Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
July-2016 Volume 14 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2016 Volume 14 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Daidzein attenuates abdominal aortic aneurysm through NF-κB, p38MAPK and TGF-β1 pathways

  • Authors:
    • Yan‑Feng Liu
    • Yun‑Qing Bai
    • Ming Qi
  • View Affiliations / Copyright

    Affiliations: Department of General Surgery, The First Affiliated Hospital of Dalian Medical University, Dalian, Liaoning 116011, P.R. China
  • Pages: 955-962
    |
    Published online on: May 18, 2016
       https://doi.org/10.3892/mmr.2016.5304
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The current study focuses on the protection of daidzein on nerves, as daidzein was demonstrated to have a protective effect on neurons of the central nervous system in a glutamate excitotoxicity and oxygen/glucose deprivation model. However, the effect of daidzein on the abdominal aortic aneurysm (AAA) remains unclear. The angiotensin II-induced AAA mouse model was utilized in the present study to determine the effect of daidzein on AAA. The results demonstrated that daidzein significantly attenuated incidence of AAA, max aortic aneurysm and mortality in the angiotensin II‑induced AAA mice. Daidzein had an anti‑inflammatory effect by inhibiting tumor necrosis factor α (TNF-α), interleukin 1β (IL‑1β) and nuclear factor κB (NF‑κB) protein expression. In addition, daidzein strongly suppressed the gene expression of cyclooxygenase (COX)‑2, matrix metalloproteinase 2 (MMP‑2), tissue inhibitor of metalloproteinase 1 (TIMP-1), transforming growth factor β1 (TGF‑β1), and inhibited inducible nitric oxide synthase (iNOS) protein expression in angiotensin II‑induced AAA mice. It also inhibited phosphorylation of the p38 mitogen-activated protein kinase (MAPK) signaling pathway. These results demonstrate, to the best of our knowledge for the first time, that the anti‑inflammatory effects and inhibitory mechanism of daidzein attenuates AAA in angiotensin II‑induced mice. Daidzein contains strong anti‑inflammatory activity and affects various mechanism pathways including the NF‑κB, p38MAPK and TGF-β1 pathway.

Introduction

Abdominal aortic aneurysm (AAA) is a degenerative disease characterized by structural damage to the wall of the abdominal aorta and the gradual expansion into a pulsating mass (1). It is generally accepted that AAA is the expansion of the abdominal aortic artery diameter to greater than 1.5 times the neighboring normal artery (2). To the best of our knowledge, an epidemiological survey remains to be conducted in China thus far. In western countries, the incidence of AAA is increasing; a previous study reported incidence of 12% in male hypertensive patients between the ages of 60 and 74 and 20–29% in male siblings of the patients (3). The natural rupture rate of two years for symptomatic AAA without treatment is up to 50%. The overall AAA mortality rate is has been reported to be 80–90% (4). Therefore, the aim of the present study is to investigate the pathogenesis of AAA to aid the development of early drug treatment programs.

The interaction of various factors, including genetic, environmental and biochemical factors, is the etiology of AAA (5). Human AAA is predominantly a result of hypertension, atherosclerosis and other diseases and conditions, including congenital aortic hypoplasia, syphilis, trauma, Takayasu arteritis, Marfan syndrome, infection and Bechet syndrome (6). Previous studies demonstrated that the pathological process of the aneurysm derives from the abnormal degradation of the artery wall, and this alteration is often present in atherosclerotic lesions (7–9). These studies suggest that atherosclerotic plaques may weaken the arterial wall structure or lead to a significant reduction in the mechanical strength of the abdominal aorta, resulting in focal protrusion to form a tumor, as the lipid infiltration directly destroys the normal structure of the arterial wall and the compression of the plaque results in the reduction of blood flow, thus causing ischemia in the film (10). Numerous clinical studies have demonstrated that there is widespread inflammation in the majority of AAA walls (11–13).

There are 12 types of isoflavones in soy, divided into three categories, daidzin, genistin and glycitin (14). The soy isoflavones exist in free form, glucoside, acetyl-glucoside or malonyl-glucoside (14). Daidzein has been reported to exhibit anti-oxidative and anti-inflammatory activity, reduce estrogenic activity, and prevent menopause, osteoporosis and cardiovascular diseases (15). Thus, this may suggest that daidzein attenuates AAA, and that the NF-κB, p38MAPK and TGF-β1 pathways may be critical in the action of daidzein against AAA.

Materials and methods

Reagents

Angiotensin II and daidzein were obtained from Sigma-Aldrich (St. Louis, MO, USA). Tumor necrosis factor α (TNF-α) and interleukin 1β (IL-1β) mouse enzyme-linked immunosorbent assay (ELISA) antibody set was obtained from eBioscience Inc. (San Diego, CA, USA). Bradford reagent and SDS-PAGE were obtained from Beyotime Institute of Biotechnology (Jiangsu, China).

