Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
February 2013 Volume 31 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February 2013 Volume 31 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

A novel dual oxidase maturation factor 2 gene mutation for congenital hypothyroidism

  • Authors:
    • Ru-Hai Yi
    • Wen-Bin Zhu
    • Li-Yong Yang
    • Lan Lan
    • Yao Chen
    • Jin-Fu Zhou
    • Jing Wang
    • Yue-Qing Su
  • View Affiliations / Copyright

    Affiliations: Department of Endocrinology and Metabolism, The First Affiliated Hospital, Fujian Medical University, Fuzhou, Fujian 350001, P.R. China, Center of Neonatal Screening, Fujian Maternity and Child Health Care Hospital, Fuzhou, Fujian 350001, P.R. China, Bloodletting Room, Fujian Maternity and Child Health Care Hospital, Fuzhou, Fujian 350001, P.R. China
  • Pages: 467-470
    |
    Published online on: December 24, 2012
       https://doi.org/10.3892/ijmm.2012.1223
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Congenital hypothyroidism (CH) is caused by thyroid hormone deficiency present at birth. DUOXA2 (dual oxidase maturation factor 2) is one of the prerequisites for thyroid hormone synthesis. The present study explored the novel mutations of DUOXA2 in CH patients. Genomic DNA was extracted from peripheral blood of 47 unrelated CH patients, their family members and 100 healthy controls. All 6 exons and their flanking sequences of the DUOXA2 gene were PCR amplified and sequenced. Sequencing results were compared with the standard. Compound heterozygosity with DUOXA2 gene mutations at c.413-414insA (Y138X) and c.738C>G (Y246X) was identified in one patient, and absent in 100 healthy controls. Among them, the c.413‑414insA (Y138X) mutation was a novel one. The patient with the c.413-414insA (Y138X) mutation had mild CH symptoms. This study is the first to report a novel c.413-414insA (Y138X) mutation for CH, thereby expanding the mutational spectrum of the DUOXA2 gene.

Introduction

Congenital hypothyroidism (CH), also known as cretinism, is a disease caused by thyroid hormone deficiency present at birth (1). CH can lead to delayed growth and development and mental retardation; 85% of CH cases are secondary to thyroid developmental abnormalities such as athyreosis, hypoplastic or ectopic gland, and the remaining 15% of CH cases are due to genetic defects of thyroid hormone synthesis within a structurally normal gland (1). Although the molecular mechanisms of thyroid gland development and thyroid hormone synthesis and function have been studied extensively, the genetic pathogenesis remains relatively unclear (2).

A key step in thyroid hormone biosynthesis is iodine organification, which can only be successfully accomplished in the presence of H2O2. In thyroid follicular cells, Duox2 proteins are glycosylated and bound in the follicular cavity at the apical membrane, catalyzing the formation of H2O2, which is involved in the key step in thyroid hormone synthesis - iodine organification (3). Therefore, the normal functioning of Duox2 is one of the prerequisites for thyroid hormone synthesis. Several studies have suggested that mutations in the Duox2 gene can lead to CH (4–9).

DUOXA2, a DUOX maturation factor, plays an important role in Duox2 maturation and activation, thus determining the normal functionality of Duox2 (10). Genetic defects in DUOXA2 lead to defects in DUOX2 protein expression, which in turn lead to CH (11). Thus, DUOXA2 is an important entry point for molecular genetic studies of CH. This study explored the novel mutations of DUOXA2 in CH patients

Materials and methods

Ethics statement

Approval was obtained from the local Ethics Committee. All participants provided written informed consent prior to enrollment in the study.

Patients

All 47 CH cases were first screened at the Fujian Neonatal Disease Screening Center between 1998 and 2011. The patients, 27 males and 20 females, were diagnosed and followed up by the Neonatal Department, Maternal and Child Health Hospital of Fujian Province. Thyroid agenesis, hypoplasia, or ectopic thyroid abnormalities were excluded in all objects through ECT or ultrasound. As controls, 100 unrelated healthy controls were enrolled in this study in the First Affiliated Hospital of Fujian Medical University.

