Evaluation of the genetic variability of human papillomavirus type 52

  • Authors:
    • Qiang Chen
    • Zhao-Yun Luo
    • Min Lin
    • Lin Yang
    • Li-Ye Yang
    • Gui-Zhi Ju
  • View Affiliations

  • Published online on: June 6, 2012     https://doi.org/10.3892/ijmm.2012.1017
  • Pages: 535-544
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Human papillomavirus (HPV) type 52 is one of the high-risk HPV types. Its variants can be classified as of Asian and European lineages, while little data of HPV 52 variants are available from China. In this study, the complete E6 and L1 genes were amplified and sequenced in 79 samples from eastern Guangdong, China. In total, 21 variants were identified, 18 of which could be divided into Asian lineage and the other three were phylogenetically related to European lineage. No significant difference was found between the pathogenicity of these two lineage variants. Two HPV-52 lineages variants could be classified by high resolution melting (HRM) analysis. Thus, we believe that the application of HRM analysis would be useful for facilitating pathogenic comparisons between different HPV variants. In addition, we found that 6 females were infected with two types of HPV-52 variants. To our knowledge, this is the first time that this rare phenomenon is reported worldwide.

Introduction

Cervical cancer is the second most common gynecologic malignancy in Chinese women (1). Persistent infection of specific types of genital human papillomaviruses (HPVs), especially the oncogenic or high-risk (HR) types, has been generally recognized as the principle cause of this disease and its precursor, cervical intraepithelial neoplasia (CIN). HPV-52 is one of 13 anogenital tract infected HR-HPV types (2). According to a meta-analysis in 2003 (3), it is the seventh most common detected HR-HPV type in invasive cervical cancer (ICC) worldwide. However, in South-East Asia, HPV-52 is one of most common prevalent HR-HPV types, and a large proportion of cervical cancers is associated with HPV-52, which is the second or third most common HPV type in ICC (4,5).

Each HPV type comprises numerous genomic variants, and an up to 2% nucleotide difference has often been identified. This difference confers each variant a biologically distinct characterization and pathogenic risks (6). HPV-52 is phylogenetically related to HPV-16 (7), whose variants could be divided into Asian-American, African and European lineages, whose carcinogenic risks have been extensively studied (8,9). Similarly, the variants of HPV-52 could be classified as Asian and European lineages (10), with a mean sequence difference of 1.8–2.0% (11). However, limited data of HPV-52 variants is available from the mainland of China (12).

The genomic characterization of HPV variants is necessary for understanding the intrinsic geographical relations and contribute to research of their pathogenicity. Traditional studies on the variability of HPV types are very laborious and costly. First, all target genes need to be sequenced following a set of polymerase chain reaction (PCR), and then the resulting sequences need to be compared with the reference sequence to identify mismatches. The high resolution melting (HRM) analysis provided scientists a new approach to detect and classify HPV variant in recent years. This kind of method combines DNA amplification by PCR and subsequent melting of the amplicons into one reaction. After data normalization, the sequence variation could be identified by the shape of melting curves (13). This new approach has been successfully used to study the variability of HPV type 16 (14).

Based on an epidemiologic screening for HPV infections in Chaozhou, eastern Guangdong province from 2009–2010, HPV-52 was found to be the most common HR-HPV type in this area. More than one third (971/2907) of HR-HPV infectors were singly or multiply infected with HPV-52. The present study explored the nucleotide variability and phylogeny of HPV-52, in samples from the HPV infections screening mentioned above. For this purpose, the E6 and L1 genes were firstly sequenced by the traditional method, then the HRM analysis was used to group identified variants. The pathogenicity of the most common variants was compared. Unexpectedly, several abnormal peaks (double peaks) were found in direct sequencing results. We speculated these specimens may contain two or more different HPV-52 variants, and the restriction enzyme analysis was performed to validate this hypothesis.

Materials and methods

Sample collection

From December 2009 to September 2010, an epidemiologic screening for HPV infections was organized by the Chaozhou municipal government, and more than 48,000 females participated in this screening. Multiplex real-time PCR was firstly performed to detect 13 types of HR-HPV infection. Then, the HPV GenoArray test (15,16) was used to identify the specific HPV types with the same samples. HPV DNA positive women were advised to receive ThinPrep liquid-based cytology test (LCT), and histological diagnosis was performed if necessary. In this study, a woman was eligible to participate in the study if she i) participated in the HPV infection screening described above; ii) was singly infected with HPV-52; iii) received LCT and/or histological diagnosis; and iv) was willing to be a subject in the present study. The study was carried out with the approval of the Ethics Committee of Chaozhou Central Hospital, Chaozhou, China, and patient consent was obtained for the collection of cervical exfoliated cells.