Angiotensin II-induced AAA mice model and treatment

Male BALB/C male mice (n=30; age, 8 weeks; weight, 20–22 g) were purchased from the Experimental Center of The First Affiliated Hospital of Dalian Medical University (Liaoning, China). This is a prospective interventional animal study. All mice were housed at 22±2°C with relative humidity of 55±5% and a 12-h dark:light cycle. All mice were fed with normal chow ad libitum, housed in a pathogen-free barrier facility and bred as littermate controls. Mice were randomly divided into three groups (n=10) as follows: Control, mice were infused subcutaneously (i.s.) with saline vehicle for 4 weeks as previously described (16); angiotensin II-treated, mice were i.s. with 1,000 ng/kg/min angiotensin II, then received an intraperitoneal injection (i.p.) of saline vehicle for 4 weeks as previously described (17); daidzein, angiotensin II-induced mice were treated with 0.2 mg/kg daidzein i.p. for 4 weeks. Mice was sacrificed by an excess of anesthetic (500 µl 3% pentobarbital sodium; Sigma-Aldrich)

Quantification of angiotensin II-induced AAA mice

The perfusion aorta was fixated with 4% cold paraformaldehyde (Sinopharm Chemical Reagent Co., Ltd, Shanghai, China), and exposed under a dissecting microscope (Olympus SZX7; Olympus Corporation, Tokyo, Japan) to remove the periadventitial tissue from the aortic wall. The gross appearances of the aorta were then observed to measure the maximal external diameter of the suprarenal aorta using the MultiGauge 3000 imaging processing software (Fujifilm Holdings Co., Tokyo, Japan). The increase in the aortic outer diameter was defined as >50% and used to describe the development of the aortic aneurysm.

Measurement of inflammation

Serum was obtained from the peripheral vessel and centrifuged at 1,200 x g for 10 min at room temperature. TNF-α and IL-1β serum levels were determined using the eBioscience mouse ELISA antibody set. Absorbance was determined at 450 nm wavelength using an ELISA reader (Spectramax Plus, Molecular Devices, LLC, Sunnyvale, CA, USA).

Western blot analysis of nuclear factor κB (NF-κB), inducible nitric oxide synthase (iNOS) and p38 mitogen-activated protein kinase (MAPK)

The whole aorta was harvested and homogenated with phosphatase inhibitor cocktail (Roche Diagnostics, Basel, Switzerland) in radioimmunoprecipitation assay lysis buffer (EMD Millipore, Billerica, MA, USA). The mixed solution was centrifuged at 1,200 × g for 10 min at 4°C, and protein concentration was determined using Bradford's reagent (Beyotime Institute of Biotechnology, Jiangsu, China) according to the manufacturer's instructions. Equal amounts of protein were subjected to 8–10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE; Sigma-Aldrich) for 50 min at 60 V and transferred to nitrocellulose membranes (110 V for 75 min; EMD Millipore). The membranes were blocked with 5% skimmed milk in tris-buffered saline with 0.1% Tween 20 (Beyotime Institute of Biotechnology) for 1 h at 4°C. The membranes were then incubated with rabbit anti-mouse NF-κB (cat no. sc-372; 1:1,000), rabbit anti-mouse iNOS (cat no. sc-650; 1:1,500), rabbit anti-mouse p38MAPK (cat no. sc-101427; 1:500) p-p38MAPK (cat no. sc-7973; 1:500) and β-actin (cat no. sc-130656 1:2,000) primary antibodies at 4°C overnight, all Santa Cruz Biotechnology, Inc., (Dallas, TX, USA). Subsequently, the membranes were incubated with anti-mouse IgG horseradish peroxidase-conjugated secondary antibodies (cat no. 7074, 1:5000; Cell Signaling Technology, Inc., Danvers, MA, USA), and proteins were detected with the SuperSignal West Femto chemiluminescent Substrate (Thermo Fisher Scientific, Inc., Rockford, IL, USA).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis of cyclooxygenase (COX)-2, matrix metalloproteinase 2 (MMP-2), tissue inhibitor of metalloproteinase 1 (TIMP-1) and transforming growth factor β1 (TGF-β1)

Total RNA was isolated from the aorta samples using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's instructions. Total RNA (500 ng) was utilized to synthesize cDNA using TaqMan Gold RT-PCR kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. cDNA (1 µg) was used to compound DNA. RT-qPCR was performed using the SYBR green JumpStart Taq ReadyMix (Sigma-Aldrich), SYBR Green PCR Master Mix (Applied Biosystems; Thermo Fisher Scientific, Inc.) and the iCycler iQ Real-Time PCR detection system (Bio-Rad Laboratories, Inc., Hercules, CA, USA). RT-qPCR was performed using the SYBR green JumpStart Taq ReadyMix (Sigma-Aldrich), SYBR Green PCR Master Mix (Applied Biosystems; Thermo Fisher Scientific, Inc.) and the iCycler iQ Real-Time PCR detection system (Bio-Rad Laboratories, Inc.). The reactions were performed at 95°C for 10 min, followed by 40 cycles of 95°C for 30 sec, 60°C for 30 sec, 72°C for 45 sec and 4°C for saving. The sequences for gene-specific primers are demonstrated in Table I.

Table I

Sequences for gene-specific primers.

Table I

Sequences for gene-specific primers.

