Open Access

Deguelin exerts anticancer activity of human gastric cancer MGC-803 and MKN-45 cells in vitro

  • Authors:
    • Wen Kang
    • Xiao Zheng
    • Ping Wang
    • Shanyu Guo
  • View Affiliations

  • Published online on: March 5, 2018     https://doi.org/10.3892/ijmm.2018.3532
  • Pages: 3157-3166
  • Copyright: © Kang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

During the pathogenesis of gastric cancer, Akt signaling is considered as a pivotal inducer of gastric cancer development. Here we report the identification of anticancer activities of deguelin, a natural agent that inhibits Akt signaling. When applied to MGC-803 and MKN-45 cells, deguelin suppressed the proliferation and arrested cell cycle by p21-mediated inhibition of cyclin E. We further present in vitro evidence that deguelin promoted apoptosis of cancer cells by decreasing the phospho-Akt signaling and affecting expression of the apoptosis-associated genes Bax and Bcl-2. Additionally, deguelin was found to suppress the migration and invasion of gastric cancer cells. Taken together, these results indicated that deguelin exerted anticancer activity of human gastric cancer MGC-803 and MKN-45 cells in vitro.

Introduction

Gastric cancer is biologically aggressive and one of the leading causes of cancer-related deaths (1). Although multiple therapeutic modalities exist, including surgical excision, radiation therapy and chemo therapy, the clinical results remain unsatisfactory due to gastric cancer often being diagnosed in an advanced stage or metastatic stage (2). Hence, great research efforts have been explored to exploit novel molecular markers and detailed molecular mechanisms contributing to improving diagnostic and therapeutic management of gastric cancer.

The molecular basis of gastric cancer is complicated and involves the interactions between genetic and environmental factors. Among these etiologies, phosphoinositide-3 kinase (PI3K)/protein kinase B (Akt) pathway is believed to be important in gastric cancer development (35). Tian et al demonstrated that the expression of Akt and PI3K were remarkably higher in tumor tissue than that in normal tissue (3). In addition, Ye et al found that PI3K/Akt signaling pathway plays a crucial role in the formation and progression of gastric cancer (4). Simultaneously, phosphorylated-Akt expression significantly correlated with a poor prognosis (5). Therefore, PI3K/Akt pathway may represent a considerable therapeutic target for gastric cancer.

Deguelin, a natural component derived from leguminous plants, has been reported to prevent breast cancer (6), tobacco carcinogen-induced lung carcinogenesis (7), prostate cancer (8) and squamous cancer (9) by blocking Akt activation. Many studies have demonstrated that deguelin exerts its anticancer effect by inhibiting cell viability, cell growth, migration and invasion, inducing apoptosis, targeting cell cycle arrest and anti-angiogenesis (7,10,11).

Therefore, deguelin may provide an alternative potential approach for gastric cancer treatment. Here, we investigated that deguelin not only inhibited the proliferation, invasion, migration but also induced apoptosis in gastric cancer MGC-803 and MKN-45 cells in vitro.

Materials and methods

Cell culture and reagents

Human gastric cancer cell lines MGC-803 and MKN-45 were purchased from Shanghai institute of Cell Biology, Chinese Academy of Sciences and cultured in RPMI-1640 medium with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (Gibco, Grand Island, NY, USA) under a humidified 5% CO2 atmosphere at 37°C. Deguelin (MedChem Express, Monmouth Junction, NJ, USA) was dissolved in dimethyl sulfoxide (DMSO) at concentration of 10 mM as stock solution and stored at −20°C. Before using, deguelin was diluted directly to the desired dose with an identical final concentration of DMSO.

Cell counting kit-8 (CCK-8) cell proliferation assay

CCK-8 (Dojindo, Kumamoto, Japan) assay was used to determine the inhibitory effect of deguelin on the proliferation of two cancer cell types. The MGC-803 (3×103/well) and MKN-45 (5×103/well) cells were plated in 96-well plates with 200 µl of medium. Before the cells were treated with various concentrations of deguelin (0, 1, 5, 10, 25 and 50 µM), they were starved in serum-free medium for 24 h to allow for cell synchronization, and then tested at 72 h. At the testing time-point, 10 µl of sterile CCK-8 solution was added to each well and incubated for an additional 1.5 h at 37°C. The optical density values at 450 nm were measured with a microplate reader (Thermo Scientific, Waltham, MA, USA). The inhibitory rate was calculated using the following formula: Inhibitory rate (%) = (A450 of control cells-A450 of treated cells)/(A450 of control cells) ×100%. The assays were repeated using six cell samples. In addition, for the cell viability test after treatment of deguelin, the MGC-803 (1.5×103/well) and MKN-45 (2.5×103/well) cells were plated in 96-well plates with the medium of 200 µl and incubated with various concentrations of deguelin (0, 1, 10 and 25 µM), then tested using CCK-8 assay at days 1, 2, 3 and 4.

Morphology observation

After treated with deguelin (0, 1, 10 and 25 µmol/l) for 48 h, MGC-803 and MKN-45 cells were observed under an inverted phase contrast microscope to determine their morphology changes.