In accordance with the suggestion of gynaecological practitioners, 186 HPV-52 infectors received LCT. Among them, 102 women were excluded since they were infected with multiple HPV types or did not agree to participate in the study. In total, 84 eligible cases of single HPV-52 infection were enrolled into the study.

DNA extraction and amplification

The cervical exfoliated cells were collected using plastic cervical swabs, and then immediately stored at 4°C. The DNA was extracted by the alkaline lysis method using DNA extraction kits (Hybribio Biotechnology Corp.). Detailed protocols for this assay have been described previously (15). The quality of extracted DNA was checked by PCR amplification of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene (forward, 5′-CAT GAC CAC AGT CCA TGC CAT CAC T-3′ and reverse primer, 5′-TGA GGT CCA CCA CCC TGT TGC TGT A-3′).

For complete E6 and L1 gene amplification, two and three sets of primers (Table I) were designed respectively based on the sequence of the prototype TJ49-52 (GenBank ID: GQ472848). The complete 1.8 kb genomes of the L1 gene were amplified in three or four overlapping fragments according to the primers used. The amplification protocol was as follows: initial denaturation for 5 min at 93°C, followed by 35–40 cycles of denaturation for 1 min at 93°C, annealing for 1 min at the appropriate temperature (Table I) and elongation for 10 min at 72°C. The amplified DNA fragments were identified by electrophoresis on 2% agarose gels stained with ethidium bromide, and submitted for sequencing of both strands at the Invitrogen Biotechnology Co., Ltd., Guangzhou, China.

Table I.

Primers for E6 and L1 genes amplification.

Table I.

Primers for E6 and L1 genes amplification.

GeneTargetPrimer nameSenseAntisenseAnnealing temperature (°C)
E6102–54852E6Set192–113686–71361
52E6Set226–48550–57457
L15593–718252L1Set1-A5517–55376024–604257
52L1Set1-B5590–60076515–653657
52L1Set1-C6513–65337091–710857
52L1Set1-D6867–68877290–731158
52L1Set2-A5517–55376024–604257
52L1Set2-B5590–60076515–653657
52L1Set2-C6513–65337091–710857
52L1Set2-D6865–68877416–743859
52L1Set3-A5517–55376024–604257
52L1Set3-B5953–59726645–666458
52L1Set3-C6572–65917205–722560

[i] The prototype of HPV-52 isolate TJ49-52 (GenBank ID: GQ472848) was used as the standard for nucleotide position numbering.

Sequence analysis and phylogenetic evaluations

The mismatches were analyzed and determined using the Blast 2.0 software server (http://www.ncbi.nlm.nih.gov/blast). The HPV-52 prototype TJ49-52 was used as standard for comparison. Each unique sequence variation was verified by repeated amplification and opposite strand sequencing. The resulting sequences were aligned with ClustalX software, the neighbor-joining and unweighted pair group method with arithmetic average (UPGMA) trees were constructed by using the MEGA software version 5 (17,18).

Restriction enzyme analysis

Abnormal peaks (double peaks) were found in seven sequence traces, and their corresponding PCR products were named Ab1 to Ab7, respectively. In order to eliminate samples cross-contamination, the DNA of these specimens was re-extracted, amplified and sequenced again.

For this rare phenomenon, we speculated that the PCR products contained two kinds of amplicons. In order to validate this hypothesis, restriction enzymes TaqI, XbaI, BspEI, RsaI, MspI and MlyI (all purchased from Fermentas) were selected according to the neighboring sequence of abnormal peaks. The selection criteria were i) either one hypothetical amplicon or another was cleavable; and ii) there was only one recognition site of restriction enzyme on the selected amplicon. The PCR products were digested with specific enzymes according to the recommended protocols for digestion of PCR products directly after amplification. The 50 μl digestion mixture included 15 μl PCR reaction mixture, 29 μl nuclease-free water, 3 μl 10X buffer and 3 μl (10 U/μl) restriction enzyme. The detailed protocols for digestion are listed in Table II. The resulting fragments were run on 2% agarose gels stained with ethidium bromide, and the uncleavaged fragments were purified and submitted for sequencing.

Table II.

Details for restriction enzyme analysis.

Table II.

Details for restriction enzyme analysis.

