Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
October 2014 Volume 10 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October 2014 Volume 10 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Visceral adipose tissue‑derived serine protease inhibitor inhibits interleukin‑1β‑induced catabolic and inflammatory responses in murine chondrocytes

  • Authors:
    • Jia‑Peng Bao
    • Li‑Feng Jiang
    • Jing Li
    • Wei‑Ping Chen
    • Peng‑Fei Hu
    • Li‑Dong Wu
  • View Affiliations / Copyright

    Affiliations: Department of Orthopedics Surgery, The Second Hospital of Medical College, Zhejiang University, Hangzhou, Zhejiang 310009, P.R. China
  • Pages: 2191-2197
    |
    Published online on: August 11, 2014
       https://doi.org/10.3892/mmr.2014.2478
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Visceral adipose tissue‑derived serine protease inhibitor (vaspin) is a newly identified member of the adipocytokine family, whose precise role in chondrocyte metabolism remains to be elucidated. The aim of the present study was to investigate the effect of vaspin on chondrocytes. The cell viability and the cytotoxicity of vaspin in chondrocytes were examined. Furthermore, the gene expression of matrix metalloproteinases‑2 and -9, a disintegrin and metalloproteinase with thrombospondin motifs 4 and 5 and cathepsin D was also examined, as well as the protein production of cyclooxygenase‑2, prostaglandin E2 and inducible nitrous oxide synthase following treatment with different concentrations of vaspin in the absence or presence of interleukin‑1‑beta (IL‑1β). In addition, the protein levels of the inhibitor of nuclear factor‑κB (IκB‑α) and the phosphorylation of nuclear factor kappa B (NF‑κB) were investigated. Vaspin was not able to stimulate the proliferation of chondrocytes and demonstrated no significant cytotoxic effect at concentrations of 10‑500 ng/ml following coincubation for 24 and 48 h. However, vaspin inhibited IL‑1β‑induced production of catabolic factors and inflammatory mediators in chondrocytes, and also suppressed the phosphorylation of NF‑κB and the degradation of IκB‑α. The data from the present study suggested that vaspin has a protective effect in chondrocyte metabolism and is an important factor in the pathophysiology of osteoarthritis.

Introduction

Osteoarthritis (OA) is a chronic cartilage and joint disease among elderly individuals, primarily characterized by articular cartilage breakdown, osteophyte formation, subchondral sclerosis and synovium alterations (1). Cartilage degeneration, which impairs function and causes pain and disability, is known to contribute to major structural alterations in the joint. Inflammatory cytokines, including interleukin-1 beta (IL-1β), cyclooxygenase-2 (COX-2), prostaglandin E2 (PGE2) and nitric oxide (NO) as well as catabolic factors, including matrix metalloproteinases (MMPs), a disintegrin and metalloprotease with thrombospondin motifs (ADAMTS) and cathepsins are major mediators of disturbed chondrocyte function and cartilage degeneration (2). In addition, age, gender, injury and obesity are considered to be major risk factors for the progression of OA (3). Previous studies have revealed that not only the knee and hip OA were closely associated with obesity, but also the non-weight bearing joints, such as the hand OA, were more frequent in obese individuals (4,5), however, the reasons for this remain to be elucidated. Furthermore, adipokines secreted by white adipose tissue are considered to be a link between obesity and OA, particularly in non-weight bearing joints (6). Accumulating evidence suggested that adipokines, including leptin, adiponectin, resistin, visfatin and apelin exert pro-inflammatory/anti-inflammatory and catabolic/anabolic roles during the pathophysiology of OA (7).

Visceral adipose tissue-derived serine protease inhibitor (vaspin) was identified as a novel adipocytokine, which has been found to be expressed in the visceral adipose tissue of Otsuka Long-Evans Tokushima Fatty rats at an age when obesity and insulin resistance peaked (8). Several human tissues, including adipose tissue (9,10), skin (11), stomach (12), liver and pancreas (13) have been found to express vaspin. Serum vaspin levels were paradoxically elevated in human subjects with diabetes and obesity (14). Notably, several studies demonstrated novel links between vaspin and arthritis (15,16). Ozgen et al (15) found that serum vaspin levels were higher in rheumatoid arthritis (RA) compared with healthy controls. Furthermore, the serum vaspin level was increased following glucocorticoid treatment but unaffected following adalimumab treatment in RA patients (16). In addition, another study (17) identified increased levels of vaspin in the synovial fluid of patients with RA compared with those with OA. These data suggest a possible role of vaspin in the pathophysiology of arthritis.

