Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
September-2015 Volume 47 Issue 3

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2015 Volume 47 Issue 3

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Quantitative detection of circulating tumor-derived mitochondrial NADH subunit variants as a potential prognostic biomarker for oral cancer

  • Authors:
    • Katsuhiro Uzawa
    • Atsushi Kasamatsu
    • Takao Baba
    • Yasushi Kimura
    • Dai Nakashima
    • Morihiro Higo
    • Yosuke Sakamoto
    • Katsunori Ogawara
    • Masashi Shiiba
    • Hideki Tanzawa
  • View Affiliations / Copyright

    Affiliations: Department of Oral Science, Graduate School of Medicine, Chiba University, Chuo-ku, Chiba 260‑8670, Japan, Department of Dentistry and Oral-Maxillofacial Surgery, Chiba University Hospital, Chiba University, Chuo-ku, Chiba 260‑8670, Japan, Department of Medical Oncology, Graduate School of Medicine, Chiba University, Chuo-ku, Chiba 260‑8670, Japan
  • Pages: 1077-1083
    |
    Published online on: July 15, 2015
       https://doi.org/10.3892/ijo.2015.3083
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Circulating tumor cells (CTCs) and/or their relating molecules are promising determinants during the course of cancer treatment, especially for post-therapeutic monitoring. We recently reported the clinical relevance of detecting circulating tumor-associated mutant mitochondrial DNAs (mut-mtDNAs) at three different regions including the displacement loop, 12S-rRNA and 16S-rRNA in oral squamous cell carcinomas (OSCCs). In the present study, to further investigate if the other mut-mtDNAs have novel efficiency for detecting potential tumoral micrometastasis, mut-mtDNAs on the ND2 and ND3 regions of the genome in 240 clinical samples from patients with OSCC were assessed in vitro and in vivo by quantitative real-time PCR combined with high-resolution melting curve analysis. Furthermore, the clinical relevance was evaluated by the area under the receiver operating characteristic curve (AUC) analysis. Three discrete sequence variations were identified in OSCC derived cell lines at the regions of ND2 (T:A to C:G at position 5108) and ND3 (A:T to G:C at position 10397 and C:G to T:A at position 10400), whereas no mutation was observed in normal control human normal oral keratinocytes. In OSCC patients examined, the presence of mut-mtDNAs in serum during the postoperative period accurately predicted poor prognoses (ND2 AUC, 0.761; ND3 AUC, 0.704). The data presented here provide a novel approach for detecting the circulating mut-mtDNAs that are promising molecular markers for evaluating tumoral micrometastasis in OSCCs.

Introduction

Since conventional approaches cannot detect micrometastasis with high sensitivity, development of novel and effective methods is needed. Circulating tumor cells (CTCs) and/or their specific molecules are important determinants for predicting poor prognosis in patients with cancer (1–4). CTCs also are measured to assess the therapeutic effects of chemotherapy, radiotherapy and chemoradiotherapy (5–8). CTCs or tumor-associated DNAs also have been detected frequently in serum samples from poorly diagnosed patients with oral squamous cell carcinoma (OSCC) (9,10), indicating that this type of blood test is useful during cancer treatment and follow-up to monitor patients for recurrent or metastatic lesions.

Due to low cellular copy numbers of genomic DNAs in serum samples, isolating sufficient DNA for molecular analyses can be difficult. Considering this, we recently reported the clinical relevance of detecting tumor-derived mutant mitochondrial DNAs (mut-mtDNAs) at the regions including the D-loop, 12S-rRNA and 16S-rRNA, the copy numbers of which are much higher than those of genomic DNAs (11). To examine whether discrete mutation(s) may exist in the mitochondorial genome, and moreover, detection of CTCs with the mutant mitochondrial DNA could be useful to predict micrometastasis of patients with OSCC with no histologic evidence of cancer cells in their surgical margins, we used a comprehensive approach for detecting tumor-derived mut-mtDNAs in the ND2 and ND3 regions by quantitative real-time polymerase chain reaction combined with high-resolution melting curve analysis (qRT-PCR-HRMA). This investigation showed compelling evidence that evaluation of circulating tumor-derived mitochondrial DNAs with ND2 and/or ND3 mutation may be an additional clinical tool to monitor the post-operative patients with OSCC.

Materials and methods

Ethical statement

The study protocol was approved by the Ethics Committee of the Graduate School of Medicine, Chiba University (approval number, 236) and was performed in accordance with the ethical standards laid down in the Declaration of Helsinki. Written informed consent was received from all patients or their families.