PCR productPrimersAmplicon lengthRestriction enzymeRecognition siteDigestionInactivationFragment length
Ab152E6Set2549RsaI5′-GT↓AC-3′37°C for 24 h80°C for 20 min198, 351
Ab2-5a52L1Set1-A526TaqI5′-T↓CGA-3′65°C for 3 hEDTA solutionb252, 274
XbaI5′-T↓CTAGA-3′37°C for 24 h65°C for 20 min254, 272
Ab652L1Set1-A526BspEI5′-T↓CCGGA-3′55°C for 3 h80°C for 20 min108, 418
Ab752L1Set3-B712MspI5′-C↓CGG-3′37°C for 24 h80°C for 20 min518, 194
MlyI 3′-CTCAG(n)5↓-5′37°C for 8 h65°C for 20 min532, 180

a For amplicons Ab2 to Ab5, the restriction enzymes used for digestion are identical, since the same double peaks are identified at the same site in their sequence traces.

b Adding 0.5 M EDTA, pH 8.0, to achieve a 20 mM final concentration. Arrows (↓) indicate the cleavage site.

HRM analysis

All of the specimens which could be successfully amplified with PCR, were subjected to HRM analysis. The primers (forward, 5′-TGT ATT ATG TGC CTA CGC TTT T-3′ and reverse, 5′-GGC GTT TGA CAA ATT ATA CAT C-3′) used for HRM analysis were designed based on the mismatches identified on the E6 gene. PCR reactions were performed on the LightCycler® 480 II. The instrument (Roche Diagnostics) was equipped with the software LightCycler® 480 Gene Scanning Software Version 1.5 (Roche Diagnostics). Approximately 50 ng of DNA was amplified in a total volume of 20 μl containing 0.2 μM of each primer, 1X PCR buffer, 0.2 mM of each dNTP, 0.3 unit TaqDNA polymerase (Dongsheng Biotech Co., Ltd. Guangzhou, China) and 1 μl LC Green plus (Idaho Technology). The reaction conditions were 95°C for 3 min, followed by 35 cycles at 98°C for 20 sec, 60°C for 20 sec, and 72°C for 20 sec. The melting program included three steps: denaturation at 95°C for 1 min, renaturation at 40°C for 1 min and then melting in a continuous fluorescent reading from 60–95°C at 20 acquisitions/°C.

Liquid-based cytology test (LCT) and pathological diagnosis

LCT was performed in the Chaozhou Central Hospital. The detailed protocols were previously described (15). The results were evaluated using the Bethesda system (19). The evaluation system included: i) negative (A0), ii) atypical squamous cells (ASC), iii) low-grade squamous intraepithelial lesion (LSIL), iv) high-grade squamous intraepithelial lesion (HSIL), and v) squamous cell carcinoma (SCC). The LSIL, HSIL and SCC cases further received biopsies and the samples were processed and diagnosed in the Department of Pathology, Chaozhou Central Hospital.

Statistical analysis

For pathogenic risks assessment, binary and multinomial logistic regression analysis was used. Firstly, the pathogenic risks were compared (binary logistic regression) between two main lineages variants according to the phylogenetic trees constructed. Then, the pathogenic risks of the four most common variants were compared (multinomial logistic regression). All data were analyzed using SPSS software version 16. P-values were two-sided, and statistical significance was accepted if the P-value was ≤0.05.

Results and Discussion

Phylogenetic and geographical relatedness of HPV52 variants

Of the total 84 specimens, five specimens were excluded since they were negative for GAPDH amplification, and the complete E6 and L1 genes were amplified and sequenced successfully in 79 cases. Among them, six cases were not suitable for genetic variability evaluation because they were infected with two kinds of HPV-52 variants. Thus, the HPV-52 genetic variability was evaluated in 73 HPV-52 singly infected females (median age 44.5 years, range 35.5–59.4 years).

At the nucleotide level, a total of 21 HPV-52 variants were identified when E6 and L1 sequences were combined and the prototype TJ49-52 was used as the standard for comparison. The sequences of these 21 variants have been submitted to the GenBank. The GenBank IDs are JN874437-JN874457 for the E6 gene and JN874416-JN874436 for the L1 gene (Table III). The maximum nucleotide diversity was 1.1% (22/2037) observed between isolates CZ52A375 and CZ52E429.

Table III.

The GenBank IDs for the isolates reported in this study.

Table III.

The GenBank IDs for the isolates reported in this study.

