Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
January 2013 Volume 31 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January 2013 Volume 31 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Molecular cloning, characterization and differential expression of DRK1 in Sporothrix schenckii

  • Authors:
    • Binbin Hou
    • Zhenying Zhang
    • Fangliang Zheng
    • Xiaoming Liu
  • View Affiliations / Copyright

    Affiliations: Department of Dermatology, The First Affiliated Hospital of Dalian Medical University, Dalian, Liaoning 116011, P.R. China, Key Laboratory of Animal Resource and Epidemic Disease Prevention, Life Science School of Liaoning University, Shenyang, Liaoning 110036, P.R. China
  • Pages: 99-104
    |
    Published online on: November 22, 2012
       https://doi.org/10.3892/ijmm.2012.1193
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The dimorphism of Sporothrix schenckii (S. schenckii) reflects a developmental switch in morphology and lifestyle that is necessary for virulence. DRK1, a hybrid histidine kinase, functions as a global regulator of dimorphism and virulence in Blastomyces dermatitidis (B. dermatitidis) and Histoplasma capsulatum (H. capsulatum). The partial cDNA sequence of DRK1 of S. schenckii, designated SsDRK1, was obtained using degenerate primers based on the conserved domain of the DRK1 of other fungi. The complete cDNA sequence of SsDRK1 was obtained by 5' and 3' RACE. The full-length cDNA is 4743 bp in size and has an open reading frame (ORF) of 4071 bp, encoding 1356 amino acid residues. The predicted molecular mass of SsDRK1 is 147.3 kDa with an estimated theoretical isoelectric point of 5.46. The deduced amino acid sequence of SsDRK1 shows 65% identity to that of B. dermatitidis. The SsDRK1 was predicted to be a soluble histidine kinase and to contain three parts: sensor domain, linker domain and functional domain. Quantitative real-time RT-PCR revealed that SsDRK1 was more highly expressed in the yeast stage compared with that in the mycelial stage, which indicated that the SsDRK1 may be involved in the dimorphic switch in S. schenckii.

Introduction

The dimorphic fungus Sporothrix schenckii (S. schenckii) is the etiological agent of sporotrichosis, an important cutaneous mycosis with a worldwide distribution (1). S. schenckii grows at room temperature (25°C) as a mold phase, while in vitro incubation of mold cultures at body temperature (37°C) results in the production of yeast cells (2). These in vitro forms are virtually identical to the yeast cells of S. schenckii found in diseased tissue. Therefore, the formation of yeast cells was thought to be a requisite for the pathogenicity of S. schenckii. The mechanisms that regulate the dimorphic switch, however, remain unclear.

The mitogen-activated protein kinase (MAPK) cascade and cyclic AMP (cAMP) signaling pathways are known to be involved in fungal morphogenesis and pathogenic development. However, the MAPK and cAMP pathways are both activated by an upstream branch, two-component histidine kinase phospho-relay system. Nemecek et al (3) recently uncovered a long-sought regulator that controls the switch from a non-pathogenic mold form to a pathogenic yeast form in dimorphic fungi. They found that DRK1, a hybrid dimorphism-regulating histidine kinase, functions as a global regulator of dimorphism and virulence in Blastomyces dermatitidis (B. dermatitidis) and Histoplasma capsulatum (H. capsulatum). DRK1 is required for phase transition from mold to yeast, expression of virulence genes, and pathogenicity in vivo. Disruption of DRK1 locks B. dermatitidis in the mold form at temperatures (37°C) that normally trigger phase transition to yeast. RNA silencing of DRK1 expression in B. dermatitidis results in impaired BAD1 expression, severe alterations in the cell wall, and reduction in transcription of α-(1,3)-glucan synthase and the yeast-phase specific gene BYS1. In H. capsulatum, DRK1 also regulates expression of the yeast-phase specific genes CBP1, AGS1 and yps-3. We previously reported differentially expressed genes between the mycelial and the yeast phases of S. schenckii using 2DE. The expressed sequence tag of spotC homologous to the DRK1 histidine kinase from B. dermatitidis clearly increases in the yeast form of S. schenckii (4).