All experimental animals were treated and cared for in accordance with the guidelines of Chiba University. Experimental animals were sacrificed by cervical dislocation. We made every effort to relieve the pain of experimental animals. The protocol was approved by the Committee on the Ethics of Animal Experiments of Chiba University (approval number, 25-221).

Mutation detection of mtDNA for OSCC cell lines in vitro and in vivo

The human OSCC-derived cell lines Sa3 and HSC-4 were purchased, respectively, from the RIKEN BioResource Center through the National Bioresource Project of the Ministry of Education, Culture, Sports, Science and Technology (Tsukuba, Japan) and the Human Science Research Resources Bank (Osaka, Japan). A DNA profiling procedure validated the cell lines (11). The cells were cultured in the same manner as previously reported (12).

Ten sets of specific PCR primers were prepared for amplification of regions ND2 and ND3 of the human mitochondrial genome. The primer sequences are shown in Table I. The PCR products were subcloned into a pCR8/GW/TOPO TA cloning vector (Invitrogen, Carlsbad, CA, USA), and then sequenced using ABI 3730xl DNA sequencers (Applied Biosystems, Foster City, CA, USA) to validate the identity of the amplified products by comparing them with the MITOMAP database (www.mitomap.org/MITOMAP/HumanMitoSeq).

Table I

The primer sequences used for PCR amplification.

Table I

The primer sequences used for PCR amplification.

Primer sequence (5′-3′)Nucleotide positionsProduct size (bp)
ND2-1F CCTATCACACCCCATCCTAAA4382–4402157
ND2-1R GCTTAGCGCTGTGATGAGTG4519–4538
ND2-2F TACCATCTTTGCAGGCACAC4502–4521175
ND2-2R GATTATGGATGCGGTTGCTT4657–4676
ND2-3F GTTCCACAGAAGCTGCCATC4621–4640191
ND2-3R TCAGAAGTGAAAGGGGGCTA4792–4811
ND2-4F GGAATAGCCCCCTTTCACTT4788–4807215
ND2-4R ATTTTGCGTAGCTGGGTTTG4983–5002
ND2-5F CCATCATAGCAGGCAGTTGA4951–4970228
ND2-5R GCTTGTTTCAGGTGCGAGAT5169–5188
ND2-6F TCGCACCTGAAACAAGCTAA5162–5181208
ND2-6R GGTGGAGTAGATTAGGCGTAGG5348–5369
ND2-7F CACCATCACCCTCCTTAACC5318–5337248
ND2-7R TGCAACTTACTGAGGGCTTTG5545–5565
ND3-1F CCGTTAACTTCCAATTAACTAGTTTTG10012–10038164
ND3-1R GCACTCGTAAGGGGTGGAT10157–10175
ND3-2F ACCACAACTCAACGGCTACA10130–10149169
ND3-2R TTGTAGGGCTCATGGTAGGG10279–10298
ND3-3F CCCTCCTTTTACCCCTACCA10267–10286219
ND3-3R TGTAAATGAGGGGCATTTGG10466–10485

We optimized the conditions and examined the feasibility of using qRT-PCR-HRMA for detecting three discrete sequence variations (ND2-T5108C, ND3-A10397G and ND3-C10400T) in Sa3 and HSC-4 cell lines. Using specific PCR primer sets (Table I), qPCR-HRMA was performed using a LightCycler 480 system (Roche Diagnostics GmbH, Mannheim, Germany) in a final volume of 20 μl of a reaction mixture comprised of 10 μl of LightCycler 480 High Resolution Melting Master Mix (Roche), 3 mM of MgCl2, and 4 μM of the primers, according to the manufacturer's instructions.

The in vivo experiments, i.e., detecting Sa3-derived mut-mtDNAs of the ND2 and ND3 regions in serum samples from BALB/cAnNCrj-nu/nu mice (n=2, Charles River Laboratories, Yokohama, Japan), were performed according to our previous methods (11). In brief, to validate whether mut-mtDNA of the ND2 and/or ND3 regions in human oral cancer cells were detectable quantitatively from peripheral blood samples, we transplanted Sa3 cells (2×106) by subcutaneous injection into BALB/cAnNCrj-nu/nu mice (n=2, Charles River Laboratories). The mice were sacrificed after 6 weeks as previously described (11). The non-Sa3 transplanted mice (n=2) were used as controls and their serum samples were collected. MtDNA was extracted from them for qRT-PCR-HRMA. All mice were maintained under specific pathogen-free conditions. Environmental conditions were a temperature of 24 ±2°C, humidity of 50±10%, lighting of 300 lux and a 12:12 light:dark cycle with lights on at 07:00 and off at 19:00. The mice were housed individually in 210×300×225 mm cages.