IsolatesGenBank ID for E6 geneGenBank ID for L1 geneLineage
CZ52A105JN874437JN874416Asian
CZ52A207JN874438JN874417Asian
CZ52A255JN874439JN874418Asian
CZ52A620JN874441JN874420Asian
CZ52A1404JN874442JN874421Asian
CZ52A1230JN874443JN874422Asian
CZ52A375JN874444JN874423Asian
CZ52A1569JN874446JN874425Asian
CZ52A264JN874447JN874426Asian
CZ52A247JN874448JN874427Asian
CZ52A277JN874449JN874428Asian
CZ52A336JN874450JN874429Asian
CZ52A1023JN874451JN874430Asian
CZ52A228JN874453JN874432Asian
CZ52A168JN874454JN874433Asian
CZ52D416JN874455JN874434Asian
CZ52D417JN874456JN874435Asian
CZ52A921JN874457JN874436Asian
CZ52E928JN874440JN874419European
CZ52E136JN874445JN874424European
CZ52E429JN874452JN874431European

There were 10 and 15 kinds of variability found on E6 and L1 gene, respectively. Across the E6 gene 2.5% nucleotide sites (11/447) and 1.3% encoded amino acids (2/149) were variable (Table IV), while 1.9% nucleotide sites (31/1590) and 1.1% encoded amino acids (6/530) were variable across the L1 gene (Table V).

Table IV.

Mismatches on the E6 gene.

Table IV.

Mismatches on the E6 gene.

Nucleotide position
Isolate90136168228249255277278336366429
CZ52A105TCCTTGAGTCA
CZ52A1569CCCTTGAGTCA
CZ52A336TCCTTGAGCCA
CZ52A228TCCCTGAGTCA
CZ52A255TCCTTAAGTCA
CZ52A168TCTTTGAGTCA
CZ52A277TCCTTGCGTAaA
CZ52E928TCCTGGAAbTCA
CZ52E429TCCTTGAAbTCG
CZ52E136TTCTTGAAbTCG

{ label (or @symbol) needed for fn[@id='tfn4-ijmm-30-03-0535'] } The E6 gene sequence of isolate CZ52A105 (GenBank ID, JN874437) is used as the standard for comparison and nucleotide position numbering. The E6 gene sequences of isolates CZ52A207, CZ52A620, CZ52A1404, CZ52A1230, CZ52A375, CZ52A247, CZ52A1023, CZ52D416 and CZ52A921 completely match those of isolate CZ52A105, and are not listed. The E6 gene sequences of isolates CZ52A264 and CZ52D417 are identical with CZ52A255, and are not listed.

a Non-synonymous mutation, leading to the change of amino acid R122K.

b Non-synonymous mutation, leading to the change of amino acid N93K. Other mismatches are all synonymous mutations.

Table V.

Mismatches on the L1 gene.

Table V.

Mismatches on the L1 gene.

Nucleotide position
Isolate1420724726434537540844451954662062165487992197599910231134113711921200123012461260135313771404148815481569
CZ52A105TGAAAACGGAATACATAGGGGCGGTAAAAGG
CZ52A207TAAAAACGGAATACATAGGGGCGGTAAAAGG
CZ52A620TGAAAACGGACaTACATAGGGGCGGTAAAAGG
CZ52A1404TGAAAACGGAATACATAGGGGCGGTAACbAGG
CZ52A1230TGAAAACGGAATACATAGGGGCAGTAAAAGG
CZ52A1569TGAAAACGGAATACATAGGGGCGGTAAAAGA
CZ52A264TGAGAACGGAATACATAGGGGCGGTAAAAGG
CZ52A1023TGAAAACGGAATACATAAGGGCGGTAAAAGG
CZ52A277TGAAAACGGAATACATAGGGGCGAcTAGAAGG
CZ52A921TAAAAACGGAATACGTAGGGGCGGTAAAAGG
CZ52A247TGGdAAACAGAATACGAAGGGGCGGTAAAAGG
CZ52A375TGAGAGCGGACaCACATGGGGAeCGGTAAAAGG
CZ52D416TGAAAACGAGATATATAGGGGCGGTAAAAGG
CZ52E928TAAAAATGGGATGCATAGGTGTAGCCAAGGG
CZ52E429CfAAAGATGAGATATATAGATGTAGCAAAGAG

{ label (or @symbol) needed for fn[@id='tfn7-ijmm-30-03-0535'] } The L1 gene sequence of isolate CZ52A105 (GenBank ID: JN874416) was used as the standard for comparison and nucleotide position numbering. The L1 gene sequences of isolates CZ52A255, CZ52A168, CZ52A228 and CZ52A336 completely matched with isolate CZ52A105, and are not listed. The L1 gene sequence of isolate CZ52D417 is identical with CZ52D416, and is not listed. The L1 gene sequence of isolate CZ52E136 is identical with CZ52E429, and is not listed.

a Non-synonymous mutation, leading to the change of amino acid N207T.

b Non-synonymous mutation, leading to the change of amino acid E468D.

c Non-synonymous mutation, leading to the change of amino acid D416N.

d Non-synonymous mutation, leading to the change of amino acid S83G.

e Non-synonymous mutation, leading to the change of amino acid E398K.

f Non-synonymous mutation, leading to the change of amino acid L5S. Other mismatches are all synonymous mutations.