GeneForward primer (5′-3′)Reverse primer (5′-3′)
COX-2 CACTCAGTTTGTTGAGTCATTC GATTAGTACTGTAGGGTTAATG
MMP-2 ACACTGGGACCTGTCACTCC TGTCACTGTCCGCCAAATAA
TIMP-1 GCAACTCGGACCTGGTCATAA CGGCCCGTGATGAGAAACT
TGF-β1 TGCTTCAGCTCCACAGAGAA TGGTTGTAGAGGGCAAGGAC
GAPDH TGTACCGTCTAGCATATCTCCGAC ATGATGTGCTCTAGCTCTGGGTG

[i] COX-2, cyclooxygenase 2; MMP-2, matrix metalloproteinase 2; TIMP-1, tissue inhibitor of metalloproteinase 1; TGF-β1, transforming growth factor β1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Statistical analysis

Data are presented as means ± standard error Statistical analysis was performed using Student's t-test for paired or unpaired data, and data were assessed using SPSS software, version 13 (SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

Daidzein affects angiotensin II-induced AAA mice

The chemical structure of daidzein is presented in Fig. 1. To evaluate the possible effect of daidzein on AAA mice, AAA was induced by continuous angiotensin II treatment. Mice were treated with normal saline and 0.2 mg/kg daidzein per day. Incidence of AAA, max aortic aneurysm and mortality rate of the angiotensin II-induced AAA mice were observed to be higher compared with those of the control mice (Fig. 2; P<0.01). In addition, administration of daidzein significantly attenuated these indexes in the angiotensin II-induced AAA mice compared with the angiotensin II model mice (Fig. 2; P<0.01).

Figure 1

The chemical structure of daidzein.

Figure 2

The effect of daidzein on angiotensin II-induced mice. (A) Incidence of abdominal aortic aneurysm, (B) max aortic aneurysm and (C) mortality rate in control, angiotensin II-treated and daidzein-treated mice. ##P<0.01 vs. the control group and **P<0.01 vs. the angiotensin II group. Data are presented as means ± standard error of the mean.

Daidzein affects inflammation in angiotensin II-induced mice

To determine the effect of daidzein on inflammation in the angiotensin II-induced mice, TNF-α and IL-1β serum levels were measured. As demonstrated in Fig. 3, angiotensin II infusion significantly increased the serum levels of TNF-α and IL-1β in AAA mice, compared with the control mice (P<0.01). However, a significant reduction in the TNF-α and IL-1β serum levels was demonstrated in the daidzein-treated group, compared with the angiotensin II model mice (Fig. 3; P<0.01).

Figure 3

The effect of daidzein on inflammation in angiotensin II-induced mice. (A) TNF-α and (B) IL-1β serum levels in control, angiotensin II-treated and daidzein-treated mice. ##P<0.01 vs. the control group and **P<0.01 vs. the angiotensin II group. Data are presented as means ± standard error of the mean. TNF-α, tumor necrosis factor α; IL-1β, interleukin 1β.

Daidzein affects NF-κB protein expression in angiotensin II-induced mice

To confirm the mechanism of daidzein on inflammation in the angiotensin II-induced mice, NF-κB protein expression was assessed. Western blot analysis results demonstrated that angiotensin II significantly increased the NF-κB protein expression in the AAA mice, compared with the control group (Fig. 4; P<0.01). Additional treatment with daidzein significantly inhibited the activation of NF-κB protein expression in the AAA mice compared with the angiotensin II model mice (Fig. 4; P<0.01).

Figure 4

The effect of daidzein on the NF-κB protein expression levels in angiotensin II-induced mice. (A) Western blotting assay and (B) statistical analysis of the NF-κB protein expression in control, angiotensin II-treated and daidzein-treated mice. ##P<0.01 vs. the control group and **P<0.01 vs. the angiotensin II group. Data are presented as means ± standard error of the mean. NF-κB, nuclear factor κB.

Daidzein affects COX-2 gene expression in angiotensin II-induced mice

A previous study demonstrated that the suppression of COX-2 expression has an effect on angiotensin II-induced AAA mice (18). Therefore, the effect of daidzein on COX-2 gene expression in angiotensin II-induced mice was determined. As demonstrated in Fig. 5, COX-2 gene expression was significantly increased in the angiotensin II-induced AAA mice compared with the control mice (P<0.01). COX-2 gene expression in the daidzein-treated mice was significantly suppressed compared with the angiotensin II model mice (Fig. 5; P<0.01).

Figure 5

The effect of daidzein on COX-2 gene expression in control, angiotensin II-treated and daidzein-treated mice. ##P<0.01 vs. the control group and **P<0.01 vs. the angiotensin II group. COX-2, cyclooxygenase-2. Data are presented as means ± standard error of the mean.

Daidzein affects MMP-2 gene expression in angiotensin II-induced mice

The mediated inflammation in angiotensin II-induced mice was assessed and the MMP-2 gene expression was measured using RT-qPCR analysis. A significant increase was observed in the MMP-2 gene expression in the angiotensin II-induced AAA mice compared with the control mice (Fig. 6; P<0.01). Additional treatment with daidzein significantly suppressed the promotion of MMP-2 gene expression in the angiotensin II-induced AAA mice compared with the angiotensin II model mice (Fig. 6; P<0.01).

Figure 6

The effect of daidzein on the MMP-2 gene expression in control, angiotensin II-treated and daidzein-treated mice. ##P<0.01 vs. the control group and **P<0.01 vs. the angiotensin II group. Data are presented as means ± standard error of the mean. MMP-2, metalloproteinase 2.

Daidzein affects iNOS protein expression in angiotensin II-induced mice

Western blot analysis was performed to determine iNOS protein expression levels in the aortic aneurysmal tissue. A significant elevation of iNOS protein expression levels was observed in the angiotensin II-induced AAA mice, compared with the control mice (Fig. 7; P<0.01). Administration of daidzein significantly inhibited the increase of iNOS protein expression compared with the angiotensin II model mice (Fig. 7; P<0.01).