Genomic DNA extraction

Venous blood (2 ml) was obtained from the 47 CH patients, their parents, siblings (if any), and unrelated healthy controls. Sodium citrate was added as anticoagulant. Genomic DNA (30–80 ng/μl) was extracted according to the manufacturer’s instruction (Tiangen Biotech Co.) and stored at −20°C.

Primer design and PCR

All primers were designed to the flanking intron regions of the exons (1). The primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd. The primer sequences and the length of the PCR products are shown in Table I. The PCR reaction volume was 50 μl, containing 2 μl DNA template; 2 μl upstream and downstream primers (10 μmol/μl), respectively; 4 μl of dNTP (2.5 mmol /l); 5 μl buffer solution; 1U Ex Taq DNA polymerase (Takara Bio Co.). The reaction conditions were: 95°C 5 min, 95°C 30 sec, 55°C 30 sec, 72°C 30 sec, 32 cycles; extension at 72°C for 5 min. The PCR products were run on 1.5% agarose gel, visualized by goldview, and analyzed by UV analyzer.

Table I.

PCR primers and annealing temperatures for 6 exons of the DUOXA2 gene.

Table I.

PCR primers and annealing temperatures for 6 exons of the DUOXA2 gene.

ExonPrimer (5′-3′)Product length (bp)Annealing temp (°C)
1F: CAGCCTTGTACGCAAAGAGA
R: CCCCACTCTACCTGCACTA
28957
2F: GTCTTGGGGACTCTGGTTT
R: ACCCCAGTTCCCTATTGTCC
20156
3F: CAGTGTCCCACCTCCCATA
R: CTCACCTAACCGGGGATCT
27257
4F: TTCCTGTCTGAATCCGCTTA
R: CATCCTCCCGCTCATACG
35658
5F: GGGGTAGGGATAAAGAAGAGC
R: AATCCTGTCTCCACCCTTAGC
35156
6F: GTTTGAGGCCAGAGTTCGAG
R: GGGGAAGGAGTCCAGATTG
29556

[i] F, forward; R, reverse.

PCR amplification

All exons of the DUOXA2 gene were amplified in patients first. If an exon mutation was identified in a patient, the target fragment was also amplified in the family members and in the 100 normal healthy controls.

Sequencing

PCR products were sent to Shanghai Sangon Biotechnology Co., Ltd., for sequencing using forward and reverse primers by ABl3700 automatic sequence analyzer. The sequencing primers used were the same as the PCR primers. For samples with suspected mutations, amplification and sequencing were repeated three times. If the results were consistent, the mutation was considered real, otherwise it was considered as experimental error.

Statistical analysis

The statistical χ2 test was used and P<0.05 was considered to indicate statistically significant differences.

Results

PCR products of 6 exons ran as bright single bands as visualized by UV analyzers after 1.5% agarose gel electrophoresis (Fig. 1). These 6 exon sequences were compared with GenBank DUOXA2 standard sequence (Gene ID, 405 753) using the NCBI BLAST program. The simultaneous presence of two mutations in the DUOXA2 gene in one CH child was identified in this study, a compound heterozygous mutation. The parents of the child were the carriers of the mutated gene (Fig. 2) and no corresponding mutations were found in the 100 normal controls, consistent with the recessive genetic law. The two mutations are an insertion of A base between 413 and 414 bp on the 4th exon (Fig. 3), and a C→G substitution on the 5th exon of 738 bp (p.Y246X). Aside from the C→G substitution on the 5th exon of 738 bp, a C→T substitution was found in 4 patients and in 11 healthy controls, with a frequency of 4/47 (8.5‰) and 11/100 (11‰), respectively, which was not significantly different (P>0.05). This substitution did not cause amino acid change (Fig. 4). In addition, 3 patients and their family members and 9 normal controls had a C→G substitution on the 3rd exon of 278 bp (Fig. 5), which is an SNP locus. The mutation frequency of this locus is 3/47 (6.5‰) in patients and 9/100 (9‰) in healthy controls, without significant difference between these two groups.