Great similarity was found between the phylogenetic trees constructed based on the E6 or L1 gene. Partial and complete HPV-52 sequence reports in different regions of the world formed evolutionary trees with two main branches driven by variants with high prevalence in Asia (Fig. 1, branch A) or Europe (Fig. 1, branch E), which was coincident with the previous study (10). The details of the sequences used for phylogenetic tree construction are presented in Table VI.

Table VI.

Details of the sequences used for phylogenetic tree construction.

Table VI.

Details of the sequences used for phylogenetic tree construction.

IsolateSequence typeGenBank IDCity/CountryLineage
b00422E6 genes, complete cdsEU924143Guangzhou, ChinaAsian
b00428E6 genes, complete cdsEU924144Guangzhou, ChinaAsian
HK1243E6 genes, complete cdsDQ057293Hongkong, ChinaAsian
ZJ1-52E6 genes, complete cdsHM004116Hangzhou, ChinaAsian
ZJ2-52E6 genes, complete cdsHM004115Hangzhou, ChinaAsian
ZJ7-52E6 genes, complete cdsHM004117Hangzhou, ChinaAsian
PT124-07E6 genes, complete cdsFJ002423PortugalAsian
TJ49-52Complete genomeGQ472848Tianjin, ChinaAsian
IN141070Complete genomeHQ537743Chiang Mai, ThailandAsian
IN181391Complete genomeHQ537742Chiang Mai, ThailandAsian
Qv00585Complete genomeHQ537741Guanacaste, Costa RicaAsian
Qv03594Complete genomeHQ537740Guanacaste, Costa RicaAsian
ED123E6 genes, complete cdsDQ057290ScotlandEuropean
PT240-03E6 genes, complete cdsEF566934PortugalEuropean
REF.Complete genomeX74481GermanyEuropean
Rw846Complete genomeHQ537735RwandanEuropean
Z096Complete genomeHQ537736ZambiaEuropean
Qv03719Complete genomeHQ537745Guanacaste, Costa RicaEuropean
Qv26382Complete genomeHQ537732Guanacaste, Costa RicaEuropean
Qv00615Complete genomeHQ537746Guanacaste, Costa RicaEuropean

[i] CDS, sequence coding for amino acids in protein.

The isolate CZ52A105 represented the most common variant on branch A with 45.2% (33/73) of the cases infected with this kind of variant (Table VII). Following was isolate CZ52A255 (8/73) and CZ52A207 (8/73). There was one synonymous mutation compared with CZ52A105 on E6 for the former and on L1 for the latter. The fourth most common variant were isolates CZ52A228 (2/73) and CZ52A264 (2/73). There was one synonymous mutation compared with CZ52A105 on E6 for the former, and one synonymous mutation on E6 and L1 respectively for the latter. The sequences of other variants located on branch A were all unique.

Table VII.

LCT results for the most frequent variants.

Table VII.

LCT results for the most frequent variants.

LCT results, n
Isolate (lineagea)Cases, nASCLSILHSIL and SCCLCT+ (%)OR (95% CI)b
CZ52A105 (A)33103114 (42.4)Reference
CZ52A207 (A)84004 (50.2)1.36 (0.29–6.38)
CZ52A255 (A)85005 (62.5)2.26 (0.46–11.08)
CZ52E429 (E)43003 (75.0)4.07 (0.38–43.39)
Total Asian variants66238233 (50.0)Reference
Total European variants74004 (57.1)1.33 (0.28–6.43)

a A, represents Asian lineage; E, represents European lineage.

b OR was obtained using binary (between two main lineages variants) and multinomial (between the 4 most common variants) logistic regression analysis model. OR, odds ratio; 95% CI, 95% confidence intervals.

The isolate CZ52A105 located at the bifurcation of branch A, 83.6% (61/73) samples were identical with CZ52A105 at amino acid level. Moreover, its E6 and L1 sequences were completely matched with isolate IN141070 (11,20) reported in Chiang Mai (N 18.56, E 72.49). The E6 sequence was also identical with isolates b00422 and b00433 reported in Guangzhou (N 23.70, E 113.15) and isolate HK1243 and HK2571 (17) reported in HongKong (N 22.65, E 113.86). The latitude of Chaozhou (N 23.40, E 116.38) and of these 3 cities all ranged from N 18 to N 24. Taken all above mentioned into consideration, we suggest that the isolate CZ52A105 represents the most common and ancient HPV-52 variant in South-East Asia.