Figure 7

The effect of daidzein on iNOS protein expression levels in angiotensin II-induced mice. (A) Western blotting assay and (B) statistical analysis of iNOS protein expression in control, angiotensin II-treated and daidzein-treated mice. ##P<0.01 vs. the control group and **P<0.01 vs. the angiotensin II group. Data are presented as means ± standard error of the mean. iNOS, inducible nitric oxide synthase.

Daidzein affects TIMP-1 gene expression in angiotensin II-induced mice

RT-qPCR was utilized to assess the effect of daidzein on TIMP-1 gene expression. As demonstrated in Fig. 8, TIMP-1 gene expression in the angiotensin II-induced AAA mice was lower than that of the control mice (P<0.01). Compared with the angiotensin II model mice, additional treatment with daidzein significantly increased the suppression of TIMP-1 gene expression in the angiotensin II-induced AAA mice (Fig. 8; P<0.01).

Figure 8

The effect of daidzein on TIMP-1 gene expression in control, angiotensin II-treated and daidzein-treated mice. ##P<0.01 vs. the control group and **P<0.01 vs. the angiotensin II group. Data are presented as means ± standard error of the mean. TIMP-1, tissue inhibitor of metalloproteinase 1.

Daidzein affects TGF-β1 gene expression in angiotensin II-induced mice

RT-qPCR was utilized to assess the effect of daidzein on TGF-β1 gene expression in the angiotensin II-induced mice. As demonstrated in Fig. 9, TGF-β1 gene expression significantly increased in the angiotensin II-induced AAA mice compared with the control mice. However, administration of daidzein significantly inhibited the activation of TGF-β1 gene expression in the angiotensin II-induced AAA mice compared with the angiotensin II model mice (Fig. 9; P<0.01).

Figure 9

The effect of daidzein on TGF-β1 gene expression in control, angiotensin II-treated and daidzein-treated mice. ##P<0.01 vs. the control group and **P<0.01 vs. the angiotensin II group. Data are presented as means ± standard error of the mean. TGF-β1, transforming growth factor β1.

Daidzein affects p38MAPK protein expression in angiotensin II-induced mice

The expression of p38MAPK protein was assessed to investigate the role of p38MAPK signaling in the effect of daidzein on angiotensin II-induced AAA mice. Western blot analysis demonstrated that the expression of p38MAPK protein in the angiotensin II-induced AAA mice was significantly higher compared with the control mice (Fig. 10; P<0.01). Following daidzein treatment, the activation of p38MAPK signaling was suppressed in the angiotensin II-induced AAA mice compared with the angiotensin II model mice (Fig. 10; P<0.01).

Figure 10

The effect of daidzein on the p38MAPK protein expression levels in angiotensin II-induced mice. (A) Western blotting assay and (B) statistical analysis of the p38MAPK protein expression in control, angiotensin II-treated and daidzein-treated mice. ##P<0.01 vs. the control group and **P<0.01 vs. the angiotensin II group. Data are presented as means ± standard error of the mean. MAPK, mitogen-activated protein kinase.

Discussion

AAA results from the interaction of various factors, such as anatomical, genetic, environmental and biochemical factors (1). Compared with the structure of suprarenal area of the abdominal aorta, the infrarenal aortic wall is weak and the partial load is higher, short of nourishing blood vessels and without adequate blood supply in cases of AAA (19). The anatomical defect is one of the basic pathological causes of the AAA disease (20). Previous studies demonstrated that immune inflammation is a common mechanism of AAA pathogenesis, which likely promotes the formation of AAA by infiltration of inflammatory cells, inducing inflammatory cytokines and the initiation of apoptosis by the MMP family (20–22). The present study demonstrated that administration of daidzein significantly attenuated these indexes in the angiotensin II-induced AAA mice compared with those of model mice. These results indicate that daidzein may be a novel therapeutic drug for the treatment and prevention of AAA.

Previous studies have demonstrated that inherent inflammation and antigen-induced immune responses during chronic inflammatory response in AAA tissues (21–23). Monocytes accumulate in the outer membrane of the cell to be activated and differentiate into macrophages, an important step for the degradation of the extracellular matrix (5). As a part of a non-specific immune response, lymphocytes may serve a regulatory role in the activity of macrophages, and the accumulation of inflammatory cells is a manifestation of autoimmunity (5). A previous study conducted cellular localization of MMPs by staining anti-MMP-2, -3 and -9 in human AAA specimens, and the results demonstrated that MMP-2 and -9 were located in macrophages, which have strong matrix solubility (24). Previous studies indicated similar results, that MMP-2 and MMP-9 serve important roles in the pathogenesis of AAA, and the positive cells of MMPs are mainly localized in macrophages (25,26). These data suggest that the infiltration of macrophages is vital for the early activity (elastin damage to the arterial wall) of AAA formation (27). As the infiltration degree of inflammatory cells is gradually increased, MMP species are increased with the activity, damage of elastic and collagen fibers, and the dilation extent of the abdominal aorta. The elastin degradation products produced by the degrading extracellular matrix due to the MMPs, may lead to further chemotaxis of mononuclear macrophages that are involved in inflammation (6). The present study demonstrated that daidzein treatment inhibited the promotion of TNF-α and IL-1β serum levels, and activation of NF-κB protein expression in the angiotensin II-induced AAA mice. These results are consistent with Khan et al (28), who suggested that daidzein inhibited the 12-O-tetradecanoylphorbol-13-acetate-induced cutaneous inflammation through the NF-κB and COX-2 expression.

