This article is mentioned in:

Introduction

Hepatocellular carcinoma (HCC) is one of the most lethal cancers worldwide and is the main cause of death among cirrhotic patients (1–3). Patients diagnosed with HCC have a poor prognosis because of the aggressive nature of the disease (4,5), and surgical resection or local ablation therapy is effective only at an early stage (6). Furthermore, ~70% of these patients develop recurrent tumors within five years after curative surgery (7). Recurrence of HCC, including multicentric hepatocarcinogenesis and intrahepatic metastasis, is a key prognostic factor, but it is difficult to distinguish patients at high risk for recurrence and subsequent adverse prognosis using only clinical staging systems comprising tumor characteristics and liver function (1,8). Therefore, a novel approach for predicting progression and recurrence of HCC is urgently required.

Liver damage and the increased incidence of HCC (chronic viral hepatitis B and C, alcohol consumption and aflatoxin) have multiple causes (5,9,10). Furthermore, as with other malignancies, the initiation of HCC is a multistep process, and because it is characterized by high molecular variability, clinical management requires a more complex approach (11).

Although recent research along with the development of new genomic technologies establishes that the development and progression of HCC are caused by the accumulation of genetic and epigenetic alterations (12–14), the detailed underlying mechanisms have not been determined. Therefore, identifying molecular markers for HCC, particularly those that may predict recurrence, is important, because stratification of patients at risk for recurrence facilitates individualized management, including intensive surveillance and aggressive adjuvant therapy for high-risk patients.

Prenyl diphosphate synthase subunit 2 (PDSS2) was identified in 2005 (15), it encodes the second subunit of prenyl diphosphate synthase, which is an essential enzyme involved in the biosynthesis of coenzyme Q10 (CoQ10), and PDSS2 determines the side-chain length of mammalian ubiquinones (16). CoQ10 is synthesized from mevalonic acid in the liver and plays a vital role in the mitochondrial respiratory chain, pyrimidine nucleoside biosynthesis and the modulation of cell apoptosis (17). Aberrant expression of PDSS2 in the liver may cause DNA damage and disrupt the cell cycle through inhibition of CoQ10 synthesis, leading to initiation and progression of HCC (18,19). Furthermore, chronic inflammation caused by hepatitis virus infection might affect PDSS2 expression. Although evidence indicates that PDSS2 suppresses the development of malignant melanoma and lung cancer (16,20), the clinical significance and regulatory mechanisms of PDSS2 expression in HCC remain undefined.

Therefore, we attempted to answer these questions in the present study by analyzing PDSS2 expression in HCC to identify novel, clinically significant biomarkers for progression and recurrence of HCC. To the best of our knowledge, this is the first report to determine PDSS2 expression levels in HCC.

Materials and methods

Sample collection

Nine HCC cell lines (Hep3B, HepG2, HLE, HLF, HuH1, HuH2, HuH7, PLC/PRF/5 and SK-Hep1) were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA) and were maintained as previously described (21). Primary HCC and non-cancerous tissues were collected from 151 patients who underwent liver resection for HCC at Nagoya University Hospital between January 1998 and July 2012. Clinicopathological data were collected from medical records. Specimens were classified histologically according to the 7th Edition of the Union for International Cancer Control classification (22).

Tissue samples were immediately flash-frozen in liquid nitrogen and stored at −80°C. RNA was extracted from ~5 mm2 diameter tumor samples without detectable necrotic areas comprising >80% tumor cells. The corresponding non-cancerous liver tissue samples that lacked regenerative or dysplastic nodules were collected from the same patient that were >2 cm distant from the edge of the tumor. The median duration of patient follow-up was 37.9 months (range, 0.37–147 months). Postoperative follow-up included physical examinations, measurement of serum tumor markers every three months, and enhanced computed tomography scans every six months. Treatment after recurrence was generally selected from one of the options as follows: surgery, radiofrequency ablation, transcatheter arterial chemoembolization, and chemotherapy, according to tumor status and liver function. Enrollees granted written informed consent for the use of clinical samples and data as required by the Institutional Review Board of Nagoya University, Japan.

Quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR). PDSS2

mRNA levels were determined using qRT-PCR. Total RNA (10 μg) was isolated from 9 HCC cell lines, 151 primary HCCs and adjacent non-cancerous tissues, and was used as a template for cDNA synthesis. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA (TaqMan, GAPDH control reagents; Applied Biosystems, Foster City, CA, USA) was quantified in each sample for standardization. Quantitative real-time RT-PCR was performed using the SYBR® Green PCR Core Reagents kit (Applied Biosystems) as follows: one cycle at 95°C for 10 min, 40 cycles at 95°C for 5 sec, and 60°C for 60 sec. Real-time detection of the SYBR® Green fluoresence was conducted using an ABI StepOnePlus™ Real-Time PCR System (Applied Biosystems). Triplicate samples of 9 HCC cell lines and 151 clinical samples were analyzed. Samples without templates served as negative controls. The expression level of each sample is shown as the value of the PDSS2 amplicon divided by that of GAPDH (23). The primer sequences are listed in Table I. PDSS2 mRNA levels were considered downregulated in tumor tissues when they were <50% compared with those of the corresponding non-cancerous tissues.

Table I Primers and annealing temperatures.

Table I

Primers and annealing temperatures.

Gene	Experiment	Type	Sequence (5′-3′)	Product size (bp)	Annealing temperature (°C)
PDSS2	qRT-PCR	Forward	GAATCAGGTAGTGTCAGAGG	181	60
		Reverse	GAGGCTATTCCAGCTGTCATG
	MSP methylated	Forward	TCGAAGTTGGATTCGAGGAT	263	62
		Reverse	AAACGTCGAACGAAAACACC
	MSP unmethylated	Forward	GGTTGGTGGTGATAGTGATA	195	56
		Reverse	CAACAAATAATCCCTCTACAC
	Bisulfite sequencing	Forward	TGTTTGGTTGGGTTTTGAGG	152	58
		Reverse	CACCAACCCCTA ACA ATA AC
HNF4α	qRT-PCR	Forward	CGTGGTGGACAAAGACAAGA	128	60
		Reverse	CATAGCTTGACCTTCGAGTGC
CDX2	qRT-PCR	Forward	GGAACCTGTGCGAGTGGAT	128	60
		Reverse	GAAACTCCTTCTCCAGCTCC
GAPDH	qRT-PCR	Forward	GAAGGTGAAGGTCGGAGTC	226	60
		Probe	CAAGCTTCCCGTTCTCAGCC
		Reverse	GAAGATGGTGATGGGATTTC

[i] PDSS2, prenyl diphosphate synthase subunit 2; HNF4α, hepatocyte nuclear factor 4α; CDX2, caudal-related homeobox transcription factor 2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; qRT-PCR, quantitative real-time reverse-transcription polymerase chain reaction; MSP, methylation specific PCR; bp, base pair.

Analysis of the promoter region of PDSS2

The nucleotide sequence of the PDSS2 promoter region was analyzed to determine the presence or absence of CpG islands defined as follows: at least a 200-bp region of DNA with a high HCC content (>50%) and an Observed CpG/Expected CpG ratio ≥0.6 (24,25). CpG Island Searcher software (http://cpgislands.usc.edu/) was employed to determine the locations of CpG islands (26).

Methylation-specific PCR (MSP) and bisulfite sequence analysis

PDSS2 possesses a CpG island near its promoter region, and we hypothesized that aberrant methylation regulates PDSS2 transcription in HCC. DNA samples from nine HCC cell lines treated with bisulfite were subjected to MSP. Genomic bisulfite-treated DNA from HCC cell lines was sequenced to ascertain whether the MSP amplification was reliable. The primer sequences used for MSP and bisulfite sequencing are listed in Table I. Bisulfite treatment and the sequencing procedure were performed as reported (27).