Nearly one tenth (7/73) of the cases were phylogenetically related to European lineages, and three variants were identified. The isolate CZ52E429 (4 cases) represented the most frequent variant, followed by isolate CZ52E928 (2 cases). Compared with CZ52E429, one non-synonymous mutant was observed on L1, two and seven synonymous mutants were identified on E6 and L1 respectively. The other isolate located on branch E was CZ52E136 (1 case), there was only one synonymous mutant found on E6 if the sequence of isolate CZ52E429 was used as a reference. The isolate CZ52E928 located at the bifurcation of branch E, it may represent the most widely spread variant. The same E6 and L1 sequences were also found in Europe (Germany) (21), Africa (Rwanda) and North America (Costa Rica) (11,22,23). We speculate that this variant may be derived from the worldwide migration of the European host.

Variants pathogenicity assessment and HRM analysis application

Despite phylogenetic relatedness, a geographic-related pathogenicity difference has been found in HPV-16 and HPV-18 variants. The carcinogenic risk for Asian-American or African HPV16 variants is greater than that of European variants (8), and non-European HPV-18 variants are more common in cancer tissues than European variants (9).

A preliminary pathogenicity comparison between HPV-52 variants was performed in this study. The LCT results of the most frequent variants are shown in Table VII. A total of 73 specimens were firstly divided into 2 groups, one was made up of the Asian lineage related specimens (66 cases), and the other was composed of European lineage related specimens (7 cases). The pathogenic risk was assessed by binary logistic regression analysis. The median age of the two groups was 45.4 and 42.2-year-old, no significant difference was found between the pathogenic risk of these two lineages variants (P=0.72). Then, the pathogenic risks of the four most common variants were evaluated. There was no statistically significant difference between the groups (P=0.51). However, there were some limitations for this conclusion, because there was a great unbalance between the case numbers of the variants. In order to validate this conclusion, it is necessary to perform this experiment in a larger sample.

The HRM analysis provided us a more economic and rapid method to deal with large scale screening HPV-52 variants. As a preliminary attempt, the E6 gene was used to group identified HPV-52 variants by HRM analysis. The choice of E6 gene for the analysis of the variability by HRM was based on the fact that it was the most common gene examined by sequencing worldwide, and because it has an optimal variable region (6,14).

A shorter amplicon was usually required for HRM analysis because as amplicon size increase, it becomes increasingly difficult to identify mismatches (13). For this reason, the amplicon (nucleotide 187–326, 140 bp) used for HRM analysis was only one third of the complete E6 gene. This amplicon involved five mismatches found on the E6 gene in our study, and these mismatches led to six kinds of variants. One variant involved two mismatches, the other five contained only one mismatch. It is worth pointing out that the consensus mismatch between the Asian and European lineages was located at nucleotide 278 (G>A) (Table IV), and it was also located in the amplicon.

After all the data were normalized, a total of 79 specimens (including six multiple variants infection cases) were divided into six groups (Fig. 2), and all of six variants on the amplicon could be divided into distinct groups. Four groups (Fig. 2A–D) were composed of Asian variants, and the other two (Fig. 2E and F) were made of European variants. In this sense, Asian and European variants could be distinguished by HRM analysis with a complete accuracy. Therefore, the application of HRM would facilitate the HPV-52 variants pathogenic comparison between Asian and European lineages. In addition, one case with two HPV-52 variants infection (Ab1) could also be identified by the shape of the resulting melting curve (Fig. 2G).

Multiple variant infections

In this study, some double peaks were found in 7 direct sequencing results, and 6 specimens were involved in these events. The Ab6 and Ab7 were consecutive fragments derived from one specimen, and the other 5 came from different specimens. Interestingly, the same double peaks were found in four of them (Ab2-Ab5) at the same nucleotide position.

After digestion with specific restriction enzymes, three electrophoresis bands could be found, including two new generated bands and one uncleavable band (Fig. 3), which was purified and submitted for sequencing. The double peaks disappeared in the sequence trace of the uncleavable fragments, which were replaced by a single base at the corresponding positions (Fig. 3). Using Ab2 (Fig. 3C) as an example, six double peaks were observed in its direct sequencing results (Fig. 4B2). They were composed of peaks, C:A, G:T, A:G, G:A, A:C and C:T in turn. After digestion with restriction enzyme XbaI, these double peaks were replaced with single base C, G, A, G, A and C respectively in the sequence trace of the uncleavable fragment. On the contrary, if this PCR product was digested with restriction enzyme TaqI, these double peaks were replaced with single base A, T, G, A, C and T, respectively. Based on this result, we believed that the most possible reason for this event was that the specimens contained two HPV-52 variants, in other words, these women infected two kinds of HPV-52 variants. We believe that this phenomenon may be similar to the multiple type infections. Once a woman is singly infected with HPV-52, she has an almost equal opportunity of further infection with other HPV types or infection with HPV-52 again, the former events leading to multiple infections, and the latter possibly leading to two kinds of HPV-52 variants infection.

