect the mRNA expression levels of IL-1β. Furthermore, LPS induced the expression of pro-inflammatory cytokines in the culture medium of RAW 264.7 cells, of which IL-6 and TNF-α, but not IL-1β, were significantly inhibited by EAFM administration (Fig. 3E).

Figure 3

Effects of EAFM on iNOS, COX-2 and pro-inflammatory cytokine expression. (A) Effects of EAFM on the expression of LPS-induced iNOS and COX in RAW 264.7 cells were verified at the mRNA and protein levels by RT-PCR and western blotting. (B) Expression of iNOS and COX-2 was normalized to that of β-actin (Actb). (C) Effect of EAFM on the mRNA expression of pro-inflammatory cytokines in RAW 264.7 cells, demonstrated using RT-PCR. (D) mRNA expression was normalized to that of β-actin. (E) Expression of pro-inflammatory cytokines in RAW 264.7. Cell culture medium was assessed by ELISA. All experiments were repeated at least three times. #P<0.05 and ##P<0.01 vs. the non-treated group, *P<0.05 and **P<0.01 vs. the LPS-treated control. EAFM, ethyl acetate fraction of Fritillaria thunbergii Miquel; iNOS, inducible nitric oxide synthase; COX-2, cyclooxygenase 2; RT, reverse transcription; LPS, lipopolysaccharide.

EAFM inhibits the phosphorylation of ERK and JNK, and inhibits the nuclear translocation of NF-κB

To investigate the anti-inflammatory signaling mechanisms of EAFM, the expression of MAPKs (ERK, JNK and p38) and NF-κB was investigated by western blotting. LPS stimulation induced the phosphorylation of ERK, JNK and p38; furthermore, treatment with EAFM significantly inhibited ERK and JNK phosphorylation at a concentration of 50 µg/ml (Fig. 4A and B). LPS stimulation initiates various inflammatory responses by promoting the nuclear translocation of NF-κB. In the present study, LPS induced the expression and phosphorylation of NF-κB in nuclear proteins. Furthermore, EAFM was confirmed to markedly inhibit the expression and phosphorylation of NF-κB at a concentration of 50 µg/ml (Fig. 4C and D).

Figure 4

Effects of EAFM on MAPK phosphorylation and NF-κB translocation. (A) Effect of EAFM on MAPK in RAW 264.7 cells was demonstrated by western blotting. (B) Phosphorylated ERK, JNK and p38 were quantified in each total form. (C) Effects of EAFM on NF-κB expression and phosphorylation in the nucleus. (D) Expression levels of NF-κB and p-NF-κB were quantified using lamin B as an internal reference and the expression of p-NF-κB was quantified as NF-κB. All experiments were repeated at least three times. #P<0.05 and ##P<0.01 vs. the non-treated group. *P<0.05 vs. LPS-treated control. EAFM, ethyl acetate fraction of Fritillaria thunbergii Miquel; LPS, lipopolysaccharides; W.B, western blot; p, phosphorylated.

EAFM exerts antioxidant effects by activating ABTS radical scavenging and inducing Nrf2 and HO-1 expression

Next, The ABTS radical scavenging ability of EAFM was confirmed. As shown in Fig. 5A, EAFM increased the ABTS radical scavenging ability in a concentration-dependent manner. In particular, the EAFM of 100 µg/ml was significantly increased compared to the non-treated cells. the mRNA expression levels of HO-1 were determined to confirm that the anti-inflammatory properties of EAFM resulted from an antioxidant effect. As shown in Fig. 5B and C, EAFM induces HO-1 expression at the mRNA level. The effect of EAFM on the expression of Nrf2 (a transcription factor of HO-1) was verified by western blotting. EAFM was also found to increase the expression of Nrf2 and HO-1 at the protein level. These results indicate that EAFM prevents oxidative damage by promoting HO-1 expression in macrophages.

