Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
October 2012 Volume 30 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October 2012 Volume 30 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Guggulsterone inhibits melanogenesis in B16 murine melanoma cells by downregulating tyrosinase expression

  • Authors:
    • Jeung-Hyun Koo
    • Kyoung-Suk Rhee
    • Hyoung-Won Koh
    • Hyun-Young Jang
    • Byung-Hyun Park
    • Jin-Woo Park
  • View Affiliations / Copyright

    Affiliations: Department of Biochemistry, Chonbuk National University Medical School, Jeonju, Jeonbuk 561-756, Republic of Korea, Department of Internal Medicine, Chonbuk National University Medical School, Jeonju, Jeonbuk 561-756, Republic of Korea
  • Pages: 974-978
    |
    Published online on: July 12, 2012
       https://doi.org/10.3892/ijmm.2012.1057
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

In the present study, we investigated the effect of guggulsterone on melanogenesis in B16 melanoma cells and elucidated its possible mechanism of action. The effects of guggulsterone on melanogenesis were determined by assaying melanin synthesis and cellular tyrosinase activity in B16/F10 mouse melanoma cells. Guggulsterone dose-dependently inhibited isobutylmethylxanthine (IBMX)-induced melanogenesis and cellular tyrosinase activity with no cytotoxicity. Decreased melanin biosynthesis was accompanied by the reduced expression of melanogenesis-related genes, such as tyrosinase, microphthalmia-associated transcription factor, tyrosinase-related protein (TRP)-1 and TRP-2. Guggulsterone also inhibited α-melanocyte stimulating hormone- or forskolin-induced increases in melanogenesis, suggesting an action on the cAMP-dependent melanogenic pathway. Co-incubation with chenodeoxycholic acid, a well-known farnesoid-X receptor agonist, did not affect IBMX-induced melanogenesis. These results suggest that guggulsterone exerts a melanogenic inhibitory effect through the downregulation of tyrosinase expression.

Introduction

Melanin is synthesized in the melanosomes of melanocytes by a process known as melanogenesis and plays a crucial role in protecting the skin from the harmful effects of ultraviolet (UV) radiation and diverse free radicals. Melanogenesis is regulated by at least three melanogenic enzymes, tyrosinase, tyrosinase-related protein (TRP)-1 and TRP-2 (1). Tyrosinase is a rate-limiting enzyme that catalyzes the first two steps in the melanin biosynthetic pathway: hydroxylation of tyrosine to 3,4-dihydroxyphenylalanine (DOPA) and oxidation of DOPA to DOPAquinone (2). TRP-2, which functions as a DOPAchrome tautomerase, catalyzes the rearrangement of DOPAchrome to 5,6-dihydroxyindole-2-carboxylic acid (DHICA) (3), and TRP-1 oxidizes DHICA to a carboxylated indole-quinone (4).

Understanding the regulation of melanogenesis is of great interest pharmaceutically and cosmeceutically as melanogenesis inhibitors can be used for the treatment of hyper-pigmentation-related diseases, such as melasma, lentigines, nevus, ephelis, freckles and age spots (5). Of the various signaling pathways that regulate melanogenesis, the cyclic AMP (cAMP)-dependent signaling pathway plays a pivotal role. cAMP-elevating agents, such as α-melanocyte stimulating hormone (α-MSH), isobutylmethylxanthine (IBMX) and forskolin stimulate melanogenic processes in the human epidermis (6,7). cAMP increases the expression of melanogenic enzymes partly through protein kinase A (PKA). PKA phosphorylates the cAMP responsive element binding protein (CREB), which induces the expression of microphthalmia-associated transcription factor (MITF) (8). MITF is known as a master regulator of melanocyte development, survival, differentiation and melanogenesis (9). It also regulates the transcription of three major melanogenic enzymes: tyrosinase, TRP-1 and TRP-2.

