Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
September-2018 Volume 18 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2018 Volume 18 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Lycium barbarum polysaccharides protect human trophoblast HTR8/SVneo cells from hydrogen peroxide‑induced oxidative stress and apoptosis

  • Authors:
    • Jing Li
    • Zhongjun Ding
    • Yue Yang
    • Baohong Mao
    • Yanxia Wang
    • Xiaoying Xu
  • View Affiliations / Copyright

    Affiliations: Department of Women and Children's Medical Center, Gansu Provincial Maternity and Child Care Hospital, Lanzhou, Gansu 730050, P.R. China, Reproduction Medicine Center, Gansu Provincial Maternity and Child Care Hospital, Lanzhou, Gansu 730050, P.R. China, Discipline of Physiology, Gansu University of Chinese Medicine, Lanzhou, Gansu 730000, P.R. China, Perinatal Center, Gansu Provincial Maternity and Child Care Hospital, Lanzhou, Gansu 730050, P.R. China
    Copyright: © Li et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 2581-2588
    |
    Published online on: July 12, 2018
       https://doi.org/10.3892/mmr.2018.9274
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Pregnancy complications are associated with abnormal cytotrophoblast differentiation and invasion. Hydrogen peroxide (H2O2) is an important mediator of oxidative ischemia/reperfusion stress in the placenta. Lycium barbarum polysaccharides (LBP) have been demonstrated to counteract oxidative free radicals. The effects of LBP in trophoblast HTR8/SVneo cells injured with H2O2 were examined. A cell counting kit‑8 assay was performed to detect the effect of LBP at different concentrations on the proliferative ability of H2O2 injured trophoblast cells. Flow cytometry was used to determine the levels of reactive oxygen species (ROS), mitochondria membrane potential (MMP) disruption and apoptosis. Superoxide dismutase (SOD) activity and lactate dehydrogenase (LDH) leakage into the supernatant was detected by ultraviolet spectrophotometry. Reverse transcription‑quantitative polymerase chain reaction and western blot analysis were performed to detect the expression of apoptosis‑associated factors, including survivin, hypoxia inducible factor 1‑α (HIF1‑α), Bcl‑2 apoptosis regulator (Bcl‑2), Bcl‑2 associated X apoptosis regulator (Bax). The results revealed that LBP protected the proliferative ability of trophoblast cells injured with H2O2 in a dose‑dependent manner. LBP inhibited the oxidative stress induced by H2O2, by reducing ROS and LDH levels and increasing SOD activity. Additionally, LBP decreased MMP disruption and cell apoptosis induced by H2O2, by increasing the mRNA and protein expression of survivin, HIF1‑α and Bcl‑2 and decreasing Bax expression. Therefore, it was concluded that LBP protected human trophoblast cells from H2O2‑induced oxidative stress and cell apoptosis via regulation of apoptosis‑associated factor expression. It will provide a novel strategy for the treatment of pregnancy complications.

Introduction

Preeclampsia (PE), preterm labor and intrauterine growth retardation (IUGR) are detrimental pregnancy complications that result in significant perinatal morbidity and mortality. Normal placental development is associated with the differentiation and invasion of trophoblasts, the predominant cellular component of the placenta. PE is one of the most common and serious pregnancy complications characterized by maternal endothelial dysfunction (1). PE pathogenesis originates from abnormal cytotrophoblast differentiation, shallow cytotrophoblast invasion of the uterus and decreased maternal blood flow to the placenta (2). In addition, it is associated with future development of cardiovascular disease in the mother and child (3).

The molecular mechanism of PE remains unclear, but oxidative stress is considered to have an important role in the endothelial dysfunction and systemic vasoconstriction associated with PE (4,5). Hydrogen peroxide (H2O2), a key factor in the cellular oxidative stress cascade, is also reported as an important component in placental oxidative ischemia/reperfusion stress (6,7). Previous study has demonstrated that more H2O2 is produced in the maternal circulation of patients with PE in the stage of early pregnancy (8).

Apoptosis is critical for normal placental development and removes superfluous or dysfunctional cells to maintain normal tissue functions. However, apoptosis also participates in the pathophysiology of pregnancy complications (9). In addition, apoptosis is important in maintaining maternal immune tolerance to the antigens expressed on trophoblasts (10,11). Increased trophoblast apoptosis has been observed in pregnancy complications, including PE and IUGR (12–14), indicating that an alteration in trophoblast apoptosis may result in these diseases (15–17).