Previously, Kamio et al (18) demonstrated that vaspin inhibited receptor activator of nuclear factor-κB ligand (RANKL)-induced osteoclastogenesis in RAW264.7 cells and bone marrow cells (BMCs). Vaspin also inhibited the RANKL-induced upregulation of MMP-9 and cathepsin K in RAW264.7 cells (18), which suggested that vaspin was important in bone metabolism. However, to the best of our knowledge, there are currently no studies investigating the effect of vaspin on chondrocytes. The aim of the present study was to detect the role of vaspin in chondrocytes. Initially, the effect of vaspin on normal chondrocyte viability and gene expression of MMP-2, MMP-9, ADAMTS-4, ADAMTS-5 and cathepsin was assessed, as well as the effect of vaspin on the secretion of COX-2, PGE2 and iNOS. Secondly, the effect of vaspin on IL-1β-induced catabolic and inflammatory responses in chondrocytes was evaluated. In addition, the present study investigated the effect of vaspin on the IL-1β-induced nuclear factor-kappaB (NF-κB) signaling pathway activation in chondrocytes.

Materials and methods

Isolation and culture of primary rat articular chondrocytes

Rat articular chondrocytes for primary culture were isolated from the knee joints of 4-week-old Sprague-Dawley rats obtained from The Animal Center of Zhejiang University (Hangzhou, China). The study was approved by the ethics committee of The Second Hospital of Medical College, Zhejiang University (Hangzhou, China). The harvested cartilage samples were cut into 1 mm3 cubes and digested for 0.5 h with 0.2% pronase (Sigma, St. Louis, MO, USA), followed by digestion for 4 h with 0.1% collagenase (Sigma) at 37°C. The released chondrocytes were cultured in 25 cm2 culture flasks in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum, 100 U/ml penicillin and 100 μg/ml streptomycin (Invitrogen Life Technologies, Carlsbad, CA, USA) in a 5% CO2 atmosphere at 37°C. Chondrocytes were passaged at a ratio of 1:3 with 0.05% trypsin (Life Technologies, Hangzhou, China) up to 80% confluence. Cultured chondrocytes at passage 3 were used to avoid loss of chondrocyte phenotype with successive passages.

Assessment of cell viability

Cytotoxicity of vaspin to chondrocytes was evaluated using a Cell Counting kit-8 (CCK-8; Dojindo Laboratories, Kumamoto, Japan) according to the manufacturer’s instructions. Chondrocytes were cultured in 96-well plates at a density of 2×104 cells/cm3 and the cytotoxicity was assessed in the presence of increasing concentrations of vaspin (0, 10, 50, 100, 250 and 500 ng/ml). Cell proliferation was examined 24 and 48 h after the addition of vaspin. At the indicated time points, 100 μl fresh medium and 10 μl CCK-8 solution were added to each well of the plate, and the chondrocytes were incubated for 2 h. Absorbance of 450 nm was measured using a microplate reader (Bio-Rad, Hercules, CA, USA).

Quantitative polymerase chain reaction (qPCR) analysis of MMP-2, MMP-9, ADAMTS-4, ADAMTS-5 and cathepsin D

Rat chondrocytes were treated with various concentrations of vaspin (0, 10, 50, 100, 250 and 500 ng/ml) for 24 h, while other chondrocytes were pretreated with various concentrations of vaspin for 1 h prior to treatment with IL-1β (10 ng/ml) for 24 h. The gene expression was analyzed by qPCR. Total RNA was isolated from monolayer chondrocytes using TRIzol reagent (Invitrogen Life Technologies) according to the manufacturer’s instructions, dissolved in diethylpyrocarbonate-treated water and stored at -80°C prior to use. Total RNA (1 μg) was used for synthesis of cDNA by reverse transcription, using the PrimeScript-RT reagent kit (Takara Bio., Inc., Shiga, Japan), and the reverse transcription reaction product was analyzed by qPCR using the SYBR Premix Ex Taq (Takara Bio., Inc.), according to the manufacturer’s instructions. The target gene primers used are shown in Table I. A parallel amplification of 18S (NR046237.1) was performed to normalize expression data of the targeted gene transcript. Relative expression level data were analyzed using the 2−ΔΔCt method.

Table I

Primers of targeted genes.

Table I

Primers of targeted genes.

Targeted geneSequence (5′-3′)aAmplicon length (bp)Accession number
MMP-2F: AGGATGGAGGCACGATTGG
R: CTTGATGATGGGCGACGGT111NM031054
MMP-9F: ACCCCATGTATCACTACCACGAG
R: TCAGGTTTAGAGCCACGACCAT91NM031055
ADAMTS-4F: GCCAGCAACCGAGGTCCCATA
R: CCACCAGTGTCTCCACGAATCTAC113XM001053685
ADAMTS-5F: GGGGTCAGTGTTCTCGCTCTTG
R: GCCGTTAGGTGGGCAGGGTAT146AY382879
Cathepsin DF: CAGGCADATCGTAAGTGGC
R: GTCGTGGAAAGGACAGTTGG51NM134334
18SF: TTGACGGAAGGGCACCA
R: CAGACAAATCGCTCCACCAA165NR046237.1

a F, forward; R, reverse.