Flavonoids are a group of polyphenolic compounds widely distributed in plants. Their potent bioactivity and relatively low toxicity have rendered them attractive for use as active ingredients in functional foods and cosmetics. Guggulsterone [4,17(20)-pregnadiene-3,16-dione], which is the active component of gugulipid, is derived from the gum resin (guggulu) of the tree, Commiphora mukul. This gum resin has been used for centuries in Ayurvedic medicine to treat obesity, arthritis and hyperlipidemia (10,11). In addition, guggulsterone has been reported to act as a farnesoid X receptor (FXR) antagonist (12,13). Therefore, it can effectively regulate bile acid synthesis (11–14) and carbohydrate metabolism (15). We have previously studied the effects of guggulsterone on type 1 diabetes (16) and arthritis (17). However, to our knowledge, there is no report on effect of guggulsterone on melanogenesis. During screening for new melanogenesis-inhibiting agents from flavonoids, we found that guggulsterone effectively inhibited melanogenesis. Therefore, in this study, we investigated the inhibitory mechanism of guggulsterone against IBMX-induced melanogenesis in B16 melanoma cells.

Materials and methods

Cells and materials

The B16/F10 mouse melanoma cell line was obtained from the Korean Cell Line Bank (Seoul, Korea). Cells were cultured in DMEM containing 10% fetal bovine serum, 100 U/ml penicillin, 0.1 mg/ml streptomycin, and 0.25 μg/ml amphotericin B at 37°C in a humidified 95% air/5% CO2 atmosphere. Guggulsterone was obtained from Alexis Biochemicals (Lausen, Switzerland), and 6-ethyl chenodeoxycholic acid (CDCA), α-MSH, IBMX, and forskolin were obtained from Sigma (St. Louis, MO, USA). Drug treatment began 24 h after seeding, and cells were harvested after two days of incubation.

Melanin content measurement

The melanin contents of the cultured B16 cells were measured as described previously (18). The cells were washed twice with phosphate-buffered saline (PBS) and lysed with 20 mM Tris-0.1% Triton X-100 (pH 7.5). Cell lysates were precipitated with the same amount of 20% trichloroacetic acid. After washing twice with 10% trichloroacetic acid, the pellets were treated with ethyl alcohol:diethyl ether (3:1) and diethyl ether in succession. The samples were air-dried, dissolved in 1 ml of 0.85 M KOH, and boiled for 15 min. After cooling, absorbance was measured with a spectrophotometer at 440 nm. The amount of cellular melanin was corrected according to the DNA content of the samples. The DNA content was determined using the fluorescence assay of bisbenzimide H 33258 using a DNA Quantification kit (Sigma).

Tyrosinase activity assay

Tyrosinase activity was assayed as DOPA oxidase activity with some modifications, as described previously (18). Briefly, cell lysate was obtained after washing twice with PBS. Tyrosinase activity was then analyzed spectrophotometrically by following the oxidation of DOPA to DOPAchrome at 475 nm. The reaction mixture containing 100 μl of freshly prepared substrate solution (0.1% L-DOPA in 0.1 M sodium phosphate, pH 6.0) and 50 μl of enzyme solution was incubated at 37°C. The absorbance change was measured during the first 10 min of the reaction, while the increase of the absorbance was linear. Corrections for the auto-oxidation of L-DOPA in the controls were made. The tyrosinase activity was corrected according to the DNA content of the samples and presented as a percentage of IBMX-treated control cells.

MTT assay

The viability of the cultured cells was determined by the reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) to formazan. The cells were seeded in 96-well plates and cultured for 24 h. Following drug treatment, MTT (5 mg/ml in PBS, 100 μl) was added to each well. The cells were incubated at 37°C for 30 min, and dimethyl sulfoxide (100 μl) was then added to dissolve the formazan crystals. The absorbance was measured at 570 nm with a spectrophotometer.