To our knowledge, this rare phenomenon has not so far been reported worldwide. However, since it was observed in 7.6% (6/79) specimens in this study, why was it not observed in the previous studies? We think that there are three possible reasons. First, this rare phenomenon is preferentially observed in an area of high HPV-52 prevalence. Second, the primers used for amplification must have been suitable for two kinds of variants. Last but not least, the viral loads of two different variants should be nearly equal in the same sample. However, the lower one might be ignored in the sequencing trace if there was a great difference between the viral loads of the two variants. As described above, HPV-52 was the most common HPV type in eastern Guangdong, and its high prevalence may increase the opportunity of multiple variants infection.

Acknowledgements

This study was supported by grants by the Medical Research Funds of Guangdong Province (A2011760, B2008179). Reagent discounts and reagent gifts were from the Hybribio Biotechnology Limited Corp. We offer special recognition for the excellent work of the study staff in sample collection. We sincerely thank SY Zheng and JB Liu (Department of Pathology, Chaozhou Central Hospital) for technical assistance with pathology.

References

1. 

HC ChenM SchiffmanCY LinMH PanSL YouLC ChuangCY HsiehKL LiawAW HsingCJ ChenCBCSP-HPV Study GroupPersistence of type-specific human papillomavirus infection and increased long-term risk of cervical cancerJ Natl Cancer Inst10313871396201110.1093/jnci/djr28321900119

2. 

N MuñozFX BoschS de SanjoséR HerreroX CastellsaguéKV ShahPJ SnijdersCJ MeijerInternational Agency for Research on Cancer Multicenter Cervical Cancer Study GroupEpidemiologic classification of human papillomavirus types associated with cervical cancerN Engl J Med3485185272003

3. 

GM CliffordJS SmithM PlummerN MuñozS FranceschiHuman papillomavirus types in invasive cervical cancer worldwide: a meta-analysisBr J Cancer886373200310.1038/sj.bjc.660068812556961

4. 

CM HoTY ChienSH HuangBH LeeSF ChangIntegrated human papillomavirus types 52 and 58 are infrequently found in cervical cancer, and high viral loads predict risk of cervical cancerGynecol Oncol1025460200610.1016/j.ygyno.2005.11.03516386784

5. 

K TakeharaT TodaT NishimuraJ SakaneY KawakamiT MizunoeM NishiwakiK TaniyamaHuman papillomavirus types 52 and 58 are prevalent in uterine cervical squamous lesions from Japanese womenPatholog Res Int2011246936201121660229

6. 

HU BernardIE Calleja-MaciasST DunnGenome variation of human papillomavirus types: phylogenetic and medical implicationsInt J Cancer11810711076200610.1002/ijc.2165516331617

7. 

M SchiffmanR HerreroR DesalleA HildesheimS WacholderAC RodriguezMC BrattiME ShermanJ MoralesD GuillenThe carcinogenicity of human papillomavirus types reflects viral evolutionVirology3377684200510.1016/j.virol.2005.04.00215914222

8. 

A HildesheimM SchiffmanC BromleyS WacholderR HerreroA RodriguezMC BrattiME ShermanU ScarpidisQQ LinHuman papillomavirus type 16 variants and risk of cervical cancerJ Natl Cancer Inst93315318200110.1093/jnci/93.4.31511181779

9. 

L SicheroS FerreiraH TrottierE Duarte-FrancoA FerenczyEL FrancoLL VillaHigh grade cervical lesions are caused preferentially by non-European variants of HPVs 16 and 18Int J Cancer12017631768200710.1002/ijc.2248117230525

10. 

T RaiolPS WyantRM de AmorimDM CerqueiraNG MilaneziM Brígido MdeL SicheroCR MartinsGenetic variability and phylogeny of the high-risk HPV-31, -33, -35, -52, and -58 in central BrazilJ Med Virol81685692200910.1002/jmv.2143219235839

11. 