Figure 1.

Agarose gel electrophoresis of target fragments of 6 exons in the DUOXA2 gene amplified by PCR. M, marker; lanes 1–6 are the PCR amplification products of 1–6 exons.

Figure 2.

Genotypes of the patient and the parents.

Figure 3.

Two mutations are an insertion of A base between 413 and 414 bp on the 4th exon. (A) A heterozygous insertion of A base on the 4th exon of 413–414 bp in the patient. (B) Normal control.

Figure 4.

Heterozygous C→G mutation or C→T mutation. (A) A heterozygous C→G mutation on the 5th exon of 738 bp in the patient; arrow indicates the mutation site. (B) A heterozygous C→T mutation in 4 patients and in 11 healthy controls; arrow indicates the mutation site. (C) Normal control.

Figure 5.

Homozygous C→G mutation. (A) Homozygous C→G mutation on the 3rd exon of 278 bp in 3 patients and their family members and in 9 healthy controls. (B) Normal control.

The CH patient, of Han ethnicity, with this novel DUOXA2 gene mutation was born in March 2010 at the Maternal and Child Health Hospital in Fujian Province. The parents were not diagnosed with any thyroid-related diseases. Following the initial screening of newborn diseases after birth, the child was brought to the hospital regularly for thyroid function tests and was diagnosed. This patient with the c.413–414insA (Y138X) mutation had mild CH symptoms.

Discussion

CH is one of the most common endocrine diseases in pediatrics. CH is caused by abnormal development due to various reasons such as athyreosis, hypoplastic or ectopic gland, and defects in thyroid hormone synthesis during embryonic development. This disease can lead to mental retardation and short stature, commonly known as cretinism. The average annual incidence rate of the disease is 1/1750–1/4000, making it the most common congenital metabolic abnormality (12,13).

In CH cases, approximately 15% are due to genetic defects of thyroid hormone synthesis, most of which are caused by iodine organification defects. The successful iodine organification requires the presence of H2O2, which is produced by NADPH oxidase. Duox2 is essential for the catalytic activity of NADPH oxidase (3). Thus, abnormal Duox2 function leads to the failure of iodine organification in the thyroid, affecting the synthesis of thyroid hormones, eventually resulting in reduced thyroid function.

Two genes were cloned and named DUOX maturation factors (DUOXA1 and DUOXA2) in Chicago in 2006. The DUOXA2 gene is located on chromosome 15 and consists of 6 exons, encoding a 320 amino acid long transmembrane protein. DUOXA2 is mainly expressed in the thyroid and is weakly expressed in the epithelium of the digestive tract. DUOXA2 plays an important role in the process of Duox2 protein migration from the endoplasmic reticulum to the Golgi apparatus, in the maturation and transition to the apical membrane. As the DUOXA2 gene determines the normal functionality of Duox2, it is used as an important starting point for the molecular genetic study of CH (10).

In the present study, the 6 exons and their flanking regions of the DUOXA2 gene were subjected to sequence analysis. This is the first time that heterozygous mutations were found to occur simultaneously on the 4th and 5th exons. There was a heterozygous insertion of an A base between 413–414 bp on the 4th exon, generating a premature TAA stop codon and resulting in the early termination of protein translation. The C→G mutation on the 5th exon at 738 bp leads to the generation of a premature stop codon (TAG). Screening of the 4th and 5th exons in the patient’s parents and in the 100 healthy controls revealed that the patient’s father is the carrier of the 413–414 bp insertion and the patient’s mother is the carrier of the 738 bp C→G mutation; these two mutations were not found in the normal controls. This pattern is in line with the recessive inheritance law, thus we consider that this compound heterozygous mutation is the cause of the disease in this patient. The insertion mutation on the 4th exon of 413–414 bp was not found in the NCBI SNP database, therefore this is a novel finding. Our finding expands the mutation spectrum of the DUOXA2 gene.