ELISA analysis of COX-2, PGE2 and iNOS in the culture medium

Rat chondrocytes were treated with various concentrations of vaspin (0, 10, 50, 100, 250 and 500 ng/ml) for 24 h, while other chondrocytes were pretreated with various concentrations of vaspin for 1 h prior to IL-1β treatment (10 ng/ml) for 24 h. The effect of IL-1β and/or vaspin on the levels of COX-2, PGE2 and iNOS secreted by articular chondrocytes in the culture medium was further detected by commercially available ELISA kits (R&D Systems, Inc., Minneapolis, MN, USA) according to the manufacturer’s instructions. All assays were performed in duplicate.

Western blot analysis of p-NF-κB and IκB-α

Confluent articular chondrocytes were incubated in serum-free medium for 24 h. The chondrocytes were pre-treated with various doses of vaspin (0, 10, 50, 100, 250 and 500 ng/ml) for 1 h prior to IL-1β (10 ng/ml) for 24 h. All chondrocytes were washed twice with ice-cold phosphate-buffered saline, harvested using a scraper and then the cytoplasmic proteins were isolated using an extraction kit (Beyotime Institute of Biotechnology, Jiangsu, China). Samples were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis, transferred onto nitrocellulose filters and probed with the following primary antibodies: p-NF-κB and IκB-α (rabbit monoclonal anti-mouse; Cell Signaling Technology, Hangzhou, China) overnight at 4°C. The membranes were washed and incubated for 1 h at room temperature with horseradish peroxidase-linked secondary antibodies (goat monoclonal anti-rabbit). Detection was performed with enhanced chemiluminescence using a commercially available kit according to the manufacturer’s instructions (Cell Signaling Technology) and the density of each band was measured by densitometry using Quantity One Software (Bio-Rad Laboratories Inc., Munich, Germany).

Statistical analysis

All experiments were performed three times using independent samples. Data are expressed as the mean ± standard deviation. Statistical analyses were performed using SPSS 19.0 for Windows software (SPSS, Inc., Chicago, IL, USA). Statistical significance was determined using Student’s t-test and one-way analysis of variance. P<0.05 was considered to indicate a statistically significant difference.

Results

Effects of vaspin on chondrocyte viability

In order to rule out direct cytotoxic effects, a CCK-8 test was performed. As shown in Fig. 1, the results indicated that vaspin at concentrations of 10, 50, 100, 250 and 500 ng/ml after 24 and 48 h of culture demonstrated no significant cytotoxic effect on chondrocytes. However, no chondrocyte proliferation effects of vaspin were identified at any of these concentrations.

Figure 1

Effects of vaspin on cell viability. Chondrocytes were initially plated in each well of a 96-well plate and treated with different concentrations of vaspin (0, 10, 50, 100, 250 and 500 ng/ml) for 24 and 48 h. The cells were then evaluated using a cell-counting-kit-8 assay. Values are expressed as the mean ± standard deviation of three independent experiments. Vaspin, visceral adipose tissue-derived serine protease inhibitor.

Effects of vaspin on the production of catabolic factors and inflammatory cytokines in rat chondrocytes

Following treatment with vaspin for 24 h, the expression of MMP-2, MMP-9, ADAMTS-4, ADAMTS-5 and cathepsin D were detected using qPCR. As shown in Fig. 2, vaspin (10, 50, 100, 250 and 500 ng/ml) alone did not affect the gene expression of these catabolic factors. As noted in Fig. 3, the secretion levels of COX-2, PGE2 and iNOS in chondrocytes decreased following treatment with vaspin, however, not significantly.

Figure 2

Effects of vaspin on the gene expression of MMP-2, MMP-9, ADAMTS-4, ADAMTS-5 and cathepsin D. All the mRNA expression levels were not affected by vaspin at different concentrations. The results are representative of three experiments. MMP, matrix metalloproteinase; ADAMTS, a disintegrin and metalloproteinase with thrombospondin motif; vaspin, visceral adipose tissue-derived serine protease inhibitor.

Figure 3

Effects of vaspin on COX-2, PGE2 and iNOS production. Chondrocytes were treated with concentrations of vaspin (0, 10, 50, 100, 250 and 500 ng/ml) for 1 h prior to treatment with IL-1β (10 ng/ml) for 24 h. The results are representative of three experiments. *P<0.05 and **P<0.01, vaspin-treated chondrocytes compared with chondrocytes stimulated with IL-1β alone. COX-2, cyclooxygenase-2; PGE2 prostaglandin E2; iNOS, inducible nitrous oxide synthase; vaspin, visceral adipose tissue-derived serine protease inhibitor; IL-1β, interleukin-1β.