5-Aza-2′-deoxycytidine (5-aza-dC) treatment

To assess the relation of promoter hypermethylation to PDSS2 transcription, HCC cells (1.5×106) were treated with 5-aza-dC (Sigma-Aldrich, St. Louis, MO, USA) to inhibit DNA methylation and cultured for 6 days with medium changes on days 1, 3 and 5. RNA was extracted, and RT-PCR was performed as previously described (27).

Expression of genes encoding proteins potentially associated with PDSS2

The expression levels of hepatocyte nuclear factor 4α (HNF4α) and caudal-type homeobox transcription factor 2 (CDX2), which may associate with PDSS2 (20,28) were determined in HCC cell lines using qRT-PCR. The sequences of primers specific for HNF4α and CDX2 are listed in Table I.

Immunohistochemistry (IHC)

IHC analysis of the localization of PDSS2 was performed using a mouse monoclonal antibody against PDSS2 (ab119768; Abcam, Cambridge, UK) diluted 1:150 in antibody diluent (Dako, Glostrup, Denmark) to probe 30 representative sections of well-preserved HCC tissue previously described (2). Staining patterns were compared between HCCs and the corresponding normal adjacent tissues. To avoid subjectivity, the specimens were randomized and coded before analysis by two independent observers who were unaware of the status of the samples. Each observer evaluated all specimens at least twice to minimize intraobserver variation (29).

Statistical analysis

Correlations between the levels of PDSS2 mRNA with those of HNF4α and CDX2 were a nalyzed using the Spearman rank correlation test. Relative levels of mRNA expression (PDSS2/GAPDH) between HCC and non-cancerous tissues were analyzed using the Mann-Whitney U test. The χ2 test was used to analyze the significance of the association between the expression and methylation status of PDSS2 and clinicopathological parameters. Disease-specific and disease-free survival rates were calculated using the Kaplan-Meier method, and the difference in survival curves was analyzed using the log-rank test. We performed multivariate regression analysis using the Cox proportional hazards model to detect prognostic factors, and variables with P<0.05 were entered into the final model. All statistical analyses were performed using JMP 10 software (SAS Institute, Inc., Cary, NC, USA). P<0.05 was considered statistically significant.

Results

Identification of a CpG island in the PDSS2 promoter region

A CpG island was identified in the PDSS2 promoter region (Fig. 1A), leading to the hypothesis that hypermethylation of the CpG islands regulates the expression of PDSS2 in HCC.

Figure 1 (A) A CpG island was detected near the PDSS2 transcription initiation site, extending upstream into the promoter region. (B) Bar graphs indicate PDSS2 mRNA expression in HCC cell lines before or after 5-aza-dC treatment. The methylation status of the PDSS2 promoter is shown in the box. M, methylated; pM, partially methylated; U, unmethylated. (C) Representative results of bisulfite sequence analysis. All CpG sites in Hep3B cells were retained as CG and those of HepG2 cells were converted to TG.

PDSS2 mRNA expression and regulatory mechanisms in HCC cell lines

Significant decrease in PDSS2 mRNA levels was detected in 6 (67%) of 9 HCC cell lines compared with the mean expression level in 151 non-cancerous liver tissues (Fig. 1B). Hypermethylation of the PDSS2 promoter was detected in Hep3B, HuH2, HuH7 and SK-Hep1 cells (Fig. 1B). To determine whether hypermethylation of the PDSS2 promoter inhibited expression, PDSS2 mRNA expression levels were compared before and after treatment with the methylation inhibitor 5-aza-dC. PDSS2 mRNA levels were restored in cells with downregulated PDSS2 expression accompanying hypermethylation after 5-aza-dC treatment (Fig. 1B), indicating that promoter hypermethylation inhibited PDSS2 transcription in HCC.

Expression of genes encoding proteins potentially associated with PDSS2 in HCC cell lines

The relative mRNA expression levels of PDSS2, HNF4α and CDX2 in HCC cell lines are shown in Fig. 2A. PDSS2 expression levels significantly correlated with those of HNF4α (Fig. 2B).