We describe the molecular cloning of the DRK1 gene from the yeast-form S. schenckii, designated SsDRK1. We performed necessary function analysis of the SsDRK1 gene as well as detection of the differential gene expression in the dimorphic switch of S. schenckii. These findings establish the primary foundation of understanding the function of SsDRK1. The cloning and characterization of the DRK1 gene in S. schenckii is reported for the first time.

Materials and methods

Fungal strain, media and growth conditions

The strain of S. schenckii used, ATCC10268, was maintained at the Research Center for Pathogenic Fungi, Dalian Medical University, China. To obtain a mycelial culture, the ATCC10268 isolate was inoculated on Sabouraud dextrose agar (SDA) medium and incubated at 25°C. The mycelial colonies thus obtained were inoculated in Sabouraud’s fluid medium and cultured with shaking at 100 rpm at 25°C for 72 h. To achieve the switch of S. schenckii from the mycelial to the yeast phase, mycelial colonies were transferred to brain heart infusion (BHI) liquid medium at 37°C and shaken at 100 rpm for 96 h. Mycelial and yeast pellets were collected by centrifugation and stored at −80°C immediately, or processed for total RNA isolation directly.

Total RNA, genomic DNA isolation and gene cloning

Approximately 100 mg samples of S. schenckii mycelia and yeast were separately pulverized under liquid nitrogen with a mortar and pestle. Total RNA isolation was carried out according to the manufacturer’s protocol using the Trizol Reagent kit (Invitrogen, Carlsbad, CA, USA) and treated with the RNase-free DNase I kit from Takara Bio, Inc. (Tokyo, Japan) to eliminate DNA contamination. Genomic DNA was isolated from yeast phase colonies following the manufacturer’s protocol using the InstaGene™ Matrix kit (Bio-Rad, Hercules, CA, USA). cDNA was synthesized from 500 μg of total RNA of ATCC10268 by murine leukemia virus reverse transcriptase (MLV-RT) (Takara Bio, Inc.) primed with oligo(dT) following the manufacturer’s instructions, and used as template for PCR. Degenerate primers, SsDRK1-F1 and SsDRK1-R1, were designed based on multiple alignments of the high conserved DRK1 domains of Coccidioides immitis (C. immitis) (EAS33695.2), Paracoccidioides brasiliensis (P. brasiliensis) (EEH34763.1), B. dermatitidis (EGE84246.1) and H. capsulatus H88 (EGC45940.1) amino acid sequences. PCR product of expected size was cloned into pMD18 vector (Takara Bio, Inc.) and sequenced. The degenerate primers yielded two fragments, with the length of 161 and 160 bp, respectively. Primers HBB-F and HBB-R were designed to amplify the cDNA sequence between the above two fragments. To obtain the full-length cDNA sequence of the SsDRK1 gene, 5′-RACE and 3′-RACE were performed with 5′-Full RACE kit and 3′-Full RACE Core Set Ver.2.0 kit (Takara Bio, Inc.) according to the manufacturer′s instructions. Nest-PCR was performed. Briefly, five specific primers CTE869-F and CTE869-R of 3′-RACE and R132-1, R132-2 and R132-3 of 5′-RACE were synthesized based on the cDNA sequence obtained by the degenerate primers. PCR products of 5′- and 3′-RACE were both cloned into pMD18 vector (Takara Bio, Inc.) and sequenced.

To determine the nucleotide sequence of the genomic DNA corresponding to the SsDRK1, PCR was performed using the primers SsDRK1-P1 and SsDRK1-B3 and genomic DNA as template. The PCR products were then sequenced. The sequences of all the primers used in this study are listed in Table I.

Table I

Sequence of primers in this study.