Effects of vaspin on IL-1β-induced MMP-2, MMP-9, ADAMTS-4, ADAMTS-5 and cathepsin D mRNA in rat chondrocytes

Following stimulation with IL-1β (10 ng/ml; Fig. 4), rat chondrocytes demonstrated marked upregulation of MMP-2, MMP-9, ADAMTS-4, ADAMTS-5 and cathepsin D. Vaspin inhibited MMP-2, MMP-9, ADAMTS-5 and cathepsin D but not ADAMTS-4 in low concentrations and failed to inhibit the production of IL-1β-induced catabolic factors in high concentrations.

Figure 4

Effects of vaspin on IL-1β-induced gene expression of MMP-2, MMP-9, ADAMTS-4, ADAMTS-5 and cathepsin D in chondrocytes. Chondrocytes were pretreated with various concentrations of vaspin (0, 10, 50, 100, 250 and 500 ng/ml) for 1 h prior to treatment with IL-1β (10 ng/ml) for 24 h. The results are representative of three experiments. *P<0.05 and **P<0.01, vaspin-treated chondrocytes compared with chondrocytes stimulated with IL-1β alone. MMP, matrix metalloproteinase; ADAMTS, a disintegrin and metalloproteinase with thrombospondin motif; vaspin, visceral adipose tissue-derived serine protease inhibitor.

Effects of vaspin on IL-1β-induced COX-2, PGE2 and iNOS production in rat chondrocytes

Following stimulation with IL-1β (10 ng/ml; Fig. 3), the production of COX-2, PGE2 and iNOS from the culture medium of rat chondrocytes significantly increased. Vaspin inhibited all these inflammatory cytokines in a dose-dependent manner.

Effects of vaspin on the NF-κB pathway induced by treatment with IL-1β in rat chondrocytes

In order to investigate the mechanisms of vaspin mediated-inhibition of IL-1β-induced catabolic and inflammatory responses, cultured rat chondrocytes were treated with either IL-1β alone or with various concentrations of vaspin for 24 h. The phosphorylation of NF-κB and IκB-α were evaluated by western blotting. Vaspin pretreatment at different concentrations (10, 50, 100, 250 and 500 ng/ml), prior to IL-1β stimulation, inhibited IL-1β-induced NF-κB phosphorylation in a dose-dependent manner (Fig. 5). In addition, the degradation of IκB-α induced by IL-1β was also inhibited by vaspin (Fig. 5).

Figure 5

Effects of vaspin on IL-1β-induced phosphorylation of NF-κB and degradation of IκB-α in chondrocytes. Chondrocytes were pretreated with various concentrations of vaspin (0, 10, 50, 100, 250 and 500 ng/ml) for 1 h prior to treatment with IL-1β (10 ng/ml) for 24 h. The phosphorylation of NF-κB and the expression of IκB-α were determined by (A) western blot analysis. (B) Densitometry data was also assessed. The results are representative of three experiments. *P<0.05 and **P<0.01, vaspin-treated chondrocytes compared with chondrocytes stimulated with IL-1β alone. IL-1β, interleukin-1β; NF-κB, nuclear factor-kappaB; IκB-α, inhibitor of kappa B-α; vaspin, visceral adipose tissue-derived serine protease inhibitor.

Discussion

Vaspin has been suggested to be a ‘good’ adipokine similar to adiponectin (19). Administration of vaspin to obese mice improved glucose tolerance and elevated insulin sensitivity (20). A study by Kadoglou et al demonstrated a protective effect of vaspin against atherosclerosis and cardiovascular events (21). In addition, several studies have demonstrated that vaspin may act as an anti-apoptotic and anti-inflammatory cytokine in certain cell types (22–24). Phalitakul et al (22) demonstrated that vaspin inhibited methylglyoxal-induced endothelial cell apoptosis by preventing caspase-3 activation via the inhibition of NADPH oxidase-derived reactive oxygen species (ROS) generation. Another study by the same group (23) revealed that vaspin prevented tumor necrosis factor-α (TNF-α)-induced intracellular adhesion molecule-1 via inhibiting ROS-dependent NF-κB and protein kinase C-θ (PKCθ) activation in cultured rat vascular smooth muscle cells (SMCs). This suggested that vaspin had an inhibitory effect on the inflammatory state of SMCs. Furthermore, vaspin was able to suppress the expression of pro-inflammatory cytokines, including leptin, TNF-α and resistin in chronic hepatitis (24). However, another study by Fu et al (25) failed to demonstrate that vaspin inhibited TNF-α-induced inflammation in human umbilical vein endothelial cells. These results strongly suggested that vaspin may act as an anti-inflammatory adipokine in metabolic diseases.