The mutation on the 5th exon of 738 bp was an SNP locus (rs4774518) found in the NCBI database. It has been indicated that two mutations, the C→G and the C→T mutation, exist in this SNP. Among the 47 patients and the 100 normal controls in this study, we found a C→G heterozygous mutation in one patient only, and it was not found in the 100 healthy controls. The C→T mutation was found in patients and healthy controls, including 4 cases of patients (4/47, 8.5‰) and 11 cases of healthy controls (11/100, 11‰). The difference between the two groups is not statistically significant (P>0.05), consistent with what was reported by Zamproni et al (11). In addition, a C→G homozygous mutation on the 3rd exon of 278 bp in the DUOXA2 gene was found in 3 patients and in 9 healthy controls. It was verified as another SNP (rs2576090) in the NCBI database. Although the mutation led to a CGT→GGT change with a corresponding amino acid change, the present study suggests that the mutation frequency between patients and healthy controls was not statistically different, therefore we do not consider this mutation the cause of CH.

Of note, no mutations were found at the 1st and 2nd exons of the DUOXA2 gene. Only a point mutation was found in the flanking intron regions in 2 patients, indicating that segment of the sequence is relatively stable. Heterozygous or homozygous single nucleotide substitution polymorphisms were found at the 4th and 5th intron regions in 11 patients, at different sites. Whether the polymorphisms affect the RNA transcription process and lead to genetic instability of the DUOXA2 gene requires further study.

In conclusion, the present study reports a novel c.413–414insA (Y138X) mutation for CH, which expands the mutational spectrum of the DUOXA2 gene. The potential function of this novel mutation requires further investigation.

References

1. 

Park SM, Clifton-Bligh RJ, Betts P and Chatterjee VK: Congenital hypothyroidism and apparent athyreosis with compound heterozygosity or compensated hypothyroidism with probable hemizygosity for inactivating mutations of the TSH receptor. Clin Endocrinol (Oxf). 60:220–227. 2004. View Article : Google Scholar

2. 

Targovnik HM, Esperante SA and Rivolta CM: Genetics and phenomics of hypothyroidism and goiter due to thyroglobulin mutations. Mol Cell Endocrinol. 322:44–55. 2010. View Article : Google Scholar : PubMed/NCBI

3. 

Vaisman M, Rosenthal D and Carvalho D: Enzymes involved in thyroid iodide organification. Arq Bras Endocrinol Metabol. 48:9–15. 2004.(In Portuguese).

4. 

Vigone MC, Fugazzola L, Zamproni I, et al: Persistent mild hypothyroidism associated with novel sequence variants of the DUOX2 gene in two siblings. Hum Mutat. 26:3952005. View Article : Google Scholar : PubMed/NCBI

5. 

De Deken X, Wang D, Dumont J, et al: Characterization of ThOX proteins as components of the thyroid H(2)O(2)-generating system. Exp Cell Res. 273:187–196. 2002.PubMed/NCBI

6. 

Moreno JC, Bikker H, Kempers MJ, et al: Inactivating mutations in the gene for thyroid oxidase 2 (THOX2) and congenital hypothyroidism. N Engl J Med. 347:95–102. 2002. View Article : Google Scholar : PubMed/NCBI

7. 

Varela V, Rivolta CM, Esperante SA, et al: Three mutations (p.Q36H, pG418fsX482, and gIVS19-2A>C) in the dual oxidase 2 gene responsible for congenital goiter and iodide organification defect. Clin Chem. 52:182–191. 2006.PubMed/NCBI

8. 

Hoste C, Rigutto S, Van Vliet G, et al: Compound heterozygosity for a novel hemizygous missense mutation and a partial deletion affecting the catalytic core of the H2O2-generating enzyme DUOX2 associated with transient congenital hypothyroidism. Hum Mutat. 31:E1304–E1319. 2010. View Article : Google Scholar : PubMed/NCBI

9. 