Western blot analysis

Cells were homogenized in ice-cold lysis buffer. The homogenates containing 10 μg of protein were separated by SDS-PAGE with 10% resolving and 3% acrylamide stacking gel and transferred to a nitrocellulose membrane in a western blot analysis apparatus run at 100 V for 1.5 h. The nitrocellulose membrane was blocked with 2% bovine serum albumin and then incubated overnight with 1 μg/ml goat anti-murine tyrosinase IgG (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA). The binding of the antibody was detected with anti-goat IgG conjugated with horseradish peroxidase (Sigma). Immunoblots were developed using an Enhanced Chemiluminescence Plus kit (Amersham Biosciences, Buckinghamshire, UK), and the intensity of the bands was measured by LAS-1000 (Fujifilm, Tokyo, Japan).

Real-time RT-PCR

Total RNA was prepared from the cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Total RNA (2 μg) was treated with RNase-free DNase (Invitrogen), and first-strand cDNA was generated using random hexamer primers provided in the first-strand cDNA synthesis kit (Applied Biosystems, Foster City, CA, USA). Specific primers for each gene (Table I) were designed using Primer Express software (Applied Biosystems). The real-time RT-PCR reaction mixture consisted of 10 ng reverse transcribed total RNA, 167 nM forward and reverse primers, and 2X PCR master mixture in a final volume of 10 μl. PCR reactions were carried out in 384-well plates using the ABI PRISM 7900HT Sequence Detection System (Applied Biosystems). All the experiments were performed in triplicate.

Table I

Sequences and accession numbers for forward (F) and reverse (R) primers used in real-time RT-PCR.

Table I

Sequences and accession numbers for forward (F) and reverse (R) primers used in real-time RT-PCR.

GeneSequences for primersAccession no.
TyrosinaseF, TTGCCACTTCATGTCATCATAGAATATT
R, TTTATCAAAGGTGTGACTGCTATACAAAT
NM011661
TRP1F, ATGCGGTCTTTGACGAATGG
R, CGTTTTCCAACGGGAAGGT
NM031202
TRP2F, CTCAGAGCTCGGGCTCAGTT
R, TGTTCAGCACGCCATCCA
X63349
MITFF, CGCCTGATCTGGTGAATCG
R, CCTGGCTGCAGTTCTCAAGAA
NM008601
GAPDHF, CGTCCCGTAGACAAAATGGT
R, TTGATGGCAACAATCTCCAC
NM008084
Statistical analysis

Statistical analysis of the data was performed using ANOVA and Duncan’s test. P<0.05 was considered to indicated statistically significant differences.

Results

Guggulsterone inhibits melanogenesis in B16 cells

In order to investigate the effects of guggulsterone on IBMX-induced melanogenesis, the melanin contents in the B16 cells were measured following treatment with guggulsterone. At concentrations of 1, 5, 10, and 25 μM guggulsterone, melanin production was compared with the untreated controls (Fig. 1). At concentrations of 1, 5, 10, and 25 μM, guggulsterone decreased melanin production to 104.5±5.0, 54.1±5.8, 39.4±4.8 and 33.8±3.4%, respectively in a dose-dependent manner without obvious cytotoxicity at any of the concentrations tested.

Figure 1

Effect of guggulsterone on melanin content in B16 melanoma cells. Cells (5x106 cells/well) were incubated with various concentrations of guggulsterone in the presence of 0.1 mM IBMX for two days. Melanin content was determined as described in ‘Materials and methods’. Cell viability was determined by the MTT assay. Data are expressed as a percentage of the IBMX-treated control cells and presented as the means ± SEM (n=11). **P<0.01 vs. untreated control. GS, guggulsterone.

Guggulsterone decreases the expression of melanogenesis-related genes

Since tyrosinase is the rate-limiting enzyme for melanin biosynthesis, the effect of guggulsterone on tyrosinase activity was determined. Cellular tyrosinase activity was decreased by guggulsterone in a dose-dependent manner (Fig. 2), which was consistent with the decreased melanin content (Fig. 1). The expression of tyrosinase protein was determined by western blot analysis (Fig. 3). The results showed that the tyrosinase protein was greatly increased by IBMX treatment, and this induction was significantly inhibited by guggulsterone in a dose-dependent manner. The expression of tyrosinase mRNA determined by real-time RT-PCR also exhibited a significant decrease following guggulsterone treatment (Fig. 4). These results indicated that the inhibition of tyrosinase by guggulsterone was exerted at the transcriptional level. The mRNA levels of TRP-1, TRP-2 and MITF, members of the melanogenesis-related gene family, were also decreased by the presence of guggulsterone (Fig. 4).