MMPs are predominantly produced by macrophages, T or B lymphocytes, fibroblasts and smooth muscle cells. Macrophages generate MMPs depending on the role of prostaglandin E2 (PGE2), that is synthesized by the arachidonic acid under the effect of a series of enzymes, in which COX-2 is the rate-limiting enzyme. PGE2 inhibits COX-2, thus inhibiting the generation of MMPs (6,29). Previous studies have demonstrated that inflammatory cytokines are associated with the vascular response to injury and atherosclerosis. Numerous inflammatory mediators, such as PGE2, IL-1, IL-6, IL-8, TNF-α and nitric oxide, have direct or indirect angiogenic activity (18,30–32). The results of the present study demonstrated that administration of daidzein significantly suppressed COX-2 and MMP-2 relative gene expression levels, and inhibited iNOS protein expression levels in the angiotensin II-induced AAA mice. Choi et al (15) demonstrated that daidzein inhibited inflammation by suppressing iNOS protein expression.

TIMPs are endogenous low-molecular-weight proteis, hydrolytic enzymes in the degradation of the extracellular matrix and endogenous inhibitors of MMPs, serving a role in various pathophysiological processes of the body (33). TIMPs serve a role in cardiac remodeling, myocardial ischemia-reperfusion injury and mediating the remodeling of external cardiac extracellular matrix (34). TIMPs are protease inhibitors secreted by the cells in the body, which may be expressed in the sarcomere of myocardial cells, thin filaments and stromal cells, and may be additionally expressed in tumor cells (35). TIMPs are a family of multi-functional factors, that regulate the activity of MMPs in vivo, as TIMP-1 may be bound to numerous MMPs, including MMP-1, 3 and 9 (10). The present study demonstrated that daidzein significantly increased the suppression of the TIMP-1 gene expression in the angiotensin II-induced AAA mice. Soumyakrishnan et al (17) indicated that daidzein exhibits an anti-fibrotic effect by reducing the expression of TIMP-1 and TGF-β1 in Bleomycin-induced experimental pulmonary fibrosis. These results demonstrate that the TIMP signaling pathway serves an important role in the effect of daidzein on AAA.

TGF exists widely in the body, regulating cell growth and differentiation. In the cardiovascular system, predominantly TGF-β1 promotes matrix synthesis and secretion (24). Although previous studies suggested that overexpression of TGF-β1 and apoptosis of smooth muscle are increased simultaneously, TGF-β1 has been demonstrated to exhibit different effects in smooth muscle cells. TGF-β1 inhibited apoptosis in cultured bovine aortic smooth muscle cells, however triggered apoptosis in the cultured rat aortic smooth muscle cells (36–38). This effect may be due to the TGF-β1 regulation of the apoptosis of smooth muscle cells dependent on the local microenvironment and the concentration of TGF-β1 (39). In addition, the cytotoxic medium generated by the infiltrated T lymphocytes in the aortic aneurysm results in the apoptosis of smooth muscle cells, thus TGF-β1 may regulate apoptosis by influencing the degree of inflammatory infiltration in the wall of the aneurysm (38,39). Similar to the results of previous studies, the results of the current study demonstrated that daidzein significantly inhibited the activation of TGF-β1 gene expression in the angiotensin II-induced AAA mice (40,41). The results of the present study demonstrated that the TGF-β1 signaling pathway induced by daidzein serves an important role in the treatment of AAA.

In the p38/MAPK signaling pathway, the phosphokinase p38MAPK mediates the proliferation and migration of vascular smooth muscle cells (VSMCs), and the hypertrophy of VSMCs and the deposition of extracellular matrix may be the required signaling pathway for hypertensive vascular remodeling (42). Protein kinase 1 activated by TGF-β1, combined with protein, may lead to the autophosphorylation of p38MAPK, to activate the p38/MAPK signaling pathway (9). Therefore, TGF-β1 and p38MAPK serve important roles in the occurrence and development of hypertension (9,42). The results of the current study demonstrated that daidzein significantly suppressed the activation of p38MAPK signaling in the angiotensin II-induced AAA mice. Lim et al (14) demonstrated that daidzein is a novel inhibitor of protein kinase α by suppressing the solar ultraviolet-induced MMP-1 through p38. Thus, these data suggest that p38 signaling associates with the effect of daidzein on AAA.

In conclusion, the results of the current study demonstrated that the anti-inflammatory effects and inhibitory mechanism of daidzein attenuate AAA in the angiotensin II-induced mice. The anti-inflammatory effect of daidzein was associated with NF-κB, COX-2, MMP-2 and iNOS expression. In addition, the results suggested that suppression of TIMP, TGF-β1 and p38MAPK signaling promotes the effect of daidzein in AAA. Daidzein had a strong anti-inflammatory activity and affects various mechanism pathways, including NF-κB, p38MAPK and TGF-β1, suggesting it may be a novel therapeutic target for the treatment of AAA formation.