Figure 2 (A) Analysis of PDSS2, HNF4α and CDX2 mRNA expression in HCC cell lines. (B) Comparison of mRNA expression levels between PDSS2, HNF4α and CDX2.

Patient characteristics

The mean age of the 151 patients was 64.6±9.7 years (range, 34–84 years), the male to female ratio was 5:1, and there were 37 and 84 patients with hepatitis B and C virus infections, respectively. Of the patients without HCC, 10, 87 and 54 presented with normal liver function, chronic hepatitis or cirrhosis, respectively. We classified 140 and 11 patients as Child-Pugh class A or B, respectively.

Expression levels of PDSS2 mRNA and protein in resected tissues

The mean level of PDSS2 mRNA compared with that of non-cancerous liver diminished gradually in the order of normal liver, chronic hepatitis and cirrhosis, indicating that chronic inflammation and fibrosis of non-cancerous liver decreased PDSS2 expression (Fig. 3A). In contrast, the type of hepatitis virus infection (hepatitis virus B, C or none) did not influence PDSS2 expression in non-cancerous liver tissues. PDSS2 mRNA expression was decreased in HCC tissues of 122 (81%) of 151 patients compared with that of the corresponding non-cancerous tissues. The mean expression level of PDSS2 mRNA was significantly lower in HCC tissues compared with that of the corresponding non-cancerous tissues (P<0.001; Fig. 3A). Moreover, poorly differentiated tumor cells expressed relatively lower levels of PDSS2 mRNA (Fig. 3B).

Figure 3 Analysis of the expression of PDSS2 in clinical specimens. (A) The mean level of PDSS2 mRNA expression was lower in HCC tissues compared with the corresponding non-cancerous tissues categorized by background uninvolved liver status. (B) Comparison of PDSS2 mRNA expression level among HCCs categorized by tumor differentiation. (C) Representative IHC data. PDSS2 was expressed at lower levels compared with non-cancerous adjacent tissue (magnified at ×100 and ×400). N, non-cancerous tissue; T, tumor tissue.

The expression of PDSS2 was analyzed using IHC. Representative sections with reduced PDSS2 staining in HCC tissues are shown in Fig. 3C. The overall staining intensities of 30 samples were consistent with mRNA levels detected using qRT-PCR.

Prognostic implications of PDSS2 mRNA expression levels

Fifty-six (37%) of 151 patients were categorized with decreased PDSS2 mRNA levels in HCC tissues compared with noncancerous tissues. The disease-specific survival rate of patients with HCC with decreased PDSS2 mRNA was significantly lower compared with those without this factor (5-year survival rates, 51 and 74%, respectively, P=0.001; Fig. 4A). Decreased PDSS2 mRNA expression in patients with HCCs was significantly associated with uninvolved liver status, preoperative serum α-fetoprotein >20 ng/ml, tumor size ≥3.0 cm, tumor differentiation (moderate to poor), serosal infiltration, septum formation and advanced UICC stage (Table II). Multivariate analysis identified decreased PDSS2 mRNA expression as an independent prognostic factor (hazard ratio 2.45, 95% confidence interval 1.27–4.80, P=0.008; Table III). Patients with HCC with decreased PDSS2 mRNA levels experienced significantly earlier recurrences compared with those without (2-year recurrence-free survival rates, 38 and 59%, respectively, P=0.021; Fig. 4B). A stepwise decrease of PDSS mRNA expression in patients with HCC correlated with UICC stage (Fig. 4C).

Figure 4 Prognostic significance of PDSS2 mRNA expression in patients with HCC. (A) Disease-specific survival of patients with decreased PDSS2 mRNA in HCC was significantly shorter than those without. (B) Recurrencefree survival of patients with decreased PDSS2 mRNA was significantly shorter than those without. (C) PDSS2 expression levels in each UICC stage.

Table II Association between expression levels of PDSS2 mRNA and clinicopathological parameters in 151 patients with hepatocellular carcinoma (HCC).