Cell cycle analysis

After deguelin treatment for 48 h, cells were collected, fixed in 70% ethanol and incubated at 4°C overnight. Cells were then centrifuged and stained in ice-cold phosphate-buffered saline (PBS) solution containing 100 µg/ml propidium iodide (PI), 0.1% Triton X-100, and 1 mg/ml RNase for 0.5 h. After washing, the samples were analyzed by flow cytometry (Beckman Coulter, Brea, CA, USA).

Annexin V/FITC-PI assay

The apoptotic assays were performed by an Annexin V-FITC/PI apoptosis detection kit and detected as the manufacturer's instructions (Miltenyi Biotec, Bergisch Gladbach, Germany). Briefly, the 106 cells were washed using 500 µl binding buffer, centrifuged at 300 × g and stained with 10 µl Annexin V-FITC solution in room temperature for 30 min. Before testing, 5 µl PI solution was added to each sample. The apoptosis rate was evaluated by flow cytometry. At least 10,000 cells for each sample was analyzed. The analyses were repeated in three cell samples.

Real-time quantitative PCR

Total RNAs from control and deguelin-treated cells were extracted by TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and reverse translated with AMV reverse transcriptase (Promega, Madison, WI, USA). To synthesize complementary DNA, 2 µg total RNA per sample was added to the reaction system of a final volume of 20 µl containing 4 µl 5X buffer, 2 µl dNTP, 1 µl oligo(dT), 0.5 µl RNase inhibitor, 0.5 µl AMV reverse transcriptase and ddH2O to meet the final volume. After incubated at 30°C for 10 min, 45°C for 60 min, 98°C for 5 min and 5°C for 5 min, the amplified complementary DNA (cDNA) products were mixed with Power SYBR-Green PCR master mix (Applied Biosystems, Foster City, CA, USA). Quantitative polymerase chain reaction (qPCR) was conducted using a real-time thermal cycler (Stratagene, La Jolla, CA, USA). The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA content was used to normalize with cDNA, and the comparative Ct method was used to analyze data. The primers for real-time qPCR analysis are shown in Table I. Each assay was performed in triplicate and repeated in three cell samples.

Table I

Primers used in quantitative PCR analysis.

Table I

Primers used in quantitative PCR analysis.

GenePrimer sequence (5′-3′)
temperature (°C)
Annealing size (bp)Product
BaxSense: TGCTTCAGGGTTTCATCCAG58170
Antisense: GGCGCCAATCATCCTCTG
Bcl-2Sense: AATCAAACAGAGGTCGCATGCTGG58192
Antisense: TTGTGGCCTTCTTTGAGTTCGGTG
Cyclin E1Sense: AGTGGCGTTTAAGTCCCCTG58326
Antisense: CAGTTTTGAGCTCCCCGTCT
p21Sense: TCCAGCGACCTTCCTCATCCAC58108
Antisense: TCCATAGCCTCTACTGCCACCATC
GAPDHSense: TCACCATCTTCCAGGAGCG58572
Antisense: CTGCTTCACCACCTTCTTGA

[i] GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Western blot analysis

Two different gastric cell lines were isolated after 6 h of incubation in the absence or different concentration of deguelin. Cells were scraped in RIPA lysis buffer and the protein content of cellular extracts were quantified by BCA assay. For western blot analysis, the prepared protein was resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred to PVDF membranes and incubated with the appropriate antibodies. For estimation of p-Akt/total-Akt protein, we used two different specific antibodies: monoclonal anti-p-Akt and monoclonal anti-total-Akt (both from Cell Signaling Technology, Beverly, MA, USA). The blots were probed with β-actin antibody (Cell Signaling Technology) for equal loading control. The secondary antibody was goat anti-rabbit HRP-conjugated antibody (Jackson ImmunoResearch, West Grove, PA, USA). Immunoreactive proteins were detected by the enhanced chemiluminescent (ECL) protocol (Amersham Biosciences, Piscataway, NJ, USA).

4′,6-Diamidino-2-phenylindole (DAPI) staining

MGC-803 and MKN-45 cells were cultured as described, and then treated with various concentrations of deguelin for 48 h. Apoptosis was further determined by nucleus morphology using DAPI staining (Sigma-Aldrich, St. Louis, MO, USA). After being fixed and stained with DAPI, the cells were examined under a fluorescent microscope (Olympus, Tokyo, Japan).

Cell migration assay

The MGC-803 and MKN-45 cells at a density of 2×105 cells/well were cultured in 6-well plates. When reaching 90% confluence, the cells were scratched by a sterile yellow 200 µl pipette tip and then washed three times with PBS. The cells were then placed in fresh RPMI-1640 medium containing 1% FBS with treatment of deguelin or DMSO for 24 h. Five random fields were selected and photographed with an inverted microscope, respectively.

Cell invasion assay

The ability of deguelin to inhibit cell invasion was tested using Transwell assay. The Transwell is in 24-well plate with an insert of 8-µm pore size polyethylene terephthalate membrane (Corning Life Sciences, Tewksbury, MA, USA). The cells were starved in serum-free medium overnight, then trypsinized and resuspended in serum-free medium. The cells at a density of 6×104 cells/well were seeded in the upper Transwell chamber which was coated with Matrigel (BD Biosciences, Bedford, MA USA), then incubated with DMSO or deguelin (1 and 10 µM) for 24 h, and 500 µl of complete growth medium was added to the bottom. Cells on the upper membrane were wiped off with a cotton swab. Invaded cells on the lower membrane were fixed with 4% paraformaldehyde, stained with DAPI and three random fields were counted under a fluorescent inverted phase contrast microscope at ×200 magnification.