The committee of the Chiba University Laboratory Animal Center reviewed and approved the protocol.

Determination of mut-mtDNAs in patients with OSCC

Sixty patients with newly diagnosed OSCC with surgical malignancy-free margins were included. The patients were divided into two groups: 47 patients with a good prognosis with no recurrence and/or metastasis and 13 patients with a poor prognosis with a recurrence or metastasis 17 months post-operatively. Additional patient information is shown in Fig. 1.

Figure 1

Status of mut-mtDNA from 60 patients with OSCC with surgical malignancy-free margins. Note that the sera at post-operative period were defined as positive (black boxes) for mut-mtDNA in at least one region examined in all poor prognosis patients (light red boxes). W, well-differentiated SCC; M, moderately differentiated SCC; P, poorly differentiated SCC.

Overall, we analyzed 240 mtDNAs comprised of normal tissue, tumoral tissue, pre-operative serum samples, and serum samples obtained 4 weeks post-operatively from each patient. To quantify the mut-mtDNAs in each sample, the qRT-PCR-HRMA procedure was performed as previously described (11) with specific primer sets for the ND2 region and the ND3 region (Table I). The amount of each mut-mtDNA in the samples was determined based on the standard curves that were created by diluting mut-mtDNA from Sa3 or HSC-4 with wild-type mtDNAs to prepare 100, 75, 50, 35, 20 and 0% mutated samples for detecting the ND2 or ND3 region in the mtDNA genome as previously described (11).

All results, expressed as the mean ± standard error of the mean, were similar among experiments repeated three times. P-values were analyzed using the Mann-Whitney U-test. P<0.05 was considered significant. Statistical analyses were performed using Microsoft Office Excel 2010 (Microsoft, Seattle, WA, USA). For receiver operating characteristic (ROC) curve analysis, EZR software (Saitama Medical Center, Jichi Medical University, Saitama, Japan) (13) was used. We also utilized the area under the ROC curve (AUC) values with estimated odds ratios and 95% confidence intervals (CIs) to evaluate the diagnostic relevance for predicting the serum mut-mtDNAs in patients with a poor prognosis.

Results

Three homoplasmic nucleotide substitutions defined as single-nucleotide polymorphisms (SNPs) were identified in the ND2 region (T:A to C:G at position 5108) in HSC-4 cells and the ND3 region (A:T to G:C at position 10397 and C:G to T:A at position 10400) in Sa3 cells; no mutation was observed in normal control human normal oral keratinocytes (hNOKs) (Fig. 2A and B). In blood samples from Sa3-xenografted mice, we detected mut-mtDNAs identical to Sa3-associated mut-mtDNAs, but control mice did not have mut-mtDNAs (Table II). The results indicated that this blood test is clinically useful for detecting tumor-related mut-mtDNAs. Based on the melting curves separated by the HRMA chromatogram, we created a standard curve by serial dilution of the DNA from hNOKs (Fig. 2C and D) and detected the mut-mtDNA amounts in samples from the mice and humans examined. Typical results are shown in Fig. 2D.

Figure 2

Determination of a novel variation of the human mitochondrial genome in oral squamous cell carcinoma cells. A representative result of quantitative real-time polymerase chain reaction combined with high-resolution melting curve analysis (qRT-PCR-HRMA) followed by DNA sequence analysis of the HSC-4 cells clearly shows a distinguishable peak (red line) compared with human normal oral keratinocytes (hNOKs) (blue baseline) (A) as a result of a variant sequence (c. 5108T>C at the ND2 region), whereas the hNOKs show wild-type (normal) sequences (B). (C) A plotted standard curve for the ND2 region. The levels of the relative signal differences obtained by qRT-PCR-HRMA (y-axis) are reported as percentages of the mutant mitochondrial DNAs (mut-mtDNAs) by Microsoft Office Excel 2010. The coefficient of correlation is high (r=0.98304). (D) Determination of the mut-mtDNA level in the serum from a Sa3-xenografted mouse (mouse 1). The standard curves were created by diluting mut-mtDNAs (ND2-T5108C) with wild-type mtDNAs to prepare 100, 75, 50, 35, 20 and 0% mutated samples for detecting the ND2 in the mtDNA genome. The fluorescence of the serum sample (red line) normalizes as a differential signal against each standard curve in light blue, enabling detection of 23% of mutant mtDNA in the ND2 region.

Table II

Comparison of Sa3 specific mut-mtDNA levels between xenografted and control mice.