References

1 

Gyoten T, Doi T, Yamashita A, Fukahara K, Kotoh K and Yoshimura N: Ruptured abdominal aortic aneurysm and aortoiliac vein fistula. Asian Cardiovasc Thorac Ann. 23:449–451. 2015. View Article : Google Scholar

2 

Knops AM, Goossens A, Ubbink DT, Balm R, Koelemay MJ, Vahl AC, de Nie AJ, van den Akker PJ, Willems MC, Koedam NA, et al: A decision aid regarding treatment options for patients with an asymptomatic abdominal aortic aneurysm: A randomised clinical trial. Eur J Vasc Endovasc Surg. 48:276–283. 2014. View Article : Google Scholar : PubMed/NCBI

3 

Bonfreschi V, Giuliani E, Malagnino FC, Navi A, Coppi G, Silingardi R, D'Amico R and Barbieri A: Analgesia during abdominal aortic aneurysm endovascular repair: Remifentanil vs. fentanyl-midazolam - a randomized controlled trial. Eur J Anaesthesiol. 26:782–787. 2009. View Article : Google Scholar : PubMed/NCBI

4 

Candell L, Tucker LY, Goodney P, Walker J, Okuhn S, Hill B and Chang R: Early and delayed rupture after endovascular abdominal aortic aneurysm repair in a 10-year multicenter registry. J Vasc Surg. 60:1146–1152. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Choke E, Cockerill GW, Laing K, Dawson J, Wilson WR, Loftus IM and Thompson MM: Whole genome-expression profiling reveals a role for immune and inflammatory response in abdominal aortic aneurysm rupture. Eur J Vasc Endovasc Surg. 37:305–310. 2009. View Article : Google Scholar

6 

Watanabe A, Ichiki T, Sankoda C, Takahara Y, Ikeda J, Inoue E, Tokunou T, Kitamoto S and Sunagawa K: Suppression of abdominal aortic aneurysm formation by inhibition of prolyl hydroxylase domain protein through attenuation of inflammation and extracellular matrix disruption. Clin Sci (Lond). 126:671–678. 2014. View Article : Google Scholar

7 

Duellman T, Warren CL, Peissig P, Wynn M and Yang J: Matrix metalloproteinase-9 genotype as a potential genetic marker for abdominal aortic aneurysm. Circ Cardiovasc Genet. 5:529–537. 2012. View Article : Google Scholar : PubMed/NCBI

8 

Henriksen NA, Sorensen LT, Jorgensen LN and Lindholt JS: Lack of association between inguinal hernia and abdominal aortic aneurysm in a population-based male cohort. Br J Surg. 100:1478–1482. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Takahashi Y, Maki T, Liang AC, Itoh K, Lok J, Osumi N and Arai K: p38 MAP kinase mediates transforming-growth factor-β1-induced upregulation of matrix metalloproteinase-9 but not -2 in human brain pericytes. Brain Res. 1593:1–8. 2014. View Article : Google Scholar : PubMed/NCBI

10 

Yurube T, Takada T, Suzuki T, Kakutani K, Maeno K, Doita M, Kurosaka M and Nishida K: Rat tail static compression model mimics extracellular matrix metabolic imbalances of matrix metalloproteinases, aggrecanases, and tissue inhibitors of metalloproteinases in intervertebral disc degeneration. Arthritis Res Ther. 14:R512012. View Article : Google Scholar : PubMed/NCBI

11 

Brown LC, Thompson SG, Greenhalgh RM and Powell JT: Endovascular Aneurysm Repair trial participants: Incidence of cardiovascular events and death after open or endovascular repair of abdominal aortic aneurysm in the randomized EVAR trial 1. Br J Surg. 98:935–942. 2011. View Article : Google Scholar : PubMed/NCBI

12 

Walsh SR, Sadat U, Boyle JR, Tang TY, Lapsley M, Norden AG and Gaunt ME: Remote ischemic preconditioning for renal protection during elective open infrarenal abdominal aortic aneurysm repair: Randomized controlled trial. Vasc Endovascular Surg. 44:334–340. 2010. View Article : Google Scholar : PubMed/NCBI

13 

Morbelli S, Ghigliotti G, Spinella G, Marini C, Bossert I, Cimmino M, Pane B, Rousas N, Cittadini G, Massollo M, et al: Systemic vascular inflammation in abdominal aortic aneurysm patients: A contrast-enhanced PET/CT study. Q J Nucl Med Mol Imaging. 58:299–309. 2014.PubMed/NCBI

14 

Lim TG, Kim JE, Lee SY, Park JS, Yeom MH, Chen H, Bode AM, Dong Z and Lee KW: The daidzein metabolite, 6,7,4′-Trihydroxyisoflavone, is a novel inhibitor of PKCα in suppressing solar UV-induced matrix metalloproteinase 1. Int J Mol Sci. 15:21419–21432. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Choi EY, Jin JY, Lee JY, Choi JI, Choi IS and Kim SJ: Anti-inflammatory effects and the underlying mechanisms of action of daidzein in murine macrophages stimulated with Prevotella intermedia lipopolysaccharide. J Periodontal Res. 47:204–211. 2012. View Article : Google Scholar

16 

Zheng YH, Li FD, Tian C, Ren HL, Du J and Li HH: Notch γ-secretase inhibitor dibenzazepine attenuates angiotensin II-induced abdominal aortic aneurysm in ApoE knockout mice by multiple mechanisms. PLoS One. 8:e833102013. View Article : Google Scholar

17 

Soumyakrishnan S, Divya T, Kalayarasan S, Sriram N and Sudhandiran G: Daidzein exhibits anti-fibrotic effect by reducing the expressions of Proteinase activated receptor 2 and TGFβ1/smad mediated inflammation and apoptosis in Bleomycin-induced experimental pulmonary fibrosis. Biochimie. 103:23–36. 2014. View Article : Google Scholar : PubMed/NCBI

18 

King VL, Trivedi DB, Gitlin JM and Loftin CD: Selective cyclooxygenase-2 inhibition with celecoxib decreases angiotensin II-induced abdominal aortic aneurysm formation in mice. Arterioscler Thromb Vasc Biol. 26:1137–1143. 2006. View Article : Google Scholar : PubMed/NCBI