Statistical analysis

All data were expressed as mean ± standard deviation (SD). Student's t test was used to analysis the difference between the deguelin-treated and control groups. The analysis was conducted with the statistical software SPSS 22 (SPSS Inc., Chicago, IL, USA). P<0.05 was considered statistically significant.

Results

Inhibitory effect of deguelin on the growth of MGC-803 and MKN-45 cells

CCK-8 assay showed inhibitory effect of deguelin on the growth of MGC-803 and MKN-45 cells. As shown in Fig. 1A and B, after various doses (1, 5, 10, 25 and 50 µM) of deguelin treatment on MGC-803 and MKN-45 cells for 72 h, the IR (inhibitory rate) of MGC-803 cells was 8.56±0.06, 12.20±0.07, 44.06±0.10, 81.00±0.01 and 86.66±0.01%, respectively and the IR of MKN-45 cells was 19.68±0.03, 32.83±0.03, 48.98±0.03, 66.48±0.01 and 83.33±0.01%, respectively. The IC50 (72 h) value for MGC-803 and MKN-45 was 11.83 and 9.33 µM, respectively. As the dose of deguelin increased, the IR of MGC-803 and MKN-45 cells improved gradually.

The effect of deguelin on the cell morphology

As the IC50 described above, doses of 1, 10 and 25 µM deguelin were chosen to perform the rest of the assays. As shown in Fig. 1C and D, after incubated with different concentrations of deguelin (1, 10 and 25 µM) for 48 h, the number of deguelin-treated cells was less than that of blank control cells. In contrast to the cells of control group which exhibited normal features with typical adherent, membrane intact morphology, deguelin treatment groups showed obvious apoptotic morphology with membrane distorted morphology with dose-dependent severity.

Deguelin inhibited cell proliferation and arrested the cell cycle of MGC-803 and MKN-45 cells

Deguelin treatment resulted in a dose- and time-dependent decrease in cell viability (Fig. 2A and B). To address whether the inhibitory effect of deguelin on the growth of cancer cells was accompanied by blocking the cell cycle, FCM assay was performed. Previous experiments suggested that a very high death rate occurred in 25 µM deguelin-treated cells and therefore we chose 1 and 10 µM deguelin treatment group to conduct the cell cycle assay. The assay indicated that deguelin altered the cell cycle distribution after 48 h treatment in both tested cell lines. For MGC-803 cells, deguelin induced cells cycle arrest at G0/G1 phase (Fig. 2C and D). Compared with control group (57.27±1.48%), the percentage of G0/G1 phase cells of deguelin treatment groups (67.53±1.72% at 1 µM, 72.1±4.10% at 10 µM) increased (P<0.05), and S and G2/M phases decreased accordingly. For MKN-45 cells, low dose of deguelin induced cell cycle arrest at S phase, while high dose of deguelin induced cell cycle arrest at G2/M phase (Fig. 2E and F). Compared with control group (22.53±1.11% at S phase, 11.60±0.90% at G2/M phase), the percentage of S phase cells of low dose-treated group (34.27±1.31%) increased (P<0.05), and the percentage of G2/M phase cells of high dose-treated group (32.93±2.44%) increased (P<0.01).

Deguelin promotes apoptotic effects on cultured MGC-803 and MKN-45 cells

Apoptosis was assessed in MGC-803 and MKN-45 cells after treatment with 1, 10 and 25 µM deguelin for 48 h. The early (10.87±0.46% at 1 µM, 20.20±3.21% at 10 µM and 52.70±4.88% at 25 µM), late (5.17±1.28 at 1 µM, 17.60±4.25% at 10 µM and 22.90±4.58% at 25 µM) and total (16.03±1.60% at 1 µM, 37.80±7.02% at 10 µM and 75.60±7.08% at 25 µM) apoptosis rates were increased significantly in MGC-803 cells compared with control (8.03±1.31% of early, 4.60±0.50% of late and 12.63±1.76% of total apoptosis rate) (Fig. 3A and B). Similarly, the early (19.20±0.79 at 1 µM, 39.13±4.01% at 10 µM and 62.63±2.00% at 25 µM), late (3.73±0.66 at 1 µM, 18.57±2.36% at 10 µM and 29.23±1.70% at 25 µM) and total (22.93±0.90 at 1 µM, 57.70±6.33% at 10 µM and 91.87±3.37% at 25 µM) apoptosis rates were also increased in MKN-45 cells compared with control (2.00±0.28% of early, 1.07±0.33% of late and 3.07±0.46% of total apoptosis rate) (Fig. 4A and B). This suggested that deguelin prominently induced apoptosis in gastric cancer cells. DAPI staining showed that many apoptotic bodies with condensed chromatin and apoptotic nucleus fragmentations were observed in deguelin-treated cells (1 and 10 µM for 48 h), but almost none in untreated cells (Fig. 3C and 4C). Notably also, not only did deguelin reduce the proliferation of MGC-803 and MKN-45 cells, but also visibly induced apoptosis.