Table I

Sequence of primers in this study.

PrimerSequence (5′-3′)
DRK1-F1 ACNGANAAYGTVAAYACYATGGC
DRK1-R1 CGRTCMACCATRTBRTTGATNGT
HBB-F TCACCAAAAAGATTGAGCGTCC
HBB-R TGTCACCGTTGGCGATGGCTT
CTE869-F GGCAACGCCATCAAGTTCACC
CTE869-R GCTCGCGCTCACGGTTTTTTTCGAGC
R132-1 (GSP1) ATTCCCTTCACGCCCT
R132-2 (GSP2) TGGTTTGTTGCAGTTGCAGGAT
R132-3 (GSP3) TGAGATCACCGAACGCGACAGC
P1 ATGACCGTTGTACCGACGAC
B3 ATGTGAGGGCCTCTCTTAGC
8F GAATCTGCACGGTATTCTGA
58R CTCAACCTCCACATCCTCAA
24T FAM-CGTCGAGTCTGGTTACTAC-TAMRA

[i] Degenerate primers designed based on multiple alignments of the high conserved DRK1 domains for gene cloning: DRK1-F1 and SsDRK1-R1. Primers designed to amplify the cDNA sequence: HBB-F and HBB-R. Primers of 3′-RACE: CTE869-F3, CTE869-F4, 5′-RACE: R132-1, R132-2 and R132-3. To determine the nucleotide sequence of the genomic DNA corresponding to the SsDRK1, PCR was performed using the primers P1 and B3. Primers and a TaqMan probe of real-time RT-PCR: 8F, 58R and 24T.

Bioinformatics and phylogenetic analysis of SsDRK1

Nucleotide sequences and deduced amino acid sequences of the cloned SsDRK1 gene were analyzed. The nucleotide sequences were analyzed using Sequencer software (Sequencer, USA) and BLAST Network service of the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov/blast). The open reading frame (ORF) was found by the ORF finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). For the exact localization of the exon/intron boundaries the mRNA-to-genomic alignment program Spidey (http://www.ncbi.nlm.nih.gov/IEB/Research/Ostell/Spidey/index.html) was used. The deduced amino acid sequence was analyzed with the Expert Protein Analysis System (http://www.expasy.org/) and the protein domain features of SsDRK1 were determined by using Simple Modular Architecture Research Tool (http://hits.isb-sib.ch/cgi-bin/PFSCAN). Isoelectric point and molecular weight prediction were carried out at (http://cn.expasy.org/tools/pi_tool.html). Multiple alignments of SsDRK1 were performed with the ClustalW Multiple Alignment Program (http://www.ebi.ac.uk/clustalw/).

Differential expression of SsDRK1 in two stages during dimorphic switch

The expression of SsDRK1 transcript in different stages (mycelial, yeast) was measured by real-time RT-PCR. Primers and a TaqMan probe for target genes were designed with primer select in DNASTAR software (Lasergene) and are listed in Table I (24T, 8F, 58R). Fifty nanograms of total RNA were assayed from two stages of S. schenckii in triplicate using the PrimeScript RT-PCR kit (Takara Bio, Inc.). The minus-reverse transcriptase control was also performed in triplicate. The amplification conditions were optimized for the ABI PRISM-7500 instrument (Applied Biosystems). The cycling conditions using TaqMan probe detection were 95°C for 2 min followed by 40 cycles at 95°C for 10 sec, 61°C for 10 sec, 72°C for 40 sec. 18srDNA was selected as the endogenous control. Relative quantification of target gene expression was evaluated using the comparative cycle threshold (CT) method as previously described by Livak and Schmittgen (5). The ΔCT value was determined by subtracting the target CT of each sample from its respective 18srDNA CT value. Calculation of ΔΔCT involved using the mycelial sample ΔCT value as an arbitrary constant to subtract from yeast sample ΔCT values. Differences in expression of target genes were determined by 2−ΔΔCT. Data are expressed as arithmetic means ± SD unless otherwise indicated. Comparison between mycelial and yeast samples was performed using the Student’s t-test. Differences with a P-value of <0.05 were considered to be statistically significant.