Figure 5

Effects of EAFM on anti-oxidative mechanisms in RAW 264.7 cells. (A) ABTS radical scavenging activity of EAFM. (B) Effects of EAFM on heme oxygenase 1 and nuclear factor erythroid 2-related factor 2 were demonstrated by revers transcription PCR and western blotting. (C) mRNA and protein expression was quantified using β-actin and Lamin B as the internal reference. All experiments were repeated at least three times. *P<0.05 and **P<0.01 vs. the non-treated group. EAFM, ethyl acetate fraction of Fritillaria thunbergii Miquel; ABTS, 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid); HO-1, heme oxygenase 1; Nrf2, nuclear factor erythroid 2-related factor 2; W.B, western blot; Actb, β-actin.

Discussion

The aim of the present study was to reveal the mechanisms by which EAFM regulates inflammation and oxidation. The RAW 264.7 murine macrophage cell line is commonly used to verify the anti-inflammatory effects of drugs, and to evaluate the associated signaling pathways. Inflammatory mechanisms are complex processes regulated by cytokine interactions and the induction of various pro-inflammatory genes (13). Macrophages are distributed throughout the human body and serve an important role in these inflammatory process. Macrophages provide immediate defense against pathogens prior to leukocyte migration, and LPS stimulation induces the secretion of macrophage inflammatory mediators such as interleukins, TNF-α, iNOS and COX-2(3). The pharmacological reduction of LPS-induced inflammatory mediators is considered to effectively alleviate various symptoms, including macrophage-associated inflammatory reactions. Therefore, an LPS-induced RAW 264.7 cell inflammation model was used in the present study.

NO is a well-known modulator of the inflammatory response, and is important for the defense against infectious organisms. However, it can also detrimentally effect host tissues. NO reacts with molecular oxygen to generate reactive nitrogen species, which can result in various modifications to cellular function (14). As a result, NO is considered to be an important factor of the inflammatory response. The expression of NO is regulated by iNOS, which is not expressed under normal conditions, but generated following the release of inflammatory cytokines such as TNF-α and IL-1β. In the present study, EAFM suppressed the expression of NO as well as iNOS mRNA and protein (15,16). This indicates that the NO-suppressive effect of EAFM is the result of iNOS regulation.

PGE2 is produced in macrophages and is involved in vasodilation, pain and fever in the early stages of the inflammatory response and COX-2 plays a major role in the expression of PGE2 (17). In previous studies, COX-2 inhibitors ablated PGE2 synthesis, and consequently suppressed inflammation. In addition, LPS-induced hepatotoxicity was alleviated in COX-2 gene-positive mice. Therefore, PGE2 and COX-2 have been used as anti-inflammatory indicators in numerous studies. However, in the present study, in contrast to the NO and iNOS results, EAFM had no effect on the expression of PGE2 and increased COX-2 expression. The reason for the existence of the difference in expression between COX-2 and PGE2 is assumed to be as follows. PGE2 metabolism is first catalyzed by hydroxyprostaglandin dehydrogenase (15-PGDH) (18). Previous studies have shown that limited degradation of PGE2 through decreased expression of 15-PGDH can lead to tumor growth (19), whereas elevation of 15-PGDH in lung cancer cells inhibited the expression of PGE2 (20). Probably, EAFM seems to control the expression of PGE2 through upregulation of 15-PGDH without affecting COX-2. However, additional research will have to be conducted to test this hypothesis.

In addition, the reason why EAFM suppresses iNOS, but not COX-2 expression is presumed to be as follows: The intracellular expression pathways of iNOS and COX-2 are complex, and the expression of these indicators depends on the degree of promoter dependence between them. The iNOS promoter contains cis-acting elements such as NF-κB, activator protein 1 (AP-1), CCAAT/enhancer-binding protein beta (C/EBPβ) and signal transducer and activator of transcription (Stat), whereas the COX-2 promoter includes cis-acting components such as NF-κB, C/EBPβ and cis-acting replication elements (CRE) elements (21,22). The activities of different promoters vary depending on the cell type and stimulant. In the present study, the COX-2 promoter was confirmed to be less dependent on NF-κB than the iNOS promoter. As the results of pro-inflammatory cytokine expression indicate, EAFM inhibited IL-6 and TNF-α by suppressing NF-κB. These results suggest that EAFM may not inhibit COX-2 expression by complementing other promoters of COX-2, highlighting the need for further investigation.