As a newly identified adipokine, the role of vaspin on chondrocytes and on the pathophysiology of OA remains to be elucidated. To the best of our knowledge, the present study is the first to investigate the effect of vaspin on chondrocytes. Our previous studies demonstrated that two important adipokines, leptin and apelin, had a catabolic effect on the articular cartilage by stimulating the expression of inflammatory and catabolic factors (26,27). However, another adipokine adiponectin was suggested to have a protective role in the development of OA (28,29). The present study aimed to reveal the precise role of this novel adipokine on chondrocytes.

The present study demonstrated that vaspin had no cytotoxicity when the concentration reached 500 ng/ml. Following treatment with different concentrations of vaspin, no significant change was observed in the gene expression of catabolic factors MMP-2, MMP-9, ADAMTS-4, ADAMTS-5 and cathepsin. The present data indicated that vaspin alone in chondrocytes demonstrated neither catabolic nor anti-catabolic effects. However, low concentrations of vaspin significantly inhibited IL-1β-induced MMP-2, MMP-9, ADAMTS-5 and cathepsin D but not ADAMTS-4 gene expression. Increased expression of MMP-2 and MMP-9 in pathological chondral, meniscal and synovial lesions of OA was considered to be important in OA pathophysiology (30). These two key MMPs, also termed gelatinase-A and gelatinase-B, could degrade numerous substrates, including collagens type IV, V, VII, X, cartilage-specific type XI, aggrecan core protein and significant collagen type II (31,32). In addition, another important aggrecanase ADAMTS-5 (aggrecanase-2) was also suppressed markedly by vaspin in IL-1β-induced chondrocytes. Notably, ADAMTS-4 and -5 were the most efficient aggrecanases and the most likely candidates to have a role in OA (33). In addition, low concentrations of vaspin also inhibited IL-1β-induced production of cathepsin D, which contribute to the proteolytic processing of the core protein of aggrecan in the initial stages of OA (34). These results suggested that low concentrations of vaspin have an anti-catabolic effect on chondrocytes in the presence of the proinflammatory agent IL-1β, by inhibiting MMPs, aggrecanases and cathespin production.

Following treatment with different concentrations of vaspin, the inflammatory mediators COX-2, PGE2 and iNOS secreted by chondrocytes decreased but not significantly, which suggested that vaspin may have an anti-inflammatory effect on the metabolism of chondrocytes. Furthermore, the production of COX-2, PGE2 and iNOS induced by IL-1β was significantly suppressed by vaspin in a dose-dependent manner in the present study. COX-2 and iNOS are two important inflammatory factors involved in the pathophysiology of OA, whose expression could be induced by IL-1β (35). COX-2 and iNOS led to the release of PGE2 and NO in chondrocytes, which has been demonstrated to increase MMP production and be implicated in joint pain in OA (36,37). PGE2 has also been implicated in the inflammation and cartilage degradation associated with OA (38,39). Several studies have reported that vaspin exhibits anti-inflammatory properties in a variety of cell types (23,24). The present study demonstrated for the first time, to the best of our knowledge, that vaspin prevented IL-1β-induced COX-2, PGE2 and iNOS production in rat normal chondrocytes, which suggested that vaspin has anti-inflammatory effects in the presence of the pro-inflammatory agent IL-1β on chondrocytes.

The current study also investigated the molecular mechanisms by which vaspin inhibited the inflammatory mediators in response to IL-1β in chondrocytes. The results suggested that vaspin suppressed IL-1β-induced phosphorylation of NF-κB and inhibited IL-1β-induced IκB-α degradation in chondrocytes. NF-κB is a crucial signaling molecule in regulating the expression of inflammatory and catabolic factors in chondrocytes (40). The NF-κB family exists in unstimulated cells bound to the IκB family protein, and the NF-κB/IκB complex is not able translocate to the nucleus. IκB degradation is tightly regulated by pro-inflammatory cytokines, including IL-1β, which then phosphorylate NF-κB and transport it from the cytoplasm to the nucleus, where it binds to the promoter regions of target genes, including inflammatory mediators and catabolic factors (41,42). In the current study, IL-1β induced the phosphorylation of NF-κB in chondrocytes and this was inhibited by vaspin. These results were partly supported by Phalitakul et al (23), who revealed that vaspin significantly inhibited TNF-α-induced phosphorylation of NF-κB in SMCs. Additionally, Li et al also reported that vaspin inhibited high glucose-induced SMC proliferation and chemokinesis by preventing ROS activation and mitogen-activated protein kinase (MAPK) phosphatidylinositol 3-kinase (PI3K/Akt) and NF-κB signaling (43). The previous studies together with the present study suggest that the anti-catabolic and anti-inflammatory effects of vaspin may partly be associated with the inhibition of NF-κB activation. However, the exact mechanism and the effects of vaspin on other signaling pathways, including PKCθ, MAPK and PI3K/Akt remain to be elucidated. Further studies are required to elucidate the precise mechanism underlying the effect of vaspin on the chondrocyte inflammatory process.