Table II

Comparison of Sa3 specific mut-mtDNA levels between xenografted and control mice.

MouseAnalyzed regionsSerum
No. 1ND223%
ND350%
No. 2ND217%
ND345%
No. 3ND20%
ND30%
No. 4ND20%
ND30%

As previously described (11,14), we isolated sufficient mtDNAs for analysis from clinical samples (n=240) from 60 patients with OSCC (746.8±476 ng/μl, tissue samples; 761.7±340 ng/μl, blood samples). In resected tissues, a significantly (P<0.05) higher concentration of mut-mtDNA was detected in tumoral tissues from patients with a good prognosis and a poor prognosis, compared to each normal counterpart (Fig. 3). The blood test analyzed by qRT-PCR-HRMA indicated that surgery significantly (P<0.05) decreased the circulating mut-mtDNAs in patients with OSCC without recurrence and/or metastasis (Fig. 4A). Compared to the group with a good prognosis, a significant (P<0.05) increase in the circulating tumor-associated mut-mtDNAs was confirmed in the blood samples obtained postoperatively from patients with a poor prognosis (Fig. 4B), all of whom had substantial mut-mtDNA in their serum, without exception, in at least one region examined (Fig. 1).

Figure 3

Comparison of mut-mtDNA levels between tumors and corresponding normal tissues. The statistical significance of the data was determined using the Mann-Whitney U test. P<0.05 was considered significant. The data are expressed as the mean ± standard error of the mean. The horizontal indentations in the boxes (white, normal tissues; black, tumor tissues) indicate the medians. *P<0.05 compared with normal tissues. All experiments were performed in triplicate.

Figure 4

The status of mutant mitochondrial DNA (mut-mtDNAs) levels in patients with oral squamous cell carcinoma preoperatively and postoperatively. The cases without recurrence/metastasis have significantly decreased mut-mtDNAs postoperatively compared to preoperatively (A), whereas significantly increasing mut-mtDNA levels are detected at all regions in serum samples obtained postoperatively from patients with a poor prognosis (B). The statistical significance of the data was determined using the Mann-Whitney U test. P<0.05 is considered significant. *P<0.05. The data are expressed as the mean ± standard error of the mean. The horizontal lines indicate the medians. All experiments were performed in triplicate.

The area under the ROC curve (AUC) values were more sensitive across a range of mut-mtDNA levels in the sera for the risk of recurrence/metastasis than serum SCC antigen (SCC-Ag) levels (Fig. 5). Using the optimal threshold values of 68% (sensitivity, 61.5%; specificity, 87.2%) for ND2, 22.9% (sensitivity, 92.3%; specificity, 51.1%) for ND3, and 1.0 ng/ml (sensitivity, 69.2%; specificity, 51.1%) for SCC-Ag, each AUC was 0.761 [95% confidence interval (CI), 0.580–0.9421, P<0.05], 0.704 (95% CI, 0.5696–0.838, P<0.05) and 0.574 (95% CI, 0.386–0.761, P=0.793), respectively.

Figure 5

Comparison of the area under the receiver operating characteristic (ROC) curve (AUC) of three diagnostic models based on ND2, ND3 or SCC-antigen (SCC-Ag) in sera. To evaluate the diagnostic relevance for predicting the recurrence/metastasis of serum mut-mtDNAs, we used the ROC curve by plotting the sensitivity vs. the specificity. The AUCs for mut-mtDNAs are 0.761 for ND2 (blue line), 0.704 for ND3 (red line), and 0.574 for SCC-Ag (green line). The AUC is a quantitative measure of the success of predicting mut-mtDNAs through comparisons of poor prognosis. The statistical significance of the study data was determined using the Mann-Whitney U-test. P<0.05 was considered significant.

Discussion

CTCs are promising clinical tools in many human cancers (15–17). Evidence indicates that the epithelial cell adhesion molecule is one of the most useful molecular markers for detecting CTCs, including human SCCs (18,19). In contrast, Wirtschafter et al (20) reported that CTCs were validated only in a small portion of patients with head and neck SCC, suggesting limited clinical application.

The present study, in which a unique set of human OSCC specimens was used, found that circulating mut-mtDNAs at the ND2 and/or ND3 regions are significant predictive biomarkers for postoperative recurrence/metastasis in OSCC. Nawroz et al (21) first reported their potential clinical use by detecting tumor-derived microsatellite alterations in serum genomic DNAs in patients with head and neck cancer. Recently, accumulating data on circulating mtDNAs have been published on malignant tumors (22–24) and other human diseases (25–28). From a clinical standpoint, there are several benefits to adopting mtDNA for clinical blood tests: DNA, including genomic DNA and mtDNA, is more stable than RNA, including mRNA and microRNA, and extracted protein; as He et al (14) and we (29) reported, the copy number of the mtDNA is hundreds to thousands of times higher than that of genomic DNA; and a high rate of somatic sequence variations resulting in a pathogenic state are present in patients with OSCC.