Cytokines are small secretory proteins that facilitate intercellular communication. Pro-inflammatory cytokines are produced by activated macrophages, and representative cytokines such as IL-6, TNF-α and IL-1β, are involved in both acute and chronic inflammatory signaling (13,23). IL-6 is rapidly produced in response to infection and tissue damage. In previous studies, IL-6-knockout animals displayed reduced susceptibility to disease symptoms in a variety of conditions, including Castleman's disease, rheumatoid arthritis and inflammatory myopathies (24). TNF-α is considered to be a master regulator of inflammatory cytokine expression and the abnormal production of TNF-α is associated with the development of various diseases, including rheumatoid arthritis, Crohn's disease and atherosclerosis. Therefore, TNF-α is a proposed target for the treatment of numerous inflammatory diseases (25). IL-1β is induced at the site of inflammation and generally promotes the expression of PGE2 and COX-2(26). IL-1β injection induces fever, headache, muscle and joint pain in humans by initiating inflammatory reactions (27). In the present study, EAFM significantly inhibited the expression of IL-6 and TNF-α, indicating its ability to regulate acute LPS-induced inflammatory responses. However, EAFM did not significantly affect IL-1β expression, which supports previous results suggesting that EAFM does not inhibit the subsequent expression of COX-2 and PGE2.

The NF-κB pathway is one of the primary mechanisms by which macrophages express pro-inflammatory factors (28). In its inactive state, NF-κB is bound to inhibitor of NF-κB subunit α (IκB) in the cytoplasm; following stimulation, IκB is degraded and NF-κB translocates to the nucleus to initiate various inflammatory responses. MAPKs serve regulatory roles in cellular proliferation and differentiation, and the regulation of cellular responses to cytokines and stress. There are three MAPK signaling pathways that involve ERK, JNK or p38, which transmit information from the extracellular environment to the nucleus. In addition, published studies indicate that MAPKs are involved in the regulation of COX-2 and iNOS expression (29). In the present study, EAFM inhibited both the nuclear transfer and phosphorylation of NF-κB, as well as ERK and JNK phosphorylation. This indicates that the potential for EAFM to inhibit NO and inflammatory cytokine production is mediated by NF-κB, ERK and JNK. However, although EAFM inhibits the nuclear potential and phosphorylation of NF-κB, there is a limitation that it is not clear why it does not affect IL-1β.

There are several ways to measure the antioxidant effect, and the results are slightly different. ABTS is a relatively stable free radical and is widely used for measuring antioxidant activity along with DPPH. This method can measure both lipophilic or hypophilic substances (30). In this study, EAFM improved the ABTS radical scavenging ability. These findings mean that EAFM improves the ability to remove free radicals, which means that it has antioxidant effects. The Nrf2/HO-1 axis is a major defense mechanism against oxidative stress, where HO-1 expression converts heme to biliverdin/bilirubin, carbon monoxide (CO) and free iron (6). The generation of biliverdin/bilirubin has a strong antioxidant effect, and CO also has anti-inflammatory properties. In activated macrophages, HO-1 induction reduces the production of IL-6, TNF-α and IL-1β and HO-1 overexpression decreases the expression of iNOS, which is produced following COX-2 initiation. NO and PGE2 production is also suppressed. HO-1 is dependently regulated by Nrf2; following nuclear translocation, Nrf2 binds to an antioxidant response element, regulating antioxidant mechanisms and serving an important role in the defense against oxidative stress. In the present study, EAFM notably increased the expression of both Nrf2 and HO-1. These results indicate that the antioxidant effect of EAFM, at least in part, influences preceding anti-inflammatory mechanisms.