Results

Cloning and genomic structure of SsDRK1

First, 828 bp cDNA fragment which had a high sequence similarity to the DRK1 of P. brasiliensis Pb01 was obtained from the total RNA of ATCC10268. Following RACE PCR, a full-length SsDRK1 cDNA 4743 including an ORF of 4071 bp, encoding 1356 amino residues, was flanked by a 31 bp 5′-untranslated region (5′-UTR) and a 641 bp 3′-UTR. The most probable CAAT box is located at -2, which is critical for eukaryotic transcription initiation (6). As in other PKC genes, no TATA box was identified within this sequence (7). Sequencing results showed that there is a poly (A) tails in 3′-UTR. The SsDRK1 genomic DNA is 4065 bp in length. The aligned results revealed that there are no introns between the sequences of the genomic DNA and the cDNA. Based on the sequence of cDNA, the molecular weight of the predicted amino acid is approximately 147.3 kDa, the theoretical pI is 5.46. Suggested models for transmembrane topology indicated that the amino acid sequence may be a soluble histidine kinase that lacks transmembrane segments. Fig. 1 shows that SsDRK1 contains three parts: sensor domain, linker domain and functional domain. The PAS and GAF domains, two structural families of cytoplasmic sensor domains, are found at positions 12–83 and 33–212 in the amino acid sequence. HAMP, which is an approximately 50-amino acid α-helical region, begins at position 231 in the linker domain part. It has been suggested that the HAMP domain possesses a role of regulating the phosphorylation of homodimeric receptors by transmitting the conformational changes in periplasmic ligand-binding domains to cytoplasmic signaling kinase domains. The functional domain of SsDRK1 is predicted to have the necessary elements for histidine kinase function, including the histidine-containing H-box and aspartate containing D-box involved in phosphorelay. The sequence also contains the N-and G-boxes used in ATP-binding and catalytic function, and an aspartate-containing receiver domain (Fig. 4). SsDRK1 is homologous to the hybrid histidine kinase SLN1 in Saccharomyces cerevisiae (S. cerevisiae), DRK1 in B. dermatitidis and to sequences in the genomes of H. capsulatum and C. immitis, dimorphic fungi for which extensive genome sequence is available.

Figure 1

SsDRK1 domain organization: a schematic showing sensor, linker and functional domain organization, GAF and PAS motif located in the sensor domain, 6 HAMP are found at positions 231–746 in the linker domain, HisKA, HATPase and REC motif in context with H-, D-, G- and N-boxes were all identified in the functional domain.

Figure 4

SsDRK1 has the domain structure and sequence of histidine kinase and is conserved in dimorphic fungi. SsDRK1 has a histidine-containing H-box, an aspartate-containing D-box, and G- and N-boxes (7). Sequences homologous to the S. cerevisiae (Sc) histidine kinase SLN1 and B. dermatitidis (Bd) histidine kinase are present in other dimorphic fungi H. capsulatum (Hc) and C. immitis (Ci).

Homology and phylogenetic analysis of SsDRK1

Multi-alignment analysis by ClustalW indicated that SsDRK1 has a high identity to DRK1 reported in other species, sharing a similarity of 66% identity to P. brasiliensis (EEH34763.1), 65% identity to B. dermatitidis (EGE84246.1), 65% identity to C. immitis (EAS33695.2), 67% identity to H. capsulatus (EGC45940.1) (Fig. 2). Based on the results of the alignment of DRK1 sequences of the former and some common fungi, the phylogenetic trees were constructed using the ClustalW software (Fig. 3). Three groups were clearly generated in the phylogenetic tree. The SsDRK1 identified in this study appeared most closely related to sequences from Neurospora crassa (N. crassa), a member of the ascomycetous class pyrenomycetes. The results also suggested that the evolutionary relationship of SsDRK1 might be different from that in Candida albicans (C. albicans).