Z ChenM SchiffmanR HerreroR DesalleK AnastosM SegondyVV SahasrabuddhePE GravittAW HsingRD BurkEvolution and taxonomic classification of human papillomavirus 16 (HPV16)-related variant genomes: HPV31, HPV33, HPV35, HPV52, HPV58 and HPV67PLoS One6e20183201110.1371/journal.pone.002018321673791

12. 

XL WuCT ZhangXK ZhuYC WangDetection of HPV types and neutralizing antibodies in women with genital warts in Tianjin City, ChinaVirol Sin25817201010.1007/s12250-010-3078-420960279

13. 

CT WittwerGH ReedCN GundryJG VandersteenRJ PryorHigh-resolution genotyping by amplicon melting analysis using LCGreenClin Chem49853860200310.1373/49.6.85312765979

14. 

I SabolM CretnikI HadzisejdićA Si-MohamedM MatovinaB GrahovacS LevanatM GrceA new approach for the evaluation of the human papillomavirus type 16 variability with high resolution melting analysisJ Virol Methods162142147200910.1016/j.jviromet.2009.07.02919664661

15. 

M LinLY YangLJ LiJR WuYP PengZY LuoGenital human papillomavirus screening by gene chip in Chinese women of Guangdong provinceAust NZ J Obstet Gynaecol48189194200810.1111/j.1479-828X.2008.00844.x18366494

16. 

SS LiuRC LeungKK ChanAN CheungHY NganEvaluation of a newly developed GenoArray human papillomavirus (HPV) genotyping assay and comparison with the Roche Linear Array HPV genotyping assayJ Clin Microbiol48758764201010.1128/JCM.00989-0920042614

17. 

IE Calleja-MaciasLL VillaJC PradoM KalantariB AllanAL WilliamsonLP ChungRJ CollinsRE ZunaST DunnWorldwide genomic diversity of the high-risk human papillomavirus types 31, 35, 52, and 58, four close relatives of human papillomavirus type 16J Virol791363013640200510.1128/JVI.79.21.13630-13640.200516227283

18. 

K TamuraD PetersonN PetersonG StecherM NeiS KumarMEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methodsMol Biol Evol2827312739201110.1093/molbev/msr121

19. 

D SolomonD DaveyR KurmanA MoriartyD O’ConnorM PreyS RaabM ShermanD WilburT Wright JrN YoungForum Group Members; Bethesda 2001 Workshop: The 2001 Bethesda System: terminology for reporting results of cervical cytologyJAMA28721142119200211966386

20. 

K WongworapatR KeawvichitB SirirojnS DokutaC RuangyuttikarnS SriplienchanA SontiratKT KlaPE GravittDD CelentanoDetection of human papillomavirus from self-collected vaginal samples of women in Chiang Mai, ThailandSex Transm Dis35172173200810.1097/OLQ.0b013e318158af6518216725

21. 

H DeliusB HofmannPrimer-directed sequencing of human papillomavirus typesCurr Top Microbiol Immunol186133119948205838

22. 

R HerreroPE CastleM SchiffmanMC BrattiA HildesheimJ MoralesM AlfaroME ShermanS WacholderS ChenEpidemiologic profile of type-specific human papillomavirus infection and cervical neoplasia in Guanacaste, Costa RicaJ Infect Dis19117961807200510.1086/42885015871111

23. 

DK SinghK AnastosDR HooverRD BurkQ ShiL NgendahayoE MutimuraA CajigasV BigirimaniX CaiHuman papillomavirus infection and cervical cytology in HIV-infected and HIV-uninfected Rwandan womenJ Infect Dis19918511861200910.1086/59912319435429

Related Articles

Journal Cover

September 2012
Volume 30 Issue 3

Print ISSN: 1107-3756
Online ISSN:1791-244X

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Chen Q, Luo Z, Lin M, Yang L, Yang L and Ju G: Evaluation of the genetic variability of human papillomavirus type 52. Int J Mol Med 30: 535-544, 2012.
APA
Chen, Q., Luo, Z., Lin, M., Yang, L., Yang, L., & Ju, G. (2012). Evaluation of the genetic variability of human papillomavirus type 52. International Journal of Molecular Medicine, 30, 535-544. https://doi.org/10.3892/ijmm.2012.1017
MLA
Chen, Q., Luo, Z., Lin, M., Yang, L., Yang, L., Ju, G."Evaluation of the genetic variability of human papillomavirus type 52". International Journal of Molecular Medicine 30.3 (2012): 535-544.
Chicago
Chen, Q., Luo, Z., Lin, M., Yang, L., Yang, L., Ju, G."Evaluation of the genetic variability of human papillomavirus type 52". International Journal of Molecular Medicine 30, no. 3 (2012): 535-544. https://doi.org/10.3892/ijmm.2012.1017