We identified cancer-specific somatic variants in the ND2 and ND3 regions (Fig. 1B). These genes encoding ND2 and ND3 are subunits of NADH, which may act as the rate-limiting enzyme of oxidative phosphorylation (30). Alterations in these genes are correlated with human cancers (31–33). It has been proposed that once these genes function abnormally in cancer cells, enhanced reactive oxygen species induces HIF1α stabilization (34,35). Thus, we speculated that genetic mutations identified in the present study, even in SNPs, may be linked partly to the above-mentioned mechanisms for oral tumorigenesis. In this context, several studies have reported an association between SNPs on mtDNA, especially in the ND3 region, and the risk of developing breast cancer (36–38).

We previously described the usefulness of qRT-PCR-HRMA for searching mtDNA mutations with high sensitivity/specificity. As indicated in the present study, our method, even in different regions on the mitochondrial genome, is sufficient for clinical use as well. However, as Kandel (39) pointed out, several issues need attention such as minimization of cellular contamination, determination of mut-mtDNA characteristics specific for OSCC, and elimination of the effect of other diseases.

The study limitations were the small number of OSCC cases and the absence of other human malignancies. However, our data were highly significant for early detection of high-risk individuals with OSCCs, since subjects expected to have a good prognosis who had recurrence/metastasis postoperatively can be distinguished by the level of tumor-derived mtDNA in their serum 4 weeks postoperatively. When a more precise approach for mut-mtDNA detection of CTCs in cancer patients is established, we will identify earlier the patients with undetectable lesions.

Acknowledgements

We thank L.C. Charters for editing the manuscript. The present study was supported by a Grant-in-Aid for Exploratory Research from The Ministry of Education, Culture, Sports, Science and Technology (MEXT) (no. 50236775).

Abbreviations:

CTCs

circulating tumor cells

mut-mtDNA

mutant mitochondorial DNAs

OSCC

oral squamous cell carcinoma

qRT-PCR-HRMA

quantitative real-time polymerase chain reaction combined with high-resolution melting curve analysis

hNOKs

human normal oral keratinocytes

ROC

receiver operating characteristic

CI

confidence interval

SNP

single-nucleotide polymorphism

References

1 

Königsberg R, Gneist M, Jahn-Kuch D, Pfeiler G, Hager G, Hudec M, Dittrich C and Zeillinger R: Circulating tumor cells in metastatic colorectal cancer: Efficacy and feasibility of different enrichment methods. Cancer Lett. 293:117–123. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Mavroudis D: Circulating cancer cells. Ann Oncol. 21(Suppl 7): vii95–v100. 2010. View Article : Google Scholar : PubMed/NCBI

3 

Khan MS, Kirkwood A, Tsigani T, Garcia-Hernandez J, Hartley JA, Caplin ME and Meyer T: Circulating tumor cells as prognostic markers in neuroendocrine tumors. J Clin Oncol. 31:365–372. 2013. View Article : Google Scholar

4 

Bidard FC, Peeters DJ, Fehm T, Nolé F, Gisbert-Criado R, Mavroudis D, Grisanti S, Generali D, Garcia-Saenz JA, Stebbing J, et al: Clinical validity of circulating tumour cells in patients with metastatic breast cancer: A pooled analysis of individual patient data. Lancet Oncol. 15:406–414. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Buglione M1, Grisanti S, Almici C, Mangoni M, Polli C, Consoli F, Verardi R, Costa L, Paiar F, Pasinetti N, et al: Circulating tumour cells in locally advanced head and neck cancer: preliminary report about their possible role in predicting response to non-surgical treatment and survival. Eur J Cancer. 48:3019–3026. 2012. View Article : Google Scholar : PubMed/NCBI

6 

Lu CY, Tsai HL, Uen YH, Hu HM, Chen CW, Cheng TL, Lin SR and Wang JY: Circulating tumor cells as a surrogate marker for determining clinical outcome to mFOLFOX chemotherapy in patients with stage III colon cancer. Br J Cancer. 108:791–797. 2013. View Article : Google Scholar : PubMed/NCBI