Figure 2

Effect of guggulsterone on cellular tyrosinase activity. Cells (5x106 cells) were treated with various concentrations of guggulsterone in the presence of 0.1 mM IBMX for two days. Tyrosinase activity in cellular lysate was determined. Data are expressed as a percentage of the IBMX-treated controls and presented as the mean ± SEM (n=9). **P<0.01 vs. untreated control. GS, guggulsterone.

Figure 3

Effect of guggulsterone on tyrosinase protein expression. Cells (5x106 cells) were treated with a range of concentrations (1–25 μM) of guggulsterone in the presence or absence of 0.1 mM IBMX for two days. Tyrosinase protein levels were analyzed by western blot analysis. Experiments were performed three times with similar results, and a typical result was presented. GS, guggulsterone.

Figure 4

Effect of guggulsterone on the expression of melanogenesis-related genes. Cells (5x106 cells) were treated with 0.1 mM IBMX for two days in the presence or absence of 10 μM guggulsterone. The cells were then harvested, and total RNA was extracted. mRNA expression was quantified by real-time RT-PCR and normalized to GAPDH. Data are expressed as a relative expression of IBMX-treated cells and presented as the means ± SEM (n=8). *P<0.05; **P<0.01 vs. IBMX-treated control. GS, guggulsterone.

Guggulsterone inhibits cAMP-elevating agent-induced melanogenesis

When the B16 cells were incubated with IBMX, the cell suspension turned black, indicating increased cellular melanogenesis (Fig. 5). The cellular melanin contents were also markedly increased in the cells treated with 5 μM α-MSH or 5 μM forskolin. However, the presence of guggulsterone significantly inhibited melanogenesis induced by both α-MSH and forskolin (Fig. 5), suggesting that guggulsterone regulates melanogenesis through the cAMP-dependent pathway.

Figure 5

Effect of guggulsterone on α-MSH-, IBMX- and forskolin-induced melanogenesis. Cells (5x106) were incubated with 10 μM guggulsterone in the presence of IBMX (0.1 mM), α-MSH (5 μM), or forskolin (5 μM) for two days, collected in a microfuge tube, and photographed. Experiments were performed three times with similar results, and a typical photograph was presented. GS, guggulsterone.

The inhibitory effect of guggulsterone on IBMX-induced melanogenesis was not affected when the B16 cells were treated with both guggulsterone and CDCA, an antagonist and an agonist for FXR, respectively (Fig. 6). These results indicated that the effect of guggulsterone on melanogenesis was not mediated by antagonizing the FXR signaling pathway. Again, treatment with guggulsterone or CDCA alone did not affect melanogenesis at the concentration used in this study.

Figure 6

Effects of guggulsterone and chenodeoxycholic acid (CDCA) on IBMX-induced melanogenesis. Cells (5x106) were incubated with 10 μM guggulsterone or 10 μM CDCA in the presence or absence of IBMX (0.1 mM) for two days, collected in a microfuge tube, and photographed. Experiments were performed three times with similar results, and a typical photograph was presented. GS, guggulsterone.

Discussion

We performed this study to examine whether guggulsterone can be used as a whitening cosmetic agent. To answer this question, we first evaluated whether guggulsterone can inhibit melanogenesis in IBMX-treated B16 melanoma cells. When the B16 cells were treated with guggulsterone, a dose-dependent inhibition of melanin production was observed. This result cannot be explained by the cytotoxicity of guggulsterone, as there was no evident decrease in the number of viable cells up to a concentration of 25 μM.