In conclusion, the results if the present study confirm that EAFM suppresses the expression of NO and pro-inflammatory cytokines by inhibiting MAPK/NF-κB signaling pathways. Additionally, EAFM also exerts its antioxidant effects by inducing HO-1 expression. The results of these experiments highlight the potential of EAFM as a future treatment for inflammatory diseases. The following limitations exist in this study. i) Peimine and peiminine, known as the main components of FTM, have been demonstrated in previous studies to have anti-inflammatory effects (9,31). However, referring to the results of the HPLC experiment, it was confirmed that peiminie was not present in the constituents of EAFM, and a very small amount of peimine was included. Therefore, further studies are needed to determine which chemicals of EAFM exhibit anti-inflammatory effects. ii) In this study, the expression of COX-2 increased with EAFM treatment. Referring to the anti-inflammatory effect of Xanthii fructus before (32), it showed anti-inflammatory effect similar to the result of this study, but the expression of COX-2 increased as the drug was treated. It can be inferred that there is some similarity between EAFM and Xanthii fructus, and it is suggested that further research is needed in the future.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors' contributions

YS conceptualized the study. JHK, MK and EYK performed the experiments. SH, BK and HSJ statistically analyzed the data. HSJ, KS and MWS interpreted the results. JHK drafted the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Chen L, Deng H, Cui H, Fang J, Zuo Z, Deng J, Li Y, Wang X and Zhao L: Inflammatory responses and inflammation-associated diseases in organs. Oncotarget. 9:7204–7218. 2017.PubMed/NCBI View Article : Google Scholar

2 

Okin D and Medzhitov R: Evolution of inflammatory diseases. Curr Biol. 22:R733–R740. 2012.PubMed/NCBI View Article : Google Scholar

3 

Alexander C and Rietschel ET: Bacterial lipopolysaccharides and innate immunity. J Endotoxin Res. 7:167–202. 2001.PubMed/NCBI

4 

Küper C, Beck FX and Neuhofer W: Toll-like receptor 4 activates NF-κB and MAP kinase pathways to regulate expression of proinflammatory COX-2 in renal medullary collecting duct cells. Am J Physiol Renal Physiol. 302:F38–F46. 2012.PubMed/NCBI View Article : Google Scholar

5 

Aderem A and Ulevitch RJ: Toll-like receptors in the induction of the innate immune response. Nature. 406:782–787. 2000.PubMed/NCBI View Article : Google Scholar

6 

Loboda A, Damulewicz M, Pyza E, Jozkowicz A and Dulak J: Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: An evolutionarily conserved mechanism. Cell Mol Life Sci. 73:3221–3247. 2016.PubMed/NCBI View Article : Google Scholar

7 

Herbology Editorial Committee of Korean Medicine: Herbology. Younglimsa, Seoul, 2004 (In Korean).

8 

Cho IH, Lee MJ, Kim JH, Han NY, Shin KW, Sohn Y and Jung HS: Fritillaria ussuriensis extract inhibits the production of inflammatory cytokine and MAPKs in mast cells. Biosci Biotechnol Biochem. 75:1440–1445. 2011.PubMed/NCBI View Article : Google Scholar

9 

Lim JM, Lee B, Min JH, Kim EY, Kim JH, Hong S, Kim JJ, Sohn Y and Jung HS: Effect of peiminine on DNCB-induced atopic dermatitis by inhibiting inflammatory cytokine expression in vivo and in vitro. Int Immunopharmacol. 56:135–142. 2018.PubMed/NCBI View Article : Google Scholar

10 

Park JH, Lee B, Kim HK, Kim EY, Kim JH, Min JH, Kim S, Sohn Y and Jung HS: Peimine inhibits the production of proinflammatory cytokines through regulation of the phosphorylation of NF-κB and MAPKs in HMC-1 cells. Pharmacogn Mag. 13 (Suppl 2):S359–S364. 2017.PubMed/NCBI View Article : Google Scholar

11 

He J, He Y and Zhang AC: Determination and visualization of peimine and peiminine content in Fritillaria thunbergii bulbi treated by sulfur fumigation using hyperspectral imaging with chemometrics. Molecules. 22(1402)2017.PubMed/NCBI View Article : Google Scholar

12 

Wu X, Chan SW, Ma J, Li P, Shaw PC and Lin G: Investigation of association of chemical profiles with the tracheobronchial relaxant activity of Chinese medicinal herb beimu derived from various fritillaria species. J Ethnopharmacol. 210:39–46. 2018.PubMed/NCBI View Article : Google Scholar

13 

Zhang JM and An J: Cytokines, inflammation, and pain. Int Anesthesiol Clin. 45:27–37. 2007.PubMed/NCBI View Article : Google Scholar