Relative gene and protein expression under the treatment of deguelin

Deguelin exerted its antitumor activity by inducing cell cycle arrest, apoptosis and inhibiting cell proliferation. Further experiments revealed the effect of deguelin on the apoptotic and proliferative gene expression. After treated in vitro with 1 and 10 µM deguelin for 48 h. Deguelin upregulated the gene expression of Bax (Fig. 5A and E) and downregulated that of Bcl-2 (Fig. 5B and F) of MGC-803 and MKN-45 cells. The expression of Bax and Bcl-2 in MGC-803 and MKN-45 cells showed significant difference from the control cells (P<0.05 for all) (Fig. 5A, B, E and F). The gene expression of cyclin E1 was downregulated and that of p21 was upregulated dramatically in a dose-dependent manner. The expression of cyclin E1 and p21 of MGC-803 and MKN-45 cells showed significant difference from the control cells (P<0.05 for all) (Fig. 5C, D, G and H).

Demonstration of deguelin-induced apoptosis of cancer cells by mediating Akt signal pathway

To test Akt inhibition by deguelin, MGC-803 and MKN-45 cells were treated in vitro with 1 and 10 µM deguelin for 6 h. Consistent with previous studies in other tumor cells (6,12,13), deguelin downregulated the expression of p-Akt (Fig. 5I). This result implied that deguelin induced apoptosis in gastric cells by downregulating Akt activity.

Deguelin inhibits the migration of MGC-803 and MKN-45 cells in vitro

To evaluate the effect of deguelin on a migration ability of MGC-803 and MKN-45 cells, wounded scratch assay was performed on both cell lines. The result showed that 24 h after scratching the cell migration of both cell lines was significantly inhibited by deguelin treatment (Fig. 6). MGC-803 and MKN-45 cells in the control group efficiently migrated into the scratched area (Fig. 6A and C). MGC-803 cells of the control group migrated 67.07±4.67% of the scratched area, whereas the 1 µM deguelin-treated MGC-803 cells migrated 37.12±1.53% of the area (P<0.05) and the 10 µM deguelin-treated MGC-803 cells migrated 31.69±0.81% of the area (P<0.05) (Fig. 6A and B). Blank control MKN-45 cells migrated 29.78±3.67% of the area, whereas the MKN-45 cells of the 1 µM and the 10 µM deguelin-treated group, respectively, migrated 11.14±1.09 and 3.96±1.03% of the area (P<0.05), and the migration rate was significantly lower in deguelin-treated group than that in blank control groups (P<0.05) (Fig. 6C and D).

Deguelin inhibits the invasion of MGC-803 and MKN-45 cells in vitro

Because the enhanced invasion properties of gastric cancer cells are the critical parameters in the development of gastric cancer, we wondered if deguelin would affect the cell behavior of MGC-803 and MKN-45 cells in vitro. Transwell chamber invasion assay results showed that, when compared with the control group (129.1±32.38), the invasion of the 1 µM deguelin-treated MGC-803 cells (36.89±9.67) and the 10 µM deguelin-treated MGC-803 cells (12.67±2.62) was significantly inhibited in a dose dependent manner (P<0.05) (Fig. 7A and B). Deguelin (1 and 10 µM)-treated MKN-45 cells exhibited much lower invasion ability compared to the blank control as evidenced by decreasing the number of cells migrated through the Matrigel (Fig. 7C and D). The invasion ability of MKN-45 cells treated with deguelin was dose-dependently decreased compared to that of DMSO treated MKN-45 cells (13.90±6.76 at 1 µM and 5.60±1.85 at 10 µM). These results indicated that deguelin was able to inhibit invasive ability of gastric cancer cells.

Discussion

Gastric cancer is a highly mortal malignancy with few effective therapies. Resulted from both genetic and environmental risk factors, such as gene mutations, cigarette smoking, helicobacter pylori and intake of salty and smoked food (14), gastric cancer is a heterogeneous and multifactorial disease. Most patients with aggressive gastric cancer fail to respond to surgery and radiotherapy, but they are sensitive to systemic chemotherapy as palliative care (15,16). Therefore, the exploitation of potential alternative chemotherapy drug for gastric cancer is highly encouraging. Deguelin, a natural component of the flavonoid family products, has been used as a promising chemopreventive and therapeutic agent against various cancer cells (13,17,18).

Deguelin has been reported to inhibit the proliferation of different cancer cells, including breast cancer cells, prostate cancer cells and lung squamous cell cancer cells (6,8,9). This study revealed that proliferation of two different gastric cancer MGC-803 and MKN-45 cell lines were inhibited in a time- and dose-dependent manner by deguelin treatment (Fig. 1A and B). Some previous studies demonstrated the anti-proliferative effect of deguelin in different cancer cells was related to G0/G1 phase, S phase or G2/M phase arrest (10,19,20). Murillo et al found that deguelin promoted cell cycle arrest at G0/G1 phase in colon cancer cells (10). Our observations were in accord with an overall efficacy of deguelin in inducing a G0/G1 arrest in MGC-803 cells (Fig. 2C and D). In another study, premalignant and malignant human HBE cells treated with deguelin were observed to arrest at G2/M phase (7). Deguelin treatment of MKN-45 cells resulted in S phase arrest at lower dose but G2/M phase arrest at higher dose (Fig. 2E and F). Indeed, more future studies are needed to identify the underlying mechanisms responsible for the action of deguelin to fully understand the seemingly puzzling role of this compound.