UV-induced hyperpigmentation occurs in two stages, an immediate darkening and a delayed tanning reaction. Immediate pigment darkening is thought to result from the oxidation of pre-existing melanin and redistribution of melanosomes. By contrast, the delayed tanning response that is photoprotective against subsequent UV injury begins as the immediate pigmentation reaction fades and progresses for at least three to five days after UV exposure (19). Delayed tanning is preceded by the increase in tyrosinase activity in melanocytes (5,19). Since tyrosinase catalyzes the rate-limiting reaction of the melanogenic process, any reduction in the amount of enzyme activity or expression will result in a corresponding decrease in the amount of melanin synthesized. Indeed, in B16 cells treated with IBMX, there were marked increases in tyrosinase activity, namely increases in protein and mRNA expression, which were similar to those of the delayed tanning response after UV irradiation. Accordingly, the treatment of cells with guggulsterone resulted in dose-dependent inhibition of the enzymatic activity and expression of tyrosinase. These results indicate that guggulsterone inhibits IBMX-induced melanogenesis in B16 cells through the suppression of tyrosinase expression.

The melanocyte-keratinocyte complex of the skin responds quickly to a wide range of environmental stimuli, often through paracrine and/or autocrine means. IBMX is known to increase cellular cAMP through the inhibition of the cAMP-degrading enzyme, phosphodiesterase (20). Guggulsterone effectively blocked the IBMX-induced increase in melanogenesis by decreasing the expression of tyrosinase. This effect occurred at the transcriptional level, suggesting its action on the cAMP-dependent pathway. When the B16 cells were treated with α-MSH, a peptide acting on melanocortin 1-receptor (MC1-R) of melanocytes (21), or forskolin, a direct activator of adenylate cyclase (22), the cellular melanin contents were significantly increased. Again, guggulsterone significantly inhibited melanogenesis induced by both α-MSH and forskolin, as in the case of IBMX stimulation. These results also support the action mechanism of guggulsterone on the cAMP-dependent pathway. In addition to the cAMP/PKA pathway, increased melanogenesis after UV irradiation was thought to occur through the activation of the diacylglycerol/protein kinase C (PKC) and nitric oxide/protein kinase G (PKG) pathways, and SOS response to UV-induced DNA damage (5). The PKC-induced activation of tyrosinase occurs through phosphorylation rather than the synthesis of new enzymes (23). However, PKG is known to increase the expression of tyrosinase protein (24). The additional effects of guggulsterone on these pathways require further study.

Safety following long-term application is a very important issue for therapeutic compounds. In recent years, naturally occurring herbal extracts and flavonoids have gained attention as putative hypopigmenting agents (18,25–27). In the case of guggulsterone, no toxicity was observed after oral administration (75 mg/kg) for eight weeks in laboratory rats (28). The topical application of guggulsterone prior to 12-O-tetradecanoylphorbol-13-acetate (TPA) application onto mouse skin resulted in a significant inhibition against TPA-induced skin edema and hyperplasia without any noticeable side-effects (29). In addition, guggulsterone has long been used in traditional medicine. This evidence suggests the possibility of guggulsterone as a safe hypopigmenting agent.

In conclusion, to our knowledge, the present study demonstrates for the first time that guggulsterone is an effective inhibitor of tyrosinase and inhibits melanin biosynthesis. Even though we have not determined its effects in in vivo conditions, guggulsterone may have beneficial effects in the treatment of hyperpigmentation diseases.

Acknowledgements

The present study was supported by a National Research Foundation of Korea grant funded by the Korean Government (no. 2011-0028222).

References

1. 

Y YamaguchiVJ HearingPhysiological factors that regulate skin pigmentationBiofactors35193199200910.1002/biof.2919449448

2. 

VJ HearingM JimenezMammalian tyrosinase - the critical regulatory control point in melanocyte pigmentationInt J Biochem1911411147198710.1016/0020-711X(87)90095-43125075

3. 

K YokoyamaK YasumotoH SuzukiS ShibaharaCloning of the human DOPAchrome tautomerase/tyrosinase-related protein 2 gene and identification of two regulatory regions required for its pigment cell-specific expressionJ Biol Chem26927080270871994

4. 