Pfarr N, Korsch E, Kaspers S, et al: Congenital hypothyroidism caused by new mutations in the thyroid oxidase 2 (THOX2) gene. Clin Endocrinol (Oxf). 65:810–815. 2006. View Article : Google Scholar : PubMed/NCBI

10. 

Grasberger H and Refetoff S: Identification of the maturation factor for dual oxidase. Evolution of an eukaryotic operon equivalent. J Biol Chem. 281:18269–18272. 2006. View Article : Google Scholar : PubMed/NCBI

11. 

Zamproni I, Grasberger H, Cortinovis F, et al: Biallelic inactivation of the dual oxidase maturation factor 2 (DUOXA2) gene as a novel cause of congenital hypothyroidism. J Clin Endocrinol Metab. 93:605–610. 2008. View Article : Google Scholar : PubMed/NCBI

12. 

Knobel M and Medeiros-Neto G: An outline of inherited disorders of the thyroid hormone generating system. Thyroid. 13:771–802. 2003. View Article : Google Scholar : PubMed/NCBI

13. 

Zhu W, Wang Z, Chen H, et al: Analysis of four-year congenital hypothyroidism neonatal screening in Jiudi City, Fujian Province. Zhong Guo You Sheng You Yu Za Zhi. 12:97–98. 2005.

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yi R, Zhu W, Yang L, Lan L, Chen Y, Zhou J, Wang J and Su Y: A novel dual oxidase maturation factor 2 gene mutation for congenital hypothyroidism. Int J Mol Med 31: 467-470, 2013.
APA
Yi, R., Zhu, W., Yang, L., Lan, L., Chen, Y., Zhou, J. ... Su, Y. (2013). A novel dual oxidase maturation factor 2 gene mutation for congenital hypothyroidism. International Journal of Molecular Medicine, 31, 467-470. https://doi.org/10.3892/ijmm.2012.1223
MLA
Yi, R., Zhu, W., Yang, L., Lan, L., Chen, Y., Zhou, J., Wang, J., Su, Y."A novel dual oxidase maturation factor 2 gene mutation for congenital hypothyroidism". International Journal of Molecular Medicine 31.2 (2013): 467-470.
Chicago
Yi, R., Zhu, W., Yang, L., Lan, L., Chen, Y., Zhou, J., Wang, J., Su, Y."A novel dual oxidase maturation factor 2 gene mutation for congenital hypothyroidism". International Journal of Molecular Medicine 31, no. 2 (2013): 467-470. https://doi.org/10.3892/ijmm.2012.1223
Copy and paste a formatted citation
x
Spandidos Publications style
Yi R, Zhu W, Yang L, Lan L, Chen Y, Zhou J, Wang J and Su Y: A novel dual oxidase maturation factor 2 gene mutation for congenital hypothyroidism. Int J Mol Med 31: 467-470, 2013.
APA
Yi, R., Zhu, W., Yang, L., Lan, L., Chen, Y., Zhou, J. ... Su, Y. (2013). A novel dual oxidase maturation factor 2 gene mutation for congenital hypothyroidism. International Journal of Molecular Medicine, 31, 467-470. https://doi.org/10.3892/ijmm.2012.1223
MLA
Yi, R., Zhu, W., Yang, L., Lan, L., Chen, Y., Zhou, J., Wang, J., Su, Y."A novel dual oxidase maturation factor 2 gene mutation for congenital hypothyroidism". International Journal of Molecular Medicine 31.2 (2013): 467-470.
Chicago
Yi, R., Zhu, W., Yang, L., Lan, L., Chen, Y., Zhou, J., Wang, J., Su, Y."A novel dual oxidase maturation factor 2 gene mutation for congenital hypothyroidism". International Journal of Molecular Medicine 31, no. 2 (2013): 467-470. https://doi.org/10.3892/ijmm.2012.1223
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team