Abnormalities of cell cycle checkpoint regulators have been recognized as critical factors in the development of human cancers. Cyclin-dependent kinase (CDK) inhibitor p21 is a significant element in this regulatory cascade (21), and is shown to be associated with the prognosis of gastric cancer (22). p21 is a negative regulator of cell cycle progression (21). Overexpression of p21 has been identified as a crucial element resulting in cell cycle arrest at G0/G1, S and G2/M phase (23). Radhakrishnan et al found that p21 was specifically associated with cyclin E, rather than cyclin D1, cyclin A, CDK4 or PCNA (23). Their finding are consistent with our results of increased expression of p21 and decreased that of cyclin E1 after deguelin treatment in gastric cancer cells (Fig. 5C, D, G and H). These results suggested that p21-mediated inhibition of cyclin E could be one of the factors that is responsible for the proliferation inhibition and cell cycle arrest of gastric cancer with deguelin treatment.

Deguelin induced apoptosis in a wide array of cancer cell types in vitro, including lung squamous cell carcinoma cells, colon cancer cells and head and neck squamous cell cancer cell lines (9,10,12). In the present study, we found that deguelin could induce apoptosis of gastric cancer MGC-803 and MKN-45 cell lines in vitro in a dose-dependent manner (Figs. 3 and 4), which is consistent with the effect of deguelin performed in other cancer cells (9,11,12). The induction effect of apoptosis could be mediated by the suppression of various molecular pathways, such as PI3K-Akt, IKK-IκBα-NF-κB, EMT, HSP90 and AMPK-mTOR-survivin pathways (11,24,25). Among all the target pathways suggested for deguelin, the PI3K/Akt pathways have the strongest support for inducing cell apoptosis (7,2629). As shown in Fig. 5, compared to the control group, phosphorylation of Akt was dramatically decreased by treatment with deguelin in a dose-dependent manner in both cell lines, suggesting that Akt pathway was responsible for deguelin-induced cell apoptosis inhibition. To further corroborate the induced-apoptosis effects of deguelin, investigation on Akt and other pathways is still necessary.

In addition, based on the references of related literatures (38,39), we assumed that another mechanism of deguelin induced-apoptosis in gastric cancer cells may be related to the mitochondria-mediated (also called the intrinsic) apoptosis pathways. Mitochondria-dependent apoptosis is mediated by the proteins of Bcl-2 family (30,31), including antiapoptotic and proapoptotic proteins such as Bcl-2/xL and Bax/Bak (3237). Bcl-2 family proteins change the mitochondrial membrane permeability required for the release of cytochrome c (38) (39,40). Bcl-2 blocks the release of cytochrome c, whereas Bax localizes to mitochondria and enhances the release of cytochrome c, promotes nuclear fragmentation and induces cell death (41). Therefore, we measured the gene expression of Bcl-2 and Bax to clarify the probable mechanism. Gene expression study by RT-qPCR has shown that deguelin persuaded apoptosis through intrinsic pathway by upregulating the pro-apoptotic gene Bax and down-regulating the anti-apoptotic gene Bcl-2 in a dose-dependent manner (Fig. 5A, B, E and F). In conclusion, deguelin induced gastric cancer cell lines apoptosis via two pathways including the regulation of Bax/Bcl-2 ratio and inhibition of Akt activation.

The motility of gastric cancer cells plays a critical role in development of metastasis. A number of reported studies have demonstrated the effect of deguelin on the migration and invasion of different cancer types (25,4244). Hu et al found that the treatment of deguelin inhibited lung cancer migration via downregulating Akt and the MAPK pathway (25). In another study, deguelin inhibited the migration and invasion of human osteosarcoma cells via the inhibition of MMP-2/9 in vitro by inhibiting the expression of GRB2, FAK and RhoA (44). However, the effects of deguelin on motility of gastric cancer MGC-803 and MKN-45 cell lines have not been reported. As shown in Figs. 6 and 7, the results showed that deguelin reduced cell migration and invasion of gastric cancer MGC-803 and MKN-45 cell lines in vitro. Therefore, deguelin would be a useful candidate to suppress cancer progression and metastasis. Based on the literature, deguelin suppressed the migration and invasion of cancer cells by complicated mechanisms such as reducing the expression and inactivation of FAK, RhoA-ROCK, MAPK and Akt. The mechanism that occurred in the effect of deguelin on the migration and invasion of gastric cancer cells need further investigation.

In conclusion, this study demonstrated that deguelin exhibited anticancer effect by inhibiting cell proliferation, causing cell cycle arrest, inducing apoptosis and suppressing cell migration and invasion of human gastric cancer in vitro. To provide a guide for further clinical trials, more studies on the precise mechanism of deguelin treatment of gastric cancer, however, are still needed. Since a number of reported animal studies have proved the antitumor activity of deguelin at doses of 3-5 mg/kg using xenograft models of different cancer types in vivo (24,43,45). These bionic models as well as our study warrant further in vivo investigations of deguelin efficacy. Collectively, deguelin may represent a promising anticancer agent capable of combating the progression and metastasis of gastric cancer.