T KobayashiK UrabeA WinderTyrosinase related protein 1 (TRP1) functions as a DHICA oxidase in melanin biosynthesisEMBO J135818582519947813420

5. 

GE CostinVJ HearingHuman skin pigmentation: melanocytes modulate skin color in response to stressFASEB J21976994200710.1096/fj.06-6649rev17242160

6. 

R BuscaR BallottiCyclic AMP a key messenger in the regulation of skin pigmentationPigment Cell Res136069200010.1034/j.1600-0749.2000.130203.x10841026

7. 

S ImO MoroF PengActivation of the cyclic AMP pathway by alpha-melanotropin mediates the response of human melanocytes to ultraviolet B radiationCancer Res58475419989426056

8. 

C BertolottoP AbbeTJ HemesathMicrophthalmia gene product as a signal transducer in cAMP-induced differentiation of melanocytesJ Cell Biol142827835199810.1083/jcb.142.3.8279700169

9. 

P WanY HuL HeRegulation of melanocyte pivotal transcription factor MITF by some other transcription factorsMol Cell Biochem354241246201110.1007/s11010-011-0823-421519923

10. 

CJ SinalFJ GonzalezGuggulsterone: an old approach to a new problemTrends Endocrinol Metab13275276200210.1016/S1043-2760(02)00640-912163224

11. 

NL UrizarDD MooreGUGULIPID: a natural cholesterol-lowering agentAnnu Rev Nutr23303313200310.1146/annurev.nutr.23.011702.07310212626688

12. 

NL UrizarAB LivermanDT DoddsA natural product that lowers cholesterol as an antagonist ligand for FXRScience29617031706200210.1126/science.107289111988537

13. 

J WuC XiaJ MeierS LiX HuDS LalaThe hypolipidemic natural product guggulsterone acts as an antagonist of the bile acid receptorMol Endocrinol1615901597200210.1210/mend.16.7.089412089353

14. 

J CuiL HuangA ZhaoGuggulsterone is a farnesoid X receptor antagonist in coactivator association assays but acts to enhance transcription of bile salt export pumpJ Biol Chem2781021410220200310.1074/jbc.M20932320012525500

15. 

KR StayrookKS BramlettRS SavkurRegulation of carbohydrate metabolism by the farnesoid X receptorEndocrinology146984991200510.1210/en.2004-096515564327

16. 

N LvMY SongEK KimJW ParkKB KwonBH ParkGuggulsterone, a plant sterol, inhibits NF-κB activation and protects pancreatic beta cells from cytokine toxicityMol Cell Endocrinol28949592008

17. 

YR LeeJH LeeEM NohGuggulsterone blocks IL-1β-mediated inflammatory responses by suppressing NF-κB activation in fibroblast-like synoviocytesLife Sci82120312092008

18. 

JH KooI LeeSK YunHU KimBH ParkJW ParkSaponified evening primrose oil reduces melanogenesis in B16 melanoma cells and reduces UV-induced skin pigmentation in humansLipids45401407201010.1007/s11745-010-3405-420352496

19. 

MS EllerBA GilchrestTanning as part of the eukaryotic SOS responsePigment Cell Res13Suppl 8S94S97200010.1034/j.1600-0749.13.s8.17.x11041364

20. 

JA BeavoNL RogersOB CroffordJG HardmanEW SutherlandEV NewmanEffects of xanthine derivatives on lipolysis and on adenosine 3′,5′-monophosphate phosphodiesterase activityMol Pharmacol65976031970

21. 

K WakamatsuA GrahamD CookAJ ThodyCharacterisation of ACTH peptides in human skin and their activation of the melanocortin-1 receptorPigment Cell Res10288297199710.1111/j.1600-0749.1997.tb00688.x9359624

22. 

T TamagawaH NikiA NikiInsulin release independent of a rise in cytosolic free Ca2+ by forskolin and phorbol esterFEBS Lett183430432198510.1016/0014-5793(85)80825-52985438

23. 