19 

Iezzi R, Cotroneo AR, Filippone A, Di Fabio F, Santoro M and Storto ML: MDCT angiography in abdominal aortic aneurysm treated with endovascular repair: Diagnostic impact of slice thickness on detection of endoleaks. AJR Am J Roentgenol. 189:1414–1420. 2007. View Article : Google Scholar : PubMed/NCBI

20 

Dawson JA, Choke E, Loftus IM, Cockerill GW and Thompson MM: A randomised placebo-controlled double-blind trial to evaluate lipid-lowering pharmacotherapy on proteolysis and inflammation in abdominal aortic aneurysms. Eur J Vasc Endovasc Surg. 41:28–35. 2011. View Article : Google Scholar

21 

Peshkova IO, Schaefer G and Koltsova EK: Atherosclerosis and Aortic Aneurysm: Is inflammation a common denominator? FEBS J. Dec 24–2015.ePub ahead of print.

22 

Fu XM, Yamawaki-Ogata A, Oshima H, Ueda Y, Usui A and Narita Y: Intravenous administration of mesenchymal stem cells prevents angiotensin II-induced aortic aneurysm formation in apolipoprotein E-deficient mouse. J Transl Med. 11:1752013. View Article : Google Scholar : PubMed/NCBI

23 

Arnaoutoglou E, Kouvelos G, Papa N, Koulouras V, Milionis H and Matsagkas M: Regarding 'the impact of endograft type on inflammatory response after endovascular treatment of abdominal aortic aneurysm'. J Vasc Surg. 58:5702013. View Article : Google Scholar

24 

Gao F, Chambon P, Offermanns S, Tellides G, Kong W, Zhang X and Li W: Disruption of TGF-β signaling in smooth muscle cell prevents elastase-induced abdominal aortic aneurysm. Biochem Biophys Res Commun. 454:137–143. 2014. View Article : Google Scholar : PubMed/NCBI

25 

Ciavarella C, Alviano F, Gallitto E, Ricci F, Buzzi M, Velati C, Stella A, Freyrie A and Pasquinelli G: Human Vascular Wall Mesenchymal Stromal Cells Contribute to Abdominal Aortic Aneurysm Pathogenesis Through an Impaired Immunomodulatory Activity and Increased Levels of Matrix Metalloproteinase-9. Circ J. 79:1460–1469. 2015. View Article : Google Scholar : PubMed/NCBI

26 

Dilmé JF, Bellmunt S, Camacho M, Solà-Villà D, Romero JM, Escudero JR and Vila L: Influence of cardiovascular risk factors on levels of matrix metalloproteinases 2 and 9 in human abdominal aortic aneurysms. Eur J Vasc Endovasc Surg. 48:374–381. 2014. View Article : Google Scholar : PubMed/NCBI

27 

Pay S, Abbasov T, Erdem H, Musabak U, Simsek I, Pekel A, Akdogan A, Sengul A and Dinc A: Serum MMP-2 and MMP-9 in patients with Behçet's disease: Do their higher levels correlate to vasculo-Behçet's disease associated with aneurysm formation? Clin Exp Rheumatol. 25:S70–75. 2007.PubMed/NCBI

28 

Khan AQ, Khan R, Rehman MU, Lateef A, Tahir M, Ali F and Sultana S: Soy isoflavones (daidzein & genistein) inhibit 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced cutaneous inflammation via modulation of COX-2 and NF-κB in Swiss albino mice. Toxicology. 302:266–274. 2012. View Article : Google Scholar : PubMed/NCBI

29 

Armstrong PJ, Franklin DP, Carey DJ and Elmore JR: Suppression of experimental aortic aneurysms: Comparison of inducible nitric oxide synthase and cyclooxygenase inhibitors. Ann Vasc Surg. 19:248–257. 2005. View Article : Google Scholar : PubMed/NCBI

30 

Luehmann HP, Detering L, Fors BP, Pressly ED, Woodard PK, Randolph GJ, Gropler RJ, Hawker C and Liu Y: PET/CT Imaging of Chemokine Receptors in Inflammatory Atherosclerosis Using Targeted Nanoparticles. J Nucl Med. Jan 21–2016.ePub ahead of print. View Article : Google Scholar : PubMed/NCBI

31 

Rohm I, Atiskova Y, Drobnik S, Fritzenwanger M, Kretzschmar D, Pistulli R, Zanow J, Krönert T, Mall G, Figulla HR and Yilmaz A: Decreased regulatory T cells in vulnerable atherosclerotic lesions: Imbalance between pro- and anti-inflammatory cells in atherosclerosis. Mediators Inflamm. 2015:3647102015. View Article : Google Scholar : PubMed/NCBI

32 

Eo HS, Lee KB, Kim AK, Kim MH, Kim DH and Kim DI: Association with inflammatory cells and apolipoproteins to the progression of atherosclerosis. J Korean Surg Soc. 80:289–296. 2011. View Article : Google Scholar : PubMed/NCBI

33 

Khan JA, Abdul Rahman MN, Mazari FA, Shahin Y, Smith G, Madden L, Fagan MJ, Greenman J, McCollum PT and Chetter IC: Intraluminal thrombus has a selective influence on matrix metalloproteinases and their inhibitors (tissue inhibitors of matrix metalloproteinases) in the wall of abdominal aortic aneurysms. Ann Vasc Surg. 26