Figure 2

Multiple sequence alignment of SsDRK1 to other fungal HK homologs. Amino acid sequence alignment of SsDRK1 with other HK homologs is shown. The amino acid sequence of Ajellomyces capsulatus (Histoplasma capsulatus), Ajellomyces dermatitidis (Blastomycosis dermatitidis), Paracoccidioides brasiliensis and Coccidioides immitis were aligned using the online version of ClustalW. Shade residues indicate ≥75% homology (black) or ≥50% homology (gray).

Figure 3

Phylogenetic relationship among DRK1 homologs. An NJ tree was generated by MEGA version 5.05 with bootstrap analysis based on 500 replications. Percentage bootstrap values are shown at branch points. Scale bar indicates the number of substitutions per site.

Expression of SsDRK1 in two stages of Sporothrix schenckii

The mRNA expression of SsDRK1 in different stages was analyzed by real-time RT-PCR normalized against 18SrDNA levels. Following amplification, Ct, ΔCt and ΔΔCt values were calculated. Expression was determined as fold increased 2−ΔΔCt levels relative to the stage with lowest expression (mycelia) set to 1. The SsDRK1 gene was expressed in two stages of S. schenckii, with higher mRNA levels observed in yeast (24.42-fold). There were significant differences between the mycelial and the yeast form (Table II).

Table II

Relative abundance of differential expression gene as determined by real-time RT/PCR (mean ± SD) (P<0.01).

Table II

Relative abundance of differential expression gene as determined by real-time RT/PCR (mean ± SD) (P<0.01).

cDNA namePhaseTarget CT18srDNA CTΔCT ΔΔCT 2−ΔΔCT
DRK1 histidine kinaseMycelial27.08±0.5220.66±0.276.42±0.6801
Yeast23.90±0.2622.09±0.641.81±0.87−4.61±0.2324.42

[i] ΔCT=target transcript CT-18srDNA CT normalization of CT for target gene relative to 18srDNA CT. Statistical analysis of normalized expression levels between mycelial and yeast form. Each of the target genes differs significantly (U-test, P<0.05). ΔΔCT=mean yeast ΔCT–mean mycelial ΔCT. The mean value for the mycelial ΔCT was used as a calibrator to set the baseline for comparing mean differences in the ΔCT values of the yeast form. 2-ΔΔCT, normalized target amount relative to the mycelial form.

Accession number

The full length of cDNA sequence and genomic DNA sequence of the SsDRK1 gene were submitted to the GenBank database under the accession number JX312331 and JX416706, respectively.

Discussion

Histidine protein kinases (HPKs) are a large family signal-transduction enzymes that autophosphorylate on a conserved histidine residue. HPKs form two-component signaling systems together with their downstream target proteins, the response regulators, which have a conserved aspartate in a ‘receiver domain’ that is phosphorylated by the HPK. The dimorphism regulating kinase DRK1 was recently proved to mediate the thermally induced transition to the pathogenic yeast-phase program in both B. dermatitidis and H. capsulatum (3). In this study, based on the conserved structures of the DRK1 in four types of fungi cells, the degenerate primers were designed to obtain the homologs of DRK1 in S. schenckii. The production of PCR has a very high identity to the DRK1 of P. brasiliensis Pb01. The ORF of SsDRK1 encoded protein was mostly similar in identity to the DRK1 of N. crassa, similar with previous molecular phylogenetic analyses both on a pertussis toxin-sensitive G protein α subunit (8) and three chitin synthase genes (9). Aligned to the other fungal DRK1, the identities were 64 to 74%. However, SsDRK1 shares limited sequence similarity with histidine kinases that regulate filamentation in the more distantly related fungus C. albicans.