HY ParkV RussakovskyS OhnoBA GilchrestThe beta isoform of protein kinase C stimulates human melanogenesis by activating tyrosinase in pigment cellsJ Biol Chem268117421174919937685020

24. 

M SasakiT HorikoshiH UchiwaY MiyachiUp-regulation of tyrosinase gene by nitric oxide in human melanocytesPigment Cell Res13248252200010.1034/j.1600-0749.2000.130406.x10952392

25. 

DS KimSH ParkSB KwonK LiSW YounKC Park(-)-Epigallocatechin-3-gallate and hinokitiol reduce melanin synthesis via decreased MITF productionArch Pharm Res27334339200410.1007/BF0298006915089040

26. 

JH KooHT KimHY YoonEffect of xanthohumol on melanogenesis in B16 melanoma cellsExp Mol Med40313319200810.3858/emm.2008.40.3.31318587269

27. 

N LvJH KooHY YoonEffect of Angelica gigas extract on melanogenesis in B16 melanoma cellsInt J Mol Med207637672007

28. 

B SharmaR SalunkeS SrivastavaC MajumderP RoyEffects of guggulsterone isolated from Commiphora mukul in high fat diet induced diabetic ratsFood Chem Toxicol4726312639200919635521

29. 

S SarfarazIA SiddiquiDN SyedF AfaqH MukhtarGuggulsterone modulates MAPK and NF-κB pathways and inhibits skin tumorigenesis in SENCAR miceCarcinogenesis2920112018200818684729

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Koo J, Rhee K, Koh H, Jang H, Park B and Park J: Guggulsterone inhibits melanogenesis in B16 murine melanoma cells by downregulating tyrosinase expression. Int J Mol Med 30: 974-978, 2012.
APA
Koo, J., Rhee, K., Koh, H., Jang, H., Park, B., & Park, J. (2012). Guggulsterone inhibits melanogenesis in B16 murine melanoma cells by downregulating tyrosinase expression. International Journal of Molecular Medicine, 30, 974-978. https://doi.org/10.3892/ijmm.2012.1057
MLA
Koo, J., Rhee, K., Koh, H., Jang, H., Park, B., Park, J."Guggulsterone inhibits melanogenesis in B16 murine melanoma cells by downregulating tyrosinase expression". International Journal of Molecular Medicine 30.4 (2012): 974-978.
Chicago
Koo, J., Rhee, K., Koh, H., Jang, H., Park, B., Park, J."Guggulsterone inhibits melanogenesis in B16 murine melanoma cells by downregulating tyrosinase expression". International Journal of Molecular Medicine 30, no. 4 (2012): 974-978. https://doi.org/10.3892/ijmm.2012.1057
Copy and paste a formatted citation
x
Spandidos Publications style
Koo J, Rhee K, Koh H, Jang H, Park B and Park J: Guggulsterone inhibits melanogenesis in B16 murine melanoma cells by downregulating tyrosinase expression. Int J Mol Med 30: 974-978, 2012.
APA
Koo, J., Rhee, K., Koh, H., Jang, H., Park, B., & Park, J. (2012). Guggulsterone inhibits melanogenesis in B16 murine melanoma cells by downregulating tyrosinase expression. International Journal of Molecular Medicine, 30, 974-978. https://doi.org/10.3892/ijmm.2012.1057
MLA
Koo, J., Rhee, K., Koh, H., Jang, H., Park, B., Park, J."Guggulsterone inhibits melanogenesis in B16 murine melanoma cells by downregulating tyrosinase expression". International Journal of Molecular Medicine 30.4 (2012): 974-978.
Chicago
Koo, J., Rhee, K., Koh, H., Jang, H., Park, B., Park, J."Guggulsterone inhibits melanogenesis in B16 murine melanoma cells by downregulating tyrosinase expression". International Journal of Molecular Medicine 30, no. 4 (2012): 974-978. https://doi.org/10.3892/ijmm.2012.1057
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team