34 

Takawale A, Fan D, Basu R, Shen M, Parajuli N, Wang W, Wang X, Oudit GY and Kassiri Z: Myocardial recovery from ischemia-reperfusion is compromised in the absence of tissue inhibitor of metalloproteinase 4. Circ Heart Fail. 7:652–662. 2014. View Article : Google Scholar : PubMed/NCBI

35 

Zhang W, Han Y, Meng G, Bai W, Xie L, Lu H, Shao Y, Wei L, Pan S, Zhou S, et al: Direct renin inhibition with aliskiren protects against myocardial ischemia/reperfusion injury by activating nitric oxide synthase signaling in spontaneously hypertensive rats. J Am Heart Assoc. 3:e0006062014. View Article : Google Scholar : PubMed/NCBI

36 

Tang W, Yang J, Zhang F, Guo H, Peng F and Wang X: Activation of extracellular signal-regulated kinase 1/2 and Sp1 may contribute to the expression of tissue inhibitor of metal-loproteinases-1 induced by transforming growth factor-β1 in human pulmonary arterial smooth muscle cells. Cytotherapy. 16:225–233. 2014. View Article : Google Scholar

37 

Gao YD, Zheng JW, Li P, Cheng M and Yang J: Store-operated Ca2+ entry is involved in transforming growth factor-β1 facilitated proliferation of rat airway smooth muscle cells. J Asthma. 50:439–448. 2013. View Article : Google Scholar : PubMed/NCBI

38 

Golledge J, Clancy P, Jones GT, Cooper M, Palmer LJ, van Rij AM and Norman PE: Possible association between genetic polymorphisms in transforming growth factor beta receptors, serum transforming growth factor beta1 concentration and abdominal aortic aneurysm. Br J Surg. 96:628–632. 2009. View Article : Google Scholar : PubMed/NCBI

39 

Dai J, Losy F, Guinault AM, Pages C, Anegon I, Desgranges P, Becquemin JP and Allaire E: Overexpression of transforming growth factor-beta1 stabilizes already-formed aortic aneurysms: A first approach to induction of functional healing by endovascular gene therapy. Circulation. 112:1008–1015. 2005. View Article : Google Scholar : PubMed/NCBI

40 

Huang CK, Luo J, Lai KP, Wang R, Pang H, Chang E, Yan C, Sparks J, Lee SO, Cho J and Chang C: Androgen receptor promotes abdominal aortic aneurysm development via modulating inflammatory interleukin-1α and transforming growth factor-β1 expression. Hypertension. 66:881–891. 2015. View Article : Google Scholar : PubMed/NCBI

41 

Thompson AR, Cooper JA, Jones GT, Drenos F, van Bockxmeer FM, Biros E, Walker PJ, van Rij AM, Golledge J, Norman PE, et al: Assessment of the association between genetic polymorphisms in transforming growth factor beta, and its binding protein (LTBP), and the presence, and expansion, of Abdominal Aortic Aneurysm. Atherosclerosis. 209:367–373. 2010. View Article : Google Scholar

42 

Yang CQ, Li W, Li SQ, Li J, Li YW, Kong SX, Liu RM, Wang SM and Lv WM: MCP-1 stimulates MMP-9 expression via ERK 1/2 and p38 MAPK signaling pathways in human aortic smooth muscle cells. Cell Physiol Biochem. 34:266–276. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liu YF, Bai YQ and Qi M: Daidzein attenuates abdominal aortic aneurysm through NF-κB, p38MAPK and TGF-β1 pathways. Mol Med Rep 14: 955-962, 2016.
APA
Liu, Y., Bai, Y., & Qi, M. (2016). Daidzein attenuates abdominal aortic aneurysm through NF-κB, p38MAPK and TGF-β1 pathways. Molecular Medicine Reports, 14, 955-962. https://doi.org/10.3892/mmr.2016.5304
MLA
Liu, Y., Bai, Y., Qi, M."Daidzein attenuates abdominal aortic aneurysm through NF-κB, p38MAPK and TGF-β1 pathways". Molecular Medicine Reports 14.1 (2016): 955-962.
Chicago
Liu, Y., Bai, Y., Qi, M."Daidzein attenuates abdominal aortic aneurysm through NF-κB, p38MAPK and TGF-β1 pathways". Molecular Medicine Reports 14, no. 1 (2016): 955-962. https://doi.org/10.3892/mmr.2016.5304
Copy and paste a formatted citation
x
Spandidos Publications style
Liu YF, Bai YQ and Qi M: Daidzein attenuates abdominal aortic aneurysm through NF-κB, p38MAPK and TGF-β1 pathways. Mol Med Rep 14: 955-962, 2016.
APA
Liu, Y., Bai, Y., & Qi, M. (2016). Daidzein attenuates abdominal aortic aneurysm through NF-κB, p38MAPK and TGF-β1 pathways. Molecular Medicine Reports, 14, 955-962. https://doi.org/10.3892/mmr.2016.5304
MLA
Liu, Y., Bai, Y., Qi, M."Daidzein attenuates abdominal aortic aneurysm through NF-κB, p38MAPK and TGF-β1 pathways". Molecular Medicine Reports 14.1 (2016): 955-962.
Chicago
Liu, Y., Bai, Y., Qi, M."Daidzein attenuates abdominal aortic aneurysm through NF-κB, p38MAPK and TGF-β1 pathways". Molecular Medicine Reports 14, no. 1 (2016): 955-962. https://doi.org/10.3892/mmr.2016.5304
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team