In conclusion, the present study demonstrated that low concentrations of vaspin inhibited the IL-1β-induced expression of catabolic factors, including MMP-2, MMP-9, ADAMTS-5 and cathepsin D. In addition, the present study revealed that the production of inflammatory mediators COX-2, PGE2 and iNOS induced by IL-1β could be suppressed by vaspin in a dose-dependent manner in chondrocytes suggesting that vaspin has anti-catabolic and anti-inflammatory effects and that it may also be a potential protective cytokine during the development of OA. Furthermore, this role may be in part due to the inhibition of IL-1β-induced activation of the NF-κB signaling pathway.

Acknowledgements

This study was supported by the National Natural Science Foundation of China (no. 81201429).

References

1 

Krasnokutsky S, Samuels J and Abramson SB: Osteoarthritis in 2007. Bull NYU Hosp Jt Dis. 65:222–228. 2007.

2 

Kapoor M, Martel-Pelletier J, Lajeunesse D, Pelletier JP and Fahmi H: Role of proinflammatory cytokines in the pathophysiology of osteoarthritis. Nat Rev Rheumatol. 71:33–42. 2011. View Article : Google Scholar

3 

Goldring MB and Goldring SR: Osteoarthritis. J Cell Physiol. 213:626–634. 2007. View Article : Google Scholar : PubMed/NCBI

4 

Yusuf E: Metabolic factors in osteoarthritis: obese people do not walk on their hands. Arthritis Res Ther. 14:1232012. View Article : Google Scholar : PubMed/NCBI

5 

Cicuttini FM, Baker JR and Spector TD: The association of obesity with osteoarthritis of the hand and knee in women: a twin study. J Rheumatol. 23:1221–1226. 1996.PubMed/NCBI

6 

Yusuf E: Metabolic factors in osteoarthritis: obese people do not walk on their hands. Arthritis Res Ther. 14:1232012. View Article : Google Scholar : PubMed/NCBI

7 

Bay-Jensen AC, Slagboom E, Chen-An P, et al: Role of hormones in cartilage and joint metabolism: understanding an unhealthy metabolic phenotype in osteoarthritis. Menopause. 20:578–586. 2013.PubMed/NCBI

8 

Hida K, Wada J, Eguchi J, et al: Visceral adipose tissue-derived serine protease inhibitor: a unique insulin-sensitizing adipocytokine in obesity. Proc Natl Acad Sci USA. 102:10610–10615. 2005. View Article : Google Scholar

9 

Fain JN, Buehrer B, Bahouth SW, Tichansky DS and Madan AK: Comparison of messenger RNA distribution for 60 proteins in fat cells vs the nonfat cells of human omental adipose tissue. Metabolism. 57:1005–1015. 2008. View Article : Google Scholar : PubMed/NCBI

10 

Klöting N, Berndt J, Kralisch S, et al: Vaspin gene expression in human adipose tissue: association with obesity and type 2 diabetes. Biochem Biophys Res Commun. 339:430–436. 2006.

11 

Meyer-Hoffert U: Reddish, scaly, and itchy: how proteases and their inhibitors contribute to inflammatory skin diseases. Arch Immunol Ther Exp (Warsz). 57:345–354. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Klöting N, Kovacs P, Kern M, et al: Central vaspin administration acutely reduces food intake and has sustained blood glucose-lowering effects. Diabetologia. 54:1819–1823. 2011.

13 

Körner A, Neef M, Friebe D, et al: Vaspin is related to gender, puberty and deteriorating insulin sensitivity in children. Int J Obes (Lond). 35:578–586. 2011.PubMed/NCBI

14 

Youn BS, Klöting N, Kratzsch J, et al: Serum vaspin concentrations in human obesity and type 2 diabetes. Diabetes. 57:372–377. 2008. View Article : Google Scholar : PubMed/NCBI

15 

Ozgen M, Koca SS, Dagli N, Balin M, Ustundag B and Isik A: Serum adiponectin and vaspin levels in rheumatoid arthritis. Arch Med Res. 41:457–463. 2010. View Article : Google Scholar : PubMed/NCBI

16 

Klaasen R, Herenius MM, Wijbrandts CA, et al: Treatment-specific changes in circulating adipocytokines: a comparison between tumour necrosis factor blockade and glucocorticoid treatment for rheumatoid arthritis. Ann Rheum Dis. 71:1510–1516. 2012. View Article : Google Scholar

17 

Senolt L, Polanská M, Filková M, et al: Vaspin and omentin: new adipokines differentially regulated at the site of inflammation in rheumatoid arthritis. Ann Rheum Dis. 69:1410–1411. 2010. View Article : Google Scholar : PubMed/NCBI