7 

Pavese JM and Bergan RC: Circulating tumor cells exhibit a biologically aggressive cancer phenotype accompanied by selective resistance to chemotherapy. Cancer Lett. 352:179–186. 2014. View Article : Google Scholar : PubMed/NCBI

8 

Tinhofer I, Konschak R, Stromberger C, Raguse JD, Dreyer JH, Jöhrens K, Keilholz U and Budach V: Detection of circulating tumor cells for prediction of recurrence after adjuvant chemoradiation in locally advanced squamous cell carcinoma of the head and neck. Ann Oncol. 25:2042–2047. 2014. View Article : Google Scholar : PubMed/NCBI

9 

Hamana K, Uzawa K, Ogawara K, Shiiba M, Bukawa H, Yokoe H and Tanzawa H: Monitoring of circulating tumour-associated DNA as a prognostic tool for oral squamous cell carcinoma. Br J Cancer. 92:2181–2184. 2005. View Article : Google Scholar : PubMed/NCBI

10 

Gröbe A, Blessmann M, Hanken H, Friedrich RE, Schön G, Wikner J, Effenberger KE, Kluwe L, Heiland M, Pantel K, et al: Prognostic relevance of circulating tumor cells in blood and disseminated tumor cells in bone marrow of patients with squamous cell carcinoma of the oral cavity. Clin Cancer Res. 20:425–433. 2014. View Article : Google Scholar

11 

Uzawa K, Baba T, Uchida F, Yamatoji M, Kasamatsu A, Sakamoto Y, Ogawara K, Shiiba M, Bukawa H and Tanzawa H: Circulating tumor-derived mutant mitochondrial DNA: A predictive biomarker of clinical prognosis in human squamous cell carcinoma. Oncotarget. 3:670–677. 2012.PubMed/NCBI

12 

Saito K, Uzawa K, Kasamatsu A, Shinozuka K, Sakuma K, Yamatoji M, Shiiba M, Shino Y, Shirasawa H and Tanzawa H: Oncolytic activity of Sindbis virus in human oral squamous carcinoma cells. Br J Cancer. 101:684–690. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Kanda Y: Investigation of the freely available easy-to-use software ‘EZR' for medical statistics. Bone Marrow Transplant. 48:452–458. 2013. View Article : Google Scholar :

14 

He Y, Wu J, Dressman DC, Iacobuzio-Donahue C, Markowitz SD, Velculescu VE, Diaz LA Jr, Kinzler KW, Vogelstein B and Papadopoulos N: Heteroplasmic mitochondrial DNA mutations in normal and tumour cells. Nature. 464:610–614. 2010. View Article : Google Scholar : PubMed/NCBI

15 

Cen P, Ni X, Yang J, Graham DY and Li M: Circulating tumor cells in the diagnosis and management of pancreatic cancer. Biochim Biophys Acta. 1826:350–356. 2012.PubMed/NCBI

16 

Lianidou ES, Mavroudis D and Georgoulias V: Clinical challenges in the molecular characterization of circulating tumour cells in breast cancer. Br J Cancer. 108:2426–2432. 2013. View Article : Google Scholar : PubMed/NCBI

17 

Romero-Laorden N, Olmos D, Fehm T, Garcia-Donas J and Diaz-Padilla I: Circulating and disseminated tumor cells in ovarian cancer: A systematic review. Gynecol Oncol. 133:632–639. 2014. View Article : Google Scholar : PubMed/NCBI

18 

Bozec A, Ilie M, Dassonville O, Long E, Poissonnet G, Santini J, Chamorey E, Ettaiche M, Chauvière D, Peyrade F, et al: Significance of circulating tumor cell detection using the CellSearch system in patients with locally advanced head and neck squamous cell carcinoma. Eur Arch Otorhinolaryngol. 270:2745–2749. 2013. View Article : Google Scholar : PubMed/NCBI

19 

Driemel C, Kremling H, Schumacher S, Will D, Wolters J, Lindenlauf N, Mack B, Baldus SA, Hoya V, Pietsch JM, et al: Context-dependent adaption of EpCAM expression in early systemic esophageal cancer. Oncogene. 33:4904–4915. 2014. View Article : Google Scholar

20 

Wirtschafter A, Benninger MS, Moss TJ, Umiel T, Blazoff K and Worsham MJ: Micrometastatic tumor detection in patients with head and neck cancer: A preliminary report. Arch Otolaryngol Head Neck Surg. 128:40–43. 2002. View Article : Google Scholar : PubMed/NCBI

21 

Nawroz H, Koch W, Anker P, Stroun M and Sidransky D: Microsatellite alterations in serum DNA of head and neck cancer patients. Nat Med. 2:1035–1037. 1996. View Article : Google Scholar : PubMed/NCBI