14 

Xue Q, Yan Y, Zhang R and Xiong H: Regulation of iNOS on immune cells and its role in diseases. Int J Mol Sci. 19(3805)2018.PubMed/NCBI View Article : Google Scholar

15 

Coleman JW: Nitric oxide in immunity and inflammation. Int Immunopharmacol. 1:1397–1406. 2001.PubMed/NCBI View Article : Google Scholar

16 

Korhonen R, Lahti A, Kankaanranta H and Moilanen E: Nitric oxide production and signaling in inflammation. Curr Drug Targets Inflamm Allergy. 4:471–479. 2005.PubMed/NCBI View Article : Google Scholar

17 

Ricciotti E and FitzGerald GA: Prostaglandins and inflammation. Arterioscler Thromb Vasc Biol. 31:986–1000. 2011.PubMed/NCBI View Article : Google Scholar

18 

Cho H and Tai HH: Inhibition of NAD+-dependent 15-hydroxyprostaglandin dehydrogenase (15-PGDH) by cyclooxygenase inhibitors and chemopreventive agents. Prostaglandins Leukot Essent Fatty Acids. 67:461–465. 2002.PubMed/NCBI View Article : Google Scholar

19 

Ding Y, Tong M, Liu S, Moscow JA and Tai HH: NAD+-linked 15-hydroxyprostaglandin dehydrogenase (15-PGDH) behaves as a tumor suppressor in lung cancer. Carcinogenesis. 26:65–72. 2005.PubMed/NCBI View Article : Google Scholar

20 

Hazra S, Batra RK, Tai HH, Sharma S, Cui X and Dubinett SM: Pioglitazone and rosiglitazone decrease prostaglandin E2 in non-small-cell lung cancer cells by up-regulating 15-hydroxyprostaglandin dehydrogenase. Mol Pharmacol. 71:1715–1720. 2007.PubMed/NCBI View Article : Google Scholar

21 

Kang YJ, Wingerd BA, Arakawa T and Smith WL: Cyclooxygenase-2 gene transcription in a macrophage model of inflammation. J Immunol. 177:8111–8122. 2006.PubMed/NCBI View Article : Google Scholar

22 

Lee AK, Sung SH, Kim YC and Kim SG: Inhibition of lipopolysaccharide-inducible nitric oxide synthase, TNF-alpha and COX-2 expression by sauchinone effects on I-kappaBalpha phosphorylatio, C/EBP and AP-1 activation. Br J Pharmacol. 139:11–20. 2003.PubMed/NCBI View Article : Google Scholar

23 

Feghali CA and Wright TM: Cytokines in acute and chronic inflammation. Front Biosci. 2:d12–d26. 1997.PubMed/NCBI View Article : Google Scholar

24 

Tanaka T, Narazaki M and Kishimoto T: IL-6 in inflammation, immunity, and disease. Cold Spring Harb Perspect Biol. 6(a016295)2014.PubMed/NCBI View Article : Google Scholar

25 

Parameswaran N and Patial S: Tumor necrosis factor-alpha signaling in macrophages. Crit Rev Eukaryot Gene Expr. 20:87–103. 2010.PubMed/NCBI View Article : Google Scholar

26 

Dinarello CA: Proinflammatory cytokines. Chest. 118:503–508. 2000.PubMed/NCBI View Article : Google Scholar

27 

Janik JE, Miller LL, Longo DL, Powers GC, Urba WJ, Kopp WC, Gause BL, Curti BD, Fenton RG, Oppenheim JJ, et al: Phase II trial of interleukin 1 alpha and indomethacin in treatment of metastatic melanoma. J Natl Cancer Inst. 88:44–49. 1996.PubMed/NCBI View Article : Google Scholar

28 

Lawrence T: The nuclear factor NF-kappaB pathway in inflammation. Cold Spring Harb Perspect Biol. 1(a001651)2009.PubMed/NCBI View Article : Google Scholar

29 

Kim EK and Choi EJ: Pathological roles of MAPK signaling pathways in human diseases. Biochim Biophys Acta. 1802:396–405. 2010.PubMed/NCBI View Article : Google Scholar