18 

Kamio N, Kawato T, Tanabe N, et al: Vaspin attenuates RANKL-induced osteoclast formation in RAW264.7 cells. Connect Tissue Res. 54:147–152. 2013. View Article : Google Scholar

19 

Choi SH, Hong ES and Lim S: Clinical implications of adipocytokines and newly emerging metabolic factors with relation to insulin resistance and cardiovascular health. Front Endocrinol (Lausanne). 4:972013.PubMed/NCBI

20 

Wada J: Vaspin: a novel serpin with insulin-sensitizing effects. Expert Opin Investig Drugs. 17:327–333. 2008. View Article : Google Scholar : PubMed/NCBI

21 

Kadoglou NP, Gkontopoulos A, Kapelouzou A, et al: Serum levels of vaspin and visfatin in patients with coronary artery disease-Kozani study. Clin Chim Acta. 412:48–52. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Phalitakul S, Okada M, Hara Y and Yamawaki H: Vaspin prevents methylglyoxal-induced apoptosis in human vascular endothelial cells by inhibiting reactive oxygen species generation. Acta Physiol (Oxf). 209:212–219. 2013.

23 

Phalitakul S, Okada M, Hara Y and Yamawaki H: Vaspin prevents TNF-α-induced intracellular adhesion molecule-1 via inhibiting reactive oxygen species-dependent NF-κB and PKCθ activation in cultured rat vascular smooth muscle cells. Pharmacol Res. 64:493–500. 2011.PubMed/NCBI

24 

Kukla M, Mazur W, Bułdak RJ and Zwirska-Korczala K: Potential role of leptin, adiponectin and three novel adipokines - visfatin, chemerin and vaspin - in chronic hepatitis. Mol Med. 17:1397–1410. 2011. View Article : Google Scholar

25 

Fu BD, Yamawaki H, Okada M and Hara Y: Vaspin can not inhibit TNF-α-induced inflammation of human umbilical vein endothelial cells. J Vet Med Sci. 71:1201–1207. 2009.

26 

Bao JP, Chen WP, Feng J, Hu PF, Shi ZL and Wu LD: Leptin plays a catabolic role on articular cartilage. Mol Biol Rep. 37:3265–3272. 2010. View Article : Google Scholar : PubMed/NCBI

27 

Hu PF, Chen WP, Tang JL, Bao JP and Wu LD: Apelin plays a catabolic role on articular cartilage: in vivo and in vitro studies. Int J Mol Med. 26:357–363. 2010.PubMed/NCBI

28 

Uchida K, Urabe K, Naruse K, Ogawa Z, Mabuchi K and Itoman M: Hyperlipidemia and hyperinsulinemia in the spontaneous osteoarthritis mouse model, STR/Ort. Exp Anim. 58:181–187. 2009. View Article : Google Scholar : PubMed/NCBI

29 

Chen TH, Chen L, Hsieh MS, Chang CP, Chou DT and Tsai SH: Evidence for a protective role for adiponectin in osteoarthritis. Biochim Biophys Acta. 1762:711–718. 2006. View Article : Google Scholar : PubMed/NCBI

30 

Hsieh YS, Yang SF, Chu SC, et al: Expression changes of gelatinases in human osteoarthritic knees and arthroscopic debridement. Arthroscopy. 20:482–488. 2004. View Article : Google Scholar : PubMed/NCBI

31 

Birkedal-Hansen H, Moore WG, Bodden MK, et al: Matrix metalloproteinases: a review. Crit Rev Oral Biol Med. 4:197–250. 1993.PubMed/NCBI

32 

Kozaci LD, Buttle DJ and Hollander AP: Degradation of type II collagen, but not proteoglycan, correlates with matrix metalloproteinase activity in cartilage explant cultures. Arthritis Rheum. 40:164–174. 1997. View Article : Google Scholar

33 

Fushimi K, Troeberg L, Nakamura H, Lim NH and Nagase H: Functional differences of the catalytic and non-catalytic domains in human ADAMTS-4 and ADAMTS-5 in aggrecanolytic activity. J Biol Chem. 283:6706–6716. 2008. View Article : Google Scholar : PubMed/NCBI

34 

Handley CJ, Mok MT, Ilic MZ, Adcocks C, Buttle DJ and Robinson HC: Cathepsin D cleaves aggrecan at unique sites within the interglobular domain and chondroitin sulfate attachment regions that are also cleaved when cartilage is maintained at acid pH. Matrix Biol. 20:543–553. 2001. View Article : Google Scholar

35 

Chabane N, Zayed N, Afif H, et al: Histone deacetylase inhibitors suppress interleukin-1β-induced nitric oxide and prostaglandin E2 production in human chondrocytes. Osteoarthritis Cartilage. 16:1267–1274. 2008.