22 

Mehra N, Penning M, Maas J, van Daal N, Giles RH and Voest EE: Circulating mitochondrial nucleic acids have prognostic value for survival in patients with advanced prostate cancer. Clin Cancer Res. 13:421–426. 2007. View Article : Google Scholar : PubMed/NCBI

23 

Kohler C, Radpour R, Barekati Z, Asadollahi R, Bitzer J, Wight E, Bürki N, Diesch C, Holzgreve W and Zhong XY: Levels of plasma circulating cell free nuclear and mitochondrial DNA as potential biomarkers for breast tumors. Mol Cancer. 8:1052009. View Article : Google Scholar : PubMed/NCBI

24 

Ellinger J, Müller DC, Müller SC, Hauser S, Heukamp LC, von Ruecker A, Bastian PJ and Walgenbach-Brunagel G: Circulating mitochondrial DNA in serum: A universal diagnostic biomarker for patients with urological malignancies. Urol Oncol. 30:509–515. 2012. View Article : Google Scholar

25 

Tsai NW, Lin TK, Chen SD, Chang WN, Wang HC, Yang TM, Lin YJ, Jan CR, Huang CR, Liou CW, et al: The value of serial plasma nuclear and mitochondrial DNA levels in patients with acute ischemic stroke. Clin Chim Acta. 412:476–479. 2011. View Article : Google Scholar

26 

Bliksøen M, Mariero LH, Ohm IK, Haugen F, Yndestad A, Solheim S, Seljeflot I, Ranheim T, Andersen GØ, Aukrust P, et al: Increased circulating mitochondrial DNA after myocardial infarction. Int J Cardiol. 158:132–134. 2012. View Article : Google Scholar : PubMed/NCBI

27 

Kung CT, Hsiao SY, Tsai TC, Su CM, Chang WN, Huang CR, Wang HC, Lin WC, Chang HW, Lin YJ, et al: Plasma nuclear and mitochondrial DNA levels as predictors of outcome in severe sepsis patients in the emergency room. J Transl Med. 10:1302012. View Article : Google Scholar : PubMed/NCBI

28 

Qiu C, Hevner K, Enquobahrie DA and Williams MA: A case-control study of maternal blood mitochondrial DNA copy number and preeclampsia risk. Int J Mol Epidemiol Genet. 3:237–244. 2012.PubMed/NCBI

29 

Lai CH, Huang SF, Liao CT, Chen IH, Wang HM and Hsieh LL: Clinical significance in oral cavity squamous cell carcinoma of pathogenic somatic mitochondrial mutations. PLoS One. 8:e655782013. View Article : Google Scholar : PubMed/NCBI

30 

Kumazaki T, Sakano T, Yoshida T, Hamada K, Sumida H, Teranishi Y, Nishiyama M and Mitsui Y: Enhanced expression of mitochondrial genes in senescent endothelial cells and fibroblasts. Mech Ageing Dev. 101:91–99. 1998. View Article : Google Scholar : PubMed/NCBI

31 

Liu VW, Shi HH, Cheung AN, Chiu PM, Leung TW, Nagley P, Wong LC and Ngan HY: High incidence of somatic mitochondrial DNA mutations in human ovarian carcinomas. Cancer Res. 61:5998–6001. 2001.PubMed/NCBI

32 

Kumimoto H1, Yamane Y, Nishimoto Y, Fukami H, Shinoda M, Hatooka S and Ishizaki K: Frequent somatic mutations of mitochondrial DNA in esophageal squamous cell carcinoma. Int J Cancer. 108:228–231. 2004. View Article : Google Scholar

33 

Prior SL, Griffiths AP, Baxter JM, Baxter PW, Hodder SC, Silvester KC and Lewis PD: Mitochondrial DNA mutations in oral squamous cell carcinoma. Carcinogenesis. 27:945–950. 2006. View Article : Google Scholar : PubMed/NCBI

34 

Sun W, Zhou S, Chang SS, McFate T, Verma A and Califano JA: Mitochondrial mutations contribute to HIF1alpha accumulation via increased reactive oxygen species and up-regulated pyruvate dehydrogenease kinase 2 in head and neck squamous cell carcinoma. Clin Cancer Res. 15:476–484. 2009. View Article : Google Scholar : PubMed/NCBI

35 

Singh RK, Srivastava A, Kalaiarasan P, Manvati S, Chopra R and Bamezai RN: mtDNA germ line variation mediated ROS generates retrograde signaling and induces pro-cancerous metabolic features. Sci Rep. 4:65712014. View Article : Google Scholar : PubMed/NCBI