Table II

Association between expression levels of PDSS2 mRNA and clinicopathological parameters in 151 patients with hepatocellular carcinoma (HCC).

Clinicopathological parameters	Decreased PDSS2 in HCCs (n=56)	Others (n=95)	P-value
Age (years)
<65	26	41	0.696
≥65	30	54
Gender
Male	50	76	0.128
Female	6	19
Background liver
Normal liver	1	9
Chronic hepatitis	38	49	0.046a
Cirrhosis	17	37
Pugh-Child’s classification
A	52	88	0.959
B	4	7
Hepatitis virus
Absent	13	17
HBV	15	22	0.551
HCV	28	56
AFP (ng/ml)
≤20	18	63	<0.001a
>20	38	32
PIVKA II (mAU/ml)
≤40	16	42	0.054
>40	40	53
Tumor multiplicity
Solitary	43	74	0.875
Multiple	13	21
Tumor size (cm)
<3.0	12	35	0.045a
≥3.0	44	60
Differentiation
Well	7	28	0.014a
Moderate to poor	49	67
Growth type
Expansive growth	43	84	0.063
Invasive growth	13	11
Serosal infiltration
Absent	35	79	0.005a
Present	21	16
Formation of capsule
Absent	17	30	0.875
Present	39	65
Infiltration to capsule
Absent	24	44	0.680
Present	32	51
Septum formation
Absent	13	40	0.017a
Present	43	55
Vascular invasion
Absent	33	81	<0.001a
Present	23	14
UICC pathological stage
I	27	67	0.014a
II	18	21
III	11	7

a Statistically significant difference (P<0.05).

{ label (or @symbol) needed for fn[@id='tfn3-ijo-45-05-2005'] } HBV, hepatitis B virus; HCV, hepatitis C virus; AFP, α-fetoprotein; PIVKA, protein induced by vitamin K antagonists; UICC, Union for International Cancer Control.

Table III Prognostic factors of 151 patients with hepatocellular carcinoma (HCC).

Table III

Prognostic factors of 151 patients with hepatocellular carcinoma (HCC).

		Univariate analysis			Multivariable analysis
Variables	n	Hazard ratio	95% CI	P-value	Hazard ratio	95% CI	P-value
Age (≥65 years)	84	1.92	1.07–3.57	0.030a	1.70	0.92–3.25	0.090
Gender (male)	126	1.27	0.60–3.13	0.553
Background liver (cirrhosis)	54	1.58	0.88–2.81	0.123
Pugh-Child’s classification (B)	11	0.93	0.28–2.32	0.889
AFP (>20 ng/ml)	70	1.90	1.07–3.42	0.029a	1.09	0.57–2.10	0.785
PIVKA II (>40 mAU/ml)	93	2.10	1.14–4.07	0.016a	1.20	0.62–2.49	0.595
Tumor multiplicity (multiple)	34	2.09	1.11–3.76	0.023a	1.80	0.92–3.41	0.085
Tumor size (≥3.0 cm)	104	2.20	1.13–4.71	0.020a	1.40	0.63–3.43	0.418
Tumor differentiation (well)	35	0.55	0.25–1.10	0.095
Growth type (invasive growth)	24	1.44	0.69–2.76	0.318
Serosal infiltration	37	2.51	1.32–4.61	0.006a	1.14	0.56–2.25	0.712
Formation of capsule	104	1.05	0.57–2.02	0.884
Infiltration to capsule	83	1.20	0.67–2.18	0.537
Septum formation	98	0.87	0.49–1.60	0.651
Vascular invasion	37	3.40	1.87–6.07	<0.001a	1.85	0.94–3.66	0.076
Margin status (positive)	28	2.64	1.42–4.73	0.003a	2.60	1.36–4.84	0.005a
Decreased PDSS2 in HCC	56	2.52	1.41–4.52	0.002a	2.45	1.27–4.80	0.008a

a Statistically significant (P<0.05).