36 

Salvemini D, Misko TP, Masferrer JL, Seibert K, Currie MG and Needleman P: Nitric oxide activates cyclooxygenase enzymes. Proc Natl Acad Sci USA. 90:7240–7244. 1993. View Article : Google Scholar : PubMed/NCBI

37 

Sasaki K, Hattori T, Fujisawa T, Takahashi K, Inoue H and Takigawa M: Nitric xide mediates interleukin-1-induced gene expression of matrix metalloproteinases and basic fibroblast growth factor in cultured rabbit articular chondrocytes. J Biochem. 123:431–439. 1998. View Article : Google Scholar

38 

Amin AR, Attur M, Patel RN, et al: Superinduction of cyclooxygenase-2 activity in human osteoarthritis-affected cartilage. Influence of nitric oxide. J Clin Invest. 99:1231–1237. 1997. View Article : Google Scholar : PubMed/NCBI

39 

Wang P, Zhu F and Konstantopoulos K: Prostaglandin E2 induces interleukin-6 expression in human chondrocytes via cAMP/protein kinase A- and phosphatidylinositol 3-kinase-dependent NF-κB activation. Am J Physiol Cell Physio. 298:C1445–C1456. 2010.PubMed/NCBI

40 

Vincenti MP and Brinckerhoff CE: Transcriptional regulation of collagenase (MMP-1, MMP-13) genes in arthritis: integration of complex signaling pathways for the recruitment of gene-specific transcription factors. Arthritis Res. 4:157–164. 2002. View Article : Google Scholar

41 

Tian B and Brasier AR: Identification of a nuclear factor κB-dependent gene network. Recent Prog Horm Res. 58:95–130. 2003.

42 

Hayden MS and Ghosh S: Signaling to NF-κB. Genes Dev. 18:2195–2224. 2004.

43 

Li H, Peng W, Zhuang J, et al: Vaspin attenuates high glucose-induced vascular smooth muscle cells proliferation and chemokinesis by inhibiting the MAPK, PI3K/Akt, and NF-κB signaling pathways. Atherosclerosis. 228:61–68. 2013.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Bao JP, Jiang LF, Li J, Chen WP, Hu PF and Wu LD: Visceral adipose tissue‑derived serine protease inhibitor inhibits interleukin‑1β‑induced catabolic and inflammatory responses in murine chondrocytes. Mol Med Rep 10: 2191-2197, 2014.
APA
Bao, J., Jiang, L., Li, J., Chen, W., Hu, P., & Wu, L. (2014). Visceral adipose tissue‑derived serine protease inhibitor inhibits interleukin‑1β‑induced catabolic and inflammatory responses in murine chondrocytes. Molecular Medicine Reports, 10, 2191-2197. https://doi.org/10.3892/mmr.2014.2478
MLA
Bao, J., Jiang, L., Li, J., Chen, W., Hu, P., Wu, L."Visceral adipose tissue‑derived serine protease inhibitor inhibits interleukin‑1β‑induced catabolic and inflammatory responses in murine chondrocytes". Molecular Medicine Reports 10.4 (2014): 2191-2197.
Chicago
Bao, J., Jiang, L., Li, J., Chen, W., Hu, P., Wu, L."Visceral adipose tissue‑derived serine protease inhibitor inhibits interleukin‑1β‑induced catabolic and inflammatory responses in murine chondrocytes". Molecular Medicine Reports 10, no. 4 (2014): 2191-2197. https://doi.org/10.3892/mmr.2014.2478
Copy and paste a formatted citation
x
Spandidos Publications style
Bao JP, Jiang LF, Li J, Chen WP, Hu PF and Wu LD: Visceral adipose tissue‑derived serine protease inhibitor inhibits interleukin‑1β‑induced catabolic and inflammatory responses in murine chondrocytes. Mol Med Rep 10: 2191-2197, 2014.
APA
Bao, J., Jiang, L., Li, J., Chen, W., Hu, P., & Wu, L. (2014). Visceral adipose tissue‑derived serine protease inhibitor inhibits interleukin‑1β‑induced catabolic and inflammatory responses in murine chondrocytes. Molecular Medicine Reports, 10, 2191-2197. https://doi.org/10.3892/mmr.2014.2478
MLA
Bao, J., Jiang, L., Li, J., Chen, W., Hu, P., Wu, L."Visceral adipose tissue‑derived serine protease inhibitor inhibits interleukin‑1β‑induced catabolic and inflammatory responses in murine chondrocytes". Molecular Medicine Reports 10.4 (2014): 2191-2197.
Chicago
Bao, J., Jiang, L., Li, J., Chen, W., Hu, P., Wu, L."Visceral adipose tissue‑derived serine protease inhibitor inhibits interleukin‑1β‑induced catabolic and inflammatory responses in murine chondrocytes". Molecular Medicine Reports 10, no. 4 (2014): 2191-2197. https://doi.org/10.3892/mmr.2014.2478
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team