Acknowledgments

The authors would like to thank the Shanghai Key Laboratory of Tissue Engineering for its technical assistance.

Notes

[1] Funding

This study was supported by grants from the Scientific Research Foundation of Traditional Chinese Medicine of Shanghai (2014JP013A, to PW) and the Research Innovation Program of Shanghai Municipal Education Commission (09yz79, to SG).

[2] Availability of data and material

The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.

[3] Authors' contributions

WK and XZ performed the experiments and wrote the manuscript. SG and PW designed the experimental plan and analyzed the data. All authors read and approved the final manuscript.

[4] Ethics approval and consent to participate

Not applicable.

[5] Consent for publication

Not applicable.

[6] Competing interests

The authors declare that they have no competing interests.

References

1 

Brenner H, Rothenbacher D and Arndt V: Epidemiology of stomach cancer. Methods Mol Biol. 472:467–477. 2009. View Article : Google Scholar

2 

Orditura M, Galizia G, Sforza V, Gambardella V, Fabozzi A, Laterza MM, Andreozzi F, Ventriglia J, Savastano B, Mabilia A, et al: Treatment of gastric cancer. World J Gastroenterol. 20:1635–1649. 2014. View Article : Google Scholar : PubMed/NCBI

3 

Tian WY, Chen WC, Li R and Liu L: Markers CD40, VEGF, AKT, PI3K and S100 correlate with tumor stage in gastric cancer. Onkologie. 36:26–31. 2013.

4 

Ye B, Jiang LL, Xu HT, Zhou DW and Li ZS: Expression of PI3K/AKT pathway in gastric cancer and its blockade suppresses tumor growth and metastasis. Int J Immunopathol Pharmacol. 25:627–636. 2012. View Article : Google Scholar : PubMed/NCBI

5 

Sukawa Y, Yamamoto H, Nosho K, Kunimoto H, Suzuki H, Adachi Y, Nakazawa M, Nobuoka T, Kawayama M, Mikami M, et al: Alterations in the human epidermal growth factor receptor 2-phosphatidylinositol 3-kinase-v-Akt pathway in gastric cancer. World J Gastroenterol. 18:6577–6586. 2012. View Article : Google Scholar : PubMed/NCBI

6 

Wu W, Hai Y, Chen L, Liu RJ, Han YX, Li WH, Li S, Lin S and Wu XR: Deguelin-induced blockade of I3K/protein kinase B/MAP kinase signaling in zebrafish and breast cancer cell lines is mediated by downregulation of fibroblast growth factor receptor 4 activity. Pharmacol Res Perspect. 4:e002122016. View Article : Google Scholar

7 

Chun KH, Kosmeder JW II, Sun S, Pezzuto JM, Lotan R, Hong WK and Lee HY: Effects of deguelin on the phosphatidylinositol 3-kinase/Akt pathway and apoptosis in premalignant human bronchial epithelial cells. J Natl Cancer Inst. 95:291–302. 2003. View Article : Google Scholar : PubMed/NCBI

8 

Thamilselvan V, Menon M and Thamilselvan S: Anticancer efficacy of deguelin in human prostate cancer cells targeting glycogen synthase kinase-3β/β-catenin pathway. Int J Cancer. 129:2916–2927. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Yan B, Zhao D, Yao Y, Bao Z, Lu G and Zhou J: Deguelin induces the apoptosis of lung squamous cell carcinoma cells through regulating the expression of galectin-1. Int J Biol Sci. 12:850–860. 2016. View Article : Google Scholar : PubMed/NCBI

10 

Murillo G, Salti GI, Kosmeder JW II, Pezzuto JM and Mehta RG: Deguelin inhibits the growth of colon cancer cells through the induction of apoptosis and cell cycle arrest. Eur J Cancer. 38:2446–2454. 2002. View Article : Google Scholar : PubMed/NCBI

11 

Wang Y, Ma W and Zheng W: Deguelin, a novel antitumorigenic agent targeting apoptosis, cell cycle arrest and anti-angiogenesis for cancer chemoprevention. Mol Clin Oncol. 1:215–219. 2013. View Article : Google Scholar

12 

Baba Y, Fujii M, Maeda T, Suzuki A, Yuzawa S and Kato Y: Deguelin induces apoptosis by targeting both EGFR-Akt and IGF1R-Akt pathways in head and neck squamous cell cancer cell lines. BioMed Res Int. 2015:6571792015. View Article : Google Scholar : PubMed/NCBI

13 

Mehta RR, Katta H, Kalra A, Patel R, Gupta A, Alimirah F, Murillo G, Peng X, Unni A, Muzzio M, et al: Efficacy and mechanism of action of Deguelin in suppressing metastasis of 4T1 cells. Clin Exp Metastasis. 30:855–866. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Karimi P, Islami F, Anandasabapathy S, Freedman ND and Kamangar F: Gastric cancer: Descriptive epidemiology, risk factors, screening, and prevention. Cancer Epidemiol Biomarkers Prev. 23:700–713. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Clarke JS, Cruze K, El Farra S and Longmire WP Jr: The natural history and results of surgical therapy for carcinoma of the stomach. An analysis of 250 cases. Am J Surg. 102:143–152. 1961. View Article : Google Scholar : PubMed/NCBI

16 

Janunger KG, Hafström L, Nygren P and Glimelius B; SBU-group: Swedish council of technology assessment in health care: A systematic overview of chemotherapy effects in gastric cancer. Acta Oncol. 40:309–326. 2001. View Article : Google Scholar

17 

Zhao H, Jiao Y and Zhang Z: Deguelin inhibits the migration and invasion of lung cancer A549 and H460 cells via regulating actin cytoskeleton rearrangement. Int J Clin Exp Pathol. 8:15582–15590. 2015.