36 

Bai RK, Leal SM, Covarrubias D, Liu A and Wong LJ: Mitochondrial genetic background modifies breast cancer risk. Cancer Res. 67:4687–4694. 2007. View Article : Google Scholar : PubMed/NCBI

37 

Covarrubias D, Bai RK, Wong LJ and Leal SM: Mitochondrial DNA variant interactions modify breast cancer risk. J Hum Genet. 53:924–928. 2008. View Article : Google Scholar : PubMed/NCBI

38 

Czarnecka AM, Krawczyk T, Zdrozny M, Lubiński J, Arnold RS, Kukwa W, Scińska A, Golik P, Bartnik E and Petros JA: Mitochondrial NADH-dehydrogenase subunit 3 (ND3) polymorphism (A10398G) and sporadic breast cancer in Poland. Breast Cancer Res Treat. 121:511–518. 2010. View Article : Google Scholar

39 

Kandel ES: Mutations in circulating mitochondrial DNA: Cassandra of oral cancer? Oncotarget. 3:664–665. 2012.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Uzawa K, Kasamatsu A, Baba T, Kimura Y, Nakashima D, Higo M, Sakamoto Y, Ogawara K, Shiiba M, Tanzawa H, Tanzawa H, et al: Quantitative detection of circulating tumor-derived mitochondrial NADH subunit variants as a potential prognostic biomarker for oral cancer. Int J Oncol 47: 1077-1083, 2015.
APA
Uzawa, K., Kasamatsu, A., Baba, T., Kimura, Y., Nakashima, D., Higo, M. ... Tanzawa, H. (2015). Quantitative detection of circulating tumor-derived mitochondrial NADH subunit variants as a potential prognostic biomarker for oral cancer. International Journal of Oncology, 47, 1077-1083. https://doi.org/10.3892/ijo.2015.3083
MLA
Uzawa, K., Kasamatsu, A., Baba, T., Kimura, Y., Nakashima, D., Higo, M., Sakamoto, Y., Ogawara, K., Shiiba, M., Tanzawa, H."Quantitative detection of circulating tumor-derived mitochondrial NADH subunit variants as a potential prognostic biomarker for oral cancer". International Journal of Oncology 47.3 (2015): 1077-1083.
Chicago
Uzawa, K., Kasamatsu, A., Baba, T., Kimura, Y., Nakashima, D., Higo, M., Sakamoto, Y., Ogawara, K., Shiiba, M., Tanzawa, H."Quantitative detection of circulating tumor-derived mitochondrial NADH subunit variants as a potential prognostic biomarker for oral cancer". International Journal of Oncology 47, no. 3 (2015): 1077-1083. https://doi.org/10.3892/ijo.2015.3083
Copy and paste a formatted citation
x
Spandidos Publications style
Uzawa K, Kasamatsu A, Baba T, Kimura Y, Nakashima D, Higo M, Sakamoto Y, Ogawara K, Shiiba M, Tanzawa H, Tanzawa H, et al: Quantitative detection of circulating tumor-derived mitochondrial NADH subunit variants as a potential prognostic biomarker for oral cancer. Int J Oncol 47: 1077-1083, 2015.
APA
Uzawa, K., Kasamatsu, A., Baba, T., Kimura, Y., Nakashima, D., Higo, M. ... Tanzawa, H. (2015). Quantitative detection of circulating tumor-derived mitochondrial NADH subunit variants as a potential prognostic biomarker for oral cancer. International Journal of Oncology, 47, 1077-1083. https://doi.org/10.3892/ijo.2015.3083
MLA
Uzawa, K., Kasamatsu, A., Baba, T., Kimura, Y., Nakashima, D., Higo, M., Sakamoto, Y., Ogawara, K., Shiiba, M., Tanzawa, H."Quantitative detection of circulating tumor-derived mitochondrial NADH subunit variants as a potential prognostic biomarker for oral cancer". International Journal of Oncology 47.3 (2015): 1077-1083.
Chicago
Uzawa, K., Kasamatsu, A., Baba, T., Kimura, Y., Nakashima, D., Higo, M., Sakamoto, Y., Ogawara, K., Shiiba, M., Tanzawa, H."Quantitative detection of circulating tumor-derived mitochondrial NADH subunit variants as a potential prognostic biomarker for oral cancer". International Journal of Oncology 47, no. 3 (2015): 1077-1083. https://doi.org/10.3892/ijo.2015.3083
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team