30 

More GK and Makola RT: In-vitro analysis of free radical scavenging activities and suppression of LPS-induced ROS production in macrophage cells by Solanum sisymbriifolium extracts. Sci Rep. 10(6493)2020.PubMed/NCBI View Article : Google Scholar

31 

Yi PF, Wu YC, Dong HB, Guo Y, Wei Q, Zhang C, Song Z, Qin QQ, Lv S, Wu SC and Fu BD: Peimine impairs pro-inflammatory cytokine secretion through the inhibition of the activation of NF-κB and MAPK in LPS-induced RAW264.7 macrophages. Immunopharmacol Immunotoxicol. 35:567–572. 2013.PubMed/NCBI View Article : Google Scholar

32 

Yeom M, Kim JH, Min JH, Hwang MK, Jung HS and Sohn Y: Xanthii fructus inhibits inflammatory responses in LPS-stimulated RAW 264.7 macrophages through suppressing NF-κB and JNK/p38 MAPK. J Ethnopharmacol. 176:394–401. 2015.PubMed/NCBI View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Kim J, Kim M, Hong S, Kwon B, Song M, Song K, Kim E, Jung H and Sohn Y: Anti‑inflammatory effects of <em>Fritillaria thunbergii</em> Miquel extracts in LPS‑stimulated murine macrophage RAW 264.7 cells. Exp Ther Med 21: 429, 2021.
APA
Kim, J., Kim, M., Hong, S., Kwon, B., Song, M., Song, K. ... Sohn, Y. (2021). Anti‑inflammatory effects of <em>Fritillaria thunbergii</em> Miquel extracts in LPS‑stimulated murine macrophage RAW 264.7 cells. Experimental and Therapeutic Medicine, 21, 429. https://doi.org/10.3892/etm.2021.9846
MLA
Kim, J., Kim, M., Hong, S., Kwon, B., Song, M., Song, K., Kim, E., Jung, H., Sohn, Y."Anti‑inflammatory effects of <em>Fritillaria thunbergii</em> Miquel extracts in LPS‑stimulated murine macrophage RAW 264.7 cells". Experimental and Therapeutic Medicine 21.5 (2021): 429.
Chicago
Kim, J., Kim, M., Hong, S., Kwon, B., Song, M., Song, K., Kim, E., Jung, H., Sohn, Y."Anti‑inflammatory effects of <em>Fritillaria thunbergii</em> Miquel extracts in LPS‑stimulated murine macrophage RAW 264.7 cells". Experimental and Therapeutic Medicine 21, no. 5 (2021): 429. https://doi.org/10.3892/etm.2021.9846
Copy and paste a formatted citation
x
Spandidos Publications style
Kim J, Kim M, Hong S, Kwon B, Song M, Song K, Kim E, Jung H and Sohn Y: Anti‑inflammatory effects of <em>Fritillaria thunbergii</em> Miquel extracts in LPS‑stimulated murine macrophage RAW 264.7 cells. Exp Ther Med 21: 429, 2021.
APA
Kim, J., Kim, M., Hong, S., Kwon, B., Song, M., Song, K. ... Sohn, Y. (2021). Anti‑inflammatory effects of <em>Fritillaria thunbergii</em> Miquel extracts in LPS‑stimulated murine macrophage RAW 264.7 cells. Experimental and Therapeutic Medicine, 21, 429. https://doi.org/10.3892/etm.2021.9846
MLA
Kim, J., Kim, M., Hong, S., Kwon, B., Song, M., Song, K., Kim, E., Jung, H., Sohn, Y."Anti‑inflammatory effects of <em>Fritillaria thunbergii</em> Miquel extracts in LPS‑stimulated murine macrophage RAW 264.7 cells". Experimental and Therapeutic Medicine 21.5 (2021): 429.
Chicago
Kim, J., Kim, M., Hong, S., Kwon, B., Song, M., Song, K., Kim, E., Jung, H., Sohn, Y."Anti‑inflammatory effects of <em>Fritillaria thunbergii</em> Miquel extracts in LPS‑stimulated murine macrophage RAW 264.7 cells". Experimental and Therapeutic Medicine 21, no. 5 (2021): 429. https://doi.org/10.3892/etm.2021.9846
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team