18 

Yi S, Wen L, He J, Wang Y, Zhao F, Zhao J, Zhao Z, Cui G and Chen Y: Deguelin, a selective silencer of the NPM1 mutant, potentiates apoptosis and induces differentiation in AML cells carrying the NPM1 mutation. Ann Hematol. 94:201–210. 2015. View Article : Google Scholar

19 

Murillo G, Peng X, Torres KE and Mehta RG: Deguelin inhibits growth of breast cancer cells by modulating the expression of key members of the Wnt signaling pathway. Cancer Prev Res (Phila). 2:942–950. 2009. View Article : Google Scholar

20 

Xiong JR and Liu HL: Regulatory effects of deguelin on proliferation and cell cycle of Raji cells. J Huazhong Univ Sci Technolog Med Sci. 33:491–495. 2013. View Article : Google Scholar : PubMed/NCBI

21 

Xiong Y, Hannon GJ, Zhang H, Casso D, Kobayashi R and Beach D: p21 is a universal inhibitor of cyclin kinases. Nature. 366:701–704. 1993. View Article : Google Scholar : PubMed/NCBI

22 

Okuyama T, Maehara Y, Kabashima A, Takahashi I, Kakeji Y and Sugimachi K: Combined evaluation of expressions of p53 and p21 proteins as prognostic factors for patients with gastric carcinoma. Oncology. 63:353–361. 2002. View Article : Google Scholar : PubMed/NCBI

23 

Radhakrishnan SK, Feliciano CS, Najmabadi F, Haegebarth A, Kandel ES, Tyner AL and Gartel AL: Constitutive expression of E2F-1 leads to p21-dependent cell cycle arrest in S phase of the cell cycle. Oncogene. 23:4173–4176. 2004. View Article : Google Scholar : PubMed/NCBI

24 

Mehta R, Katta H, Alimirah F, Patel R, Murillo G, Peng X, Muzzio M and Mehta RG: Deguelin action involves c-Met and EGFR signaling pathways in triple negative breast cancer cells. PLoS One. 8:e651132013. View Article : Google Scholar : PubMed/NCBI

25 

Hu J, Ye H, Fu A, Chen X, Wang Y, Chen X, Ye X, Xiao W, Duan X, Wei Y, et al: Deguelin - an inhibitor to tumor lymphangiogenesis and lymphatic metastasis by downregulation of vascular endothelial cell growth factor-D in lung tumor model. Int J Cancer. 127:2455–2466. 2010. View Article : Google Scholar : PubMed/NCBI

26 

Peng XH, Karna P, O'Regan RM, Liu X, Naithani R, Moriarty RM, Wood WC, Lee HY and Yang L: Downregulation of inhibitor of apoptosis proteins by deguelin selectively induces apoptosis in breast cancer cells. Mol Pharmacol. 71:101–111. 2007. View Article : Google Scholar

27 

Chen Y, Wu Q, Cui GH, Chen YQ and Li R: Deguelin blocks cells survival signal pathways and induces apoptosis of HL-60 cells in vitro. Int J Hematol. 89:618–623. 2009. View Article : Google Scholar : PubMed/NCBI

28 

Bortul R, Tazzari PL, Billi AM, Tabellini G, Mantovani I, Cappellini A, Grafone T, Martinelli G, Conte R and Martelli AM: Deguelin, A PI3K/AKT inhibitor, enhances chemosensitivity of leukaemia cells with an active PI3K/AKT pathway. Br J Haematol. 129:677–686. 2005. View Article : Google Scholar : PubMed/NCBI

29 

Chu ZH, Liang XH, Zhou XL, Huang RF, Zhan Q and Jiang JW: Effects of deguelin on proliferation and apoptosis of MCF-7 breast cancer cells by phosphatidylinositol 3-kinase/Akt signaling pathway. Zhong Xi Yi Jie He Xue Bao. 9:533–538. 2011.In Chinese. View Article : Google Scholar : PubMed/NCBI

30 

Chiu TH, Lan KY, Yang MD, Lin JJ, Hsia TC, Wu CT, Yang JS, Chueh FS and Chung JG: Diallyl sulfide promotes cell-cycle arrest through the p53 expression and triggers induction of apoptosis via caspase- and mitochondria-dependent signaling pathways in human cervical cancer Ca Ski cells. Nutr Cancer. 65:505–514. 2013. View Article : Google Scholar : PubMed/NCBI

31 

Wu J, Yang J, Liu Q, Wu S, Ma H and Cai Y: Lanthanum induced primary neuronal apoptosis through mitochondrial dysfunction modulated by Ca2+ and Bcl-2 family. Biol Trace Elem Res. 152:125–134. 2013. View Article : Google Scholar : PubMed/NCBI