The amino sequence of SsDRK1 is predicted to have the necessary elements for histidine kinase function including H-box, D-box, N- and G-boxes. This indicates that the SsDRK1 has similar functions to other fungi histidine kinases. The typical HPK is a transmembrane receptor with an aminoterminal extracellular sensing domain and a carboxy-terminal cytosolic signaling domain; however, a type of soluble histidine kinase that lacks transmembrane segments was also identified. The cytoplasmic sensor domain including GAF, PAS and PCD may reside N-terminal to the C-terminal transmitter domain in the soluble histidine kinase (10). SsDRK1 in the present study was proved to be lacking transmembrane segments and carrying GAF and PAS domains in the sensor part, which suggested that SsDRK1 is a soluble histidine kinase.

Histidine kinase two component signaling systems have recently been shown to play the role in environmental sensing and all development in eukaryotes. In C. albicans, they regulate filamentation whereas in B. dermatitidis and H. capsulatum, they may control phase transition and virulence gene expression as well as cell development and sporulation in the other systemic dimorphic fungi. Does SsDRK1 have the same functions during the process of dimorphic switch in S. schenckii? In this study, the mRNA expression of SsDRK1 in yeast cells was higher than in mycelial cells, which suggested that SsDRK1 is involved in regulating phase transition.

What is the environmental signal that SsDRK1 senses to regulate phase transition and virulence gene expression? In S. cerevisiae (11), histidine kinase Sln1p detects osmotic stress, whereas in Schizosaccharomyces pombe (12), the histidine kinase-regulated SPC1 MAPK cascade senses osmotic, oxidative, heat stress and nutrient deprivation. Potential signals for histidine kinase sensing in dimorphic fungi include temperature, osmotic or oxidative stress, nutrient deprivation, redox potential, and host-derived factors including hormones such as 17-β-estradiol, which induces germ tubes in C. albicans (13) and block mold-to-yeast transition of P. brasiliensis (14). In this study, the mycelial cells of S. schenckii switched to yeast cells when they were incubated in BHI liquid medium at 37°C, which suggests SsDRK1 can detect the change of temperature and nutrient deprivation in the environment.

The detailed functions of the SsDRK1 and its up- and down-stream proteins as well as their interactions require further investigation. If the formation mechanism of the yeast cells (the parasitic form) of S. schenckii is elucidated, this may lead to a therapy strategy for sporotrichosis.

Acknowledgements

This study was partly supported by a grant from the National Natural Science Foundation of China (grant no. 81000069). The authors thank Zhang Zhenying and Yu Zhen for their assistance with image and statistical analysis.

References

1 

Travassos LR and Lloyd KO: Sporothrix schenckii and related species of Ceratocystis. Microbiol Rev. 44:683–721. 1980.

2 

Guarro J, Gené J and Stchigel AM: Developments in fungal taxonomy. Clin Microbiol Rev. 12:454–500. 1999.

3 

Nemecek JC, Wuthrich M and Klein BS: Global control of dimorphism and virulence in fungi. Science. 312:583–588. 2006. View Article : Google Scholar : PubMed/NCBI

4 

Zhang ZY, Hou BB, Xin Y and Liu XM: Protein profiling of the dimorphic pathogenic fungus, Sporothrix schenckii. Mycopathologia. 173:1–11. 2012. View Article : Google Scholar

5 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

6 

Feng P, Xie Z, Sun J, Zhang J, Li X, Lu C and Xi L: Molecular cloning, characterization and expression of PmRsr1, a Ras-related gene from yeast form of Penicillium marneffei. Mol Biol Rep. 37:3533–3540. 2010. View Article : Google Scholar : PubMed/NCBI

7 

Aquino-Piñero E and Rodríguez-del Valle N: Characterization of a protein kinase C gene in Sporothrix schenckii and its expression during the yeast-to-mycelium transition. Med Mycol. 40:185–199. 2002.PubMed/NCBI