{ label (or @symbol) needed for fn[@id='tfn5-ijo-45-05-2005'] } CI, confidence interval; AFP, α-fetoprotein; PIVKA, protein induced by vitamin K antagonists. Univariate analysis was performed using the log-rank test. Multivariate analysis was performed using the Cox proportional hazards model.

Discussion

In the present study, our data support the role of PDSS2 as a suppressor of HCC. PDSS2 mRNA was differentially expressed by HCC cell lines and was decreased in 81% of the HCC tissues. Hypermethylation of the PDSS2 promoter was detected in four HCC cell types that expressed low levels of PDSS2 mRNA. Moreover, PDSS2 mRNA synthesis was reactivated after demethylation, indicating that promoter hypermethylation regulated PDSS2 transcription. To the best of our knowledge, the present study is the first to show a correlation between the expression and methylation status of PDSS2. However, decreased transcription of PDSS2 was detected in some HCC cells without hypermethylation of the PDSS2 promoter. Because PDSS2 is located within chromosome 6q16.3-21, a site of frequent loss of heterozygosity (LOH) in HCC (30,31), we consider LOH as a possible alternative factor leading to dysregulation.

Recent in silico pathway analysis suggests that PDSS2 interacts with HNF4α, a nuclear transcription factor that acts as a tumor suppressor and regulates the expression of many genes involved in cell growth and proliferation (20,32). CDX2 is a tumor suppressor of various malignancies and interacts with HNF4α (28,33). Accordingly, the correlations of mRNA expression between PDSS2, HNF4α and CDX2 were evaluated, and we found that the expression of PDSS2 correlated positively with that of HNF4α. These findings support the function of PDSS2 as a suppressor of HCC, and further pathway analysis will be required to support this conclusion.

PDSSs are heterotetrameric enzymes comprising subunits encoded by PDSS1 (10p12.1) and PDSS2 (15,16). In the absence of prenyl diphosphate synthase activity, CoQ10 is not synthesized (15). Therefore, decreased expression of PDSS2 in the liver tissues may lead to reduced synthesis of CoQ10 by hepatocytes, resulting in the inhibition of tumor suppressors (17,18).

Similar to patients with malignant melanoma and lung cancer, most patients with HCC harbored decreased levels of PDSS2 mRNA in HCC tissues, and their mean level of PDSS2 expression was significantly decreased in HCC tissues compared with non-cancerous liver tissues (16,20). Notably, we show here a stepwise decrease of PDSS2 expression accompanied with chronic inflammation and fibrosis of uninvolved liver. Moreover, our data link the level of PDSS2 expression to tumor differentiation. Taken together, these results suggest that PDSS2 plays a role in suppressing multistep hepatocarcinogenesis.

Because the IHC and qRT-PCR data were consistent, we used the latter to assess the prognostic significance of PDSS2 mRNA levels in a quantitative manner (24,29). We found that decreased PDSS2 mRNA expression in HCCs was significantly associated with more aggressive tumor features, including elevated preoperative serum α-fetoprotein, larger tumor size and serosal infiltration, and therefore, was identified as an independent prognostic factor. Moreover, patients with decreased PDSS2 mRNA levels in their tumor tissues experienced significantly earlier recurrence after curative hepatectomy. Furthermore, the degree of the decrease in PDSS2 expression correlated with UICC stage, indicating that the level of PDSS2 expression reflects the severity of the malignant phenotype of HCC.

Our evidence that PDSS2 act as a tumor suppressor is as follows: i) decreased expression of PDSS2 was frequently detected and the mean level of PDSS2 expression was significantly lower in HCC tissues, and ii) decreased expression of PDSS2 was associated with shorter recurrence free survival and subsequent poor prognosis. PDSS2 expression levels in biopsy or resected tissues may be useful for the prediction of recurrence and poor prognosis, which will facilitate efforts to devise an efficacious therapeutic strategy.

Our data support the conclusion that PDSS2 acts as a tumor suppressor and that its expression is regulated by promoter hypermethylation in HCC. Moreover, decreased expression of PDSS2 mRNA may represent a novel biomarker for predicting the progression and recurrence of HCC.

References