32 

van Gurp M, Festjens N, van Loo G, Saelens X and Vandenabeele P: Mitochondrial intermembrane proteins in cell death. Biochem Biophys Res Commun. 304:487–497. 2003. View Article : Google Scholar : PubMed/NCBI

33 

Scorrano L and Korsmeyer SJ: Mechanisms of cytochrome c release by proapoptotic BCL-2 family members. Biochem Biophys Res Commun. 304:437–444. 2003. View Article : Google Scholar : PubMed/NCBI

34 

Kuwana T, Mackey MR, Perkins G, Ellisman MH, Latterich M, Schneiter R, Green DR and Newmeyer DD: Bid, Bax, and lipids cooperate to form supramolecular openings in the outer mitochondrial membrane. Cell. 111:331–342. 2002. View Article : Google Scholar : PubMed/NCBI

35 

Crompton M: Bax, Bid and the permeabilization of the mitochondrial outer membrane in apoptosis. Curr Opin Cell Biol. 12:414–419. 2000. View Article : Google Scholar : PubMed/NCBI

36 

Wei MC, Zong WX, Cheng EH, Lindsten T, Panoutsakopoulou V, Ross AJ, Roth KA, MacGregor GR, Thompson CB and Korsmeyer SJ: Proapoptotic BAX and BAK: A requisite gateway to mitochondrial dysfunction and death. Science. 292:727–730. 2001. View Article : Google Scholar : PubMed/NCBI

37 

Kim R, Emi M and Tanabe K: Role of mitochondria as the gardens of cell death. Cancer Chemother Pharmacol. 57:545–553. 2006. View Article : Google Scholar

38 

Green DR and Reed JC: Mitochondria and apoptosis. Science. 281:1309–1312. 1998. View Article : Google Scholar : PubMed/NCBI

39 

Gross A, McDonnell JM and Korsmeyer SJ: BCL-2 family members and the mitochondria in apoptosis. Genes Dev. 13:1899–1911. 1999. View Article : Google Scholar : PubMed/NCBI

40 

Ghribi O, Herman MM, Spaulding NK and Savory J: Lithium inhibits aluminum-induced apoptosis in rabbit hippocampus, by preventing cytochrome c translocation, Bcl-2 decrease, Bax elevation and caspase-3 activation. J Neurochem. 82:137–145. 2002. View Article : Google Scholar : PubMed/NCBI

41 

Rossé T, Olivier R, Monney L, Rager M, Conus S, Fellay I, Jansen B and Borner C: Bcl-2 prolongs cell survival after Bax-induced release of cytochrome c. Nature. 391:496–499. 1998. View Article : Google Scholar : PubMed/NCBI

42 

Liu YP, Lee JJ, Lai TC, Lee CH, Hsiao YW, Chen PS, Liu WT, Hong CY, Lin SK, Ping Kuo MY, et al: Suppressive function of low-dose deguelin on the invasion of oral cancer cells by downregulating tumor necrosis factor alpha-induced nuclear factor-kappa B signaling. Head Neck. 38(Suppl 1): E524–E534. 2016. View Article : Google Scholar

43 

Boreddy SR and Srivastava SK: Deguelin suppresses pancreatic tumor growth and metastasis by inhibiting epithelial-to-mesenchymal transition in an orthotopic model. Oncogene. 32:3980–3991. 2013. View Article : Google Scholar

44 

Shang HS, Chang JB, Lin JH, Lin JP, Hsu SC, Liu CM, Liu JY, Wu PP, Lu HF, Au MK, et al: Deguelin inhibits the migration and invasion of U-2 OS human osteosarcoma cells via the inhibition of matrix metalloproteinase-2/-9 in vitro. Molecules. 19:16588–16608. 2014. View Article : Google Scholar : PubMed/NCBI

45 

Yang YL, Ji C, Bi ZG, Lu CC, Wang R, Gu B and Cheng L: Deguelin induces both apoptosis and autophagy in cultured head and neck squamous cell carcinoma cells. PLoS One. 8:e547362013. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

June-2018
Volume 41 Issue 6

Print ISSN: 1107-3756
Online ISSN:1791-244X

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Kang W, Zheng X, Wang P and Guo S: Deguelin exerts anticancer activity of human gastric cancer MGC-803 and MKN-45 cells in vitro. Int J Mol Med 41: 3157-3166, 2018
APA
Kang, W., Zheng, X., Wang, P., & Guo, S. (2018). Deguelin exerts anticancer activity of human gastric cancer MGC-803 and MKN-45 cells in vitro. International Journal of Molecular Medicine, 41, 3157-3166. https://doi.org/10.3892/ijmm.2018.3532
MLA
Kang, W., Zheng, X., Wang, P., Guo, S."Deguelin exerts anticancer activity of human gastric cancer MGC-803 and MKN-45 cells in vitro". International Journal of Molecular Medicine 41.6 (2018): 3157-3166.
Chicago
Kang, W., Zheng, X., Wang, P., Guo, S."Deguelin exerts anticancer activity of human gastric cancer MGC-803 and MKN-45 cells in vitro". International Journal of Molecular Medicine 41, no. 6 (2018): 3157-3166. https://doi.org/10.3892/ijmm.2018.3532