8 

Delgado N and Rodríguez-del VN: Presence of a pertussis toxin-sensitive G protein alpha subunit in Sporothrix schenckii. Med Mycol. 38:109–121. 2000. View Article : Google Scholar : PubMed/NCBI

9 

Chua SS, Momany M, Mendoza L and Szaniszlo PJ: Identification of three chitin synthase genes in the dimorphic fungal pathogen Sporothrix schenckii. Curr Microbiol. 29:151–156. 1994. View Article : Google Scholar : PubMed/NCBI

10 

Kimura S, Shiraiwa Y and Suzuki I: Function of the N-terminal region of the phosphate-sensing histidine kinase, SphS, in Synechocystis sp PCC 6803. Microbiology. 155:2256–2564. 2009. View Article : Google Scholar : PubMed/NCBI

11 

Van Wuytswinkel O, Reiser V, Siderius M, Kelders MC, Ammerer G, Ruis H and Mager WH: Response of Saccharomyces cerevisiae to severe osmotic stress: evidence for a novel activation mechanism of the HOG MAP kinase pathway. Mol Microbiol. 37:382–397. 2000.

12 

Pöhlmann J and Fleig U: Asp1, a conserved 1/3 inositol polyphosphate kinase, regulates the dimorphic switch in Schizosaccharomyces pombe. Mol Cell Biol. 30:4535–4547. 2010.PubMed/NCBI

13 

Cheng G, Yeater KM and Hoyer LL: Cellular and molecular biology of Candida albicans estrogen response. Eukaryot Cell. 5:180–191. 2006.

14 

Salazar ME, Restrepo A and Stevens DA: Inhibition by estrogens of conidium-to-yeast conversion in the fungus Paracoccidioides brasiliensis. Infect Immun. 56:711–713. 1988.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Hou B, Zhang Z, Zheng F and Liu X: Molecular cloning, characterization and differential expression of DRK1 in Sporothrix schenckii . Int J Mol Med 31: 99-104, 2013.
APA
Hou, B., Zhang, Z., Zheng, F., & Liu, X. (2013). Molecular cloning, characterization and differential expression of DRK1 in Sporothrix schenckii . International Journal of Molecular Medicine, 31, 99-104. https://doi.org/10.3892/ijmm.2012.1193
MLA
Hou, B., Zhang, Z., Zheng, F., Liu, X."Molecular cloning, characterization and differential expression of DRK1 in Sporothrix schenckii ". International Journal of Molecular Medicine 31.1 (2013): 99-104.
Chicago
Hou, B., Zhang, Z., Zheng, F., Liu, X."Molecular cloning, characterization and differential expression of DRK1 in Sporothrix schenckii ". International Journal of Molecular Medicine 31, no. 1 (2013): 99-104. https://doi.org/10.3892/ijmm.2012.1193
Copy and paste a formatted citation
x
Spandidos Publications style
Hou B, Zhang Z, Zheng F and Liu X: Molecular cloning, characterization and differential expression of DRK1 in Sporothrix schenckii . Int J Mol Med 31: 99-104, 2013.
APA
Hou, B., Zhang, Z., Zheng, F., & Liu, X. (2013). Molecular cloning, characterization and differential expression of DRK1 in Sporothrix schenckii . International Journal of Molecular Medicine, 31, 99-104. https://doi.org/10.3892/ijmm.2012.1193
MLA
Hou, B., Zhang, Z., Zheng, F., Liu, X."Molecular cloning, characterization and differential expression of DRK1 in Sporothrix schenckii ". International Journal of Molecular Medicine 31.1 (2013): 99-104.
Chicago
Hou, B., Zhang, Z., Zheng, F., Liu, X."Molecular cloning, characterization and differential expression of DRK1 in Sporothrix schenckii ". International Journal of Molecular Medicine 31, no. 1 (2013): 99-104. https://doi.org/10.3892/ijmm.2012.1193
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team