Lycium barbarum polysaccharides (LBP) is the active ingredient extracted from Lycium barbarum is, a plant species which produces the wolfberry and a traditional Chinese medicine, and has beneficial effects, particularly in the liver, kidney and eyes (18,19). Recent reports have demonstrated that LBP effectively improves immune function, resists oxidative free radicals and protects the testes from high-temperature injury (20). In China, Lycium barbarum is often used to treat male and female infertility in conjunction with other medicines. However, whether LBP repairs H2O2-induced injury in trophoblast cells remains unknown.

In the present study, an oxidative injury model of trophoblast cells damaged by H2O2 was established in order to determine the protective effect of LBP on H2O2-induced injury in trophoblast cells, and whether thus is mediated via apoptosis pathway regulation. The results of the present study may provide a novel strategy for the treatment of pregnancy complications, including PE and IUGR.

Materials and methods

Cell culture and treatment

Human trophoblast HTR8/SVneo cells were obtained from the American Type Culture Collection (Manassas, VA, USA). Cells were cultured in Dulbecco's modified Eagle's Medium (DMEM)/F12 nutrient mixture (Hyclone; GE Healthcare Life Sciences, Logan, UT, USA) supplemented with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and 1% penicillin/streptomycin in a humidified incubator containing 5% CO2 at 37°C. Cells in the logarithmic growth phase were used in subsequent experimentation.

LBP is the main active component of the Chinese wolfberry (21). LBP was purchased from Qinghai General Health Bio-science Co., LLC (Xining, China) and the purity of LBP was >50%. HTR8/SVneo cells were treated with different concentrations (100, 200 and 400 µg/ml) of LBP dissolved in PBS for 6 h. H2O2 (250 µmol/l; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) was subsequently added to treat cells for 6 h. There were five experimental groups in total: LBP1 + H2O2 (cells treated with 100 µg/ml LBP and 250 µmol/l H2O2), LBP2 + H2O2 (cells treated with 200 µg/ml LBP and 250 µmol/l H2O2), LBP3 + H2O2 (cells treated with 400 µg/ml LBP and 250 µmol/l H2O2), H2O2 (cells treated with 250 µmol/l H2O2) and control (without treatment) (22–24).

Cell viability assay

HTR8/SVneo cell viability was determined following treatment with LBP and H2O2, with Cell Counting kit-8 (CCK-8) assay (Beyotime Institute of Biotechnology, Haimen, China). Cells were treated with 250 µmol/l H2O2 for 1, 4 and 6 h. Briefly, following cells treatments, cells were seeded into a 96-well plate at an initial density of 5×103 cells/well and incubated in DMEM media with FBS for 24 h at 37°C. Then cells were treated with 100 µl 250 µmol/l H2O2 for 1, 4 and 6 h. At total of 20 µl CCK-8 reagent was added in and incubated for 1 h in a 5% CO2 incubator at 37°C. Finally, the optical density values were acquired with a microplate reader at 450 nm.

Reactive oxygen species (ROS) detection

ROS were detected in different groups (Control, H2O2, LBP1 + H2O2, LBP2 + H2O2, LBP3 + H2O2) with a 2′,7′-dichlorofluorescin diacetate (DCFH-DA) assay (Beyotime Institute of Biotechnology). After 6 h of 250 µmol/l H2O2 treatment, cells, treated with different concentrations (100, 200 and 400 µg/ml) of LBP for 6 h, were seeded into wells of 6-well plate. DCFH-DA (10 µmol/l) was subsequently added into each well. After incubation for 20 min at 37°C, cells were rinsed with PBS and analyzed by flow cytometry. ROS levels were analyzed by CellQuest software version 5.1 (BD Biosciences, Franklin Lakes, NJ, USA) and results were calculated relative to the control group.

Mitochondria membrane potential (MMP) detection

Alterations in the MMP of each group treated with LBP (100, 200 and 400 µg/ml) for 6 h and 250 µmol/l H2O2 for another 6 h were determined by aJC-1 assay (Nanjing KeyGen Biotech Co., Ltd., Nanjing, China), using the cationic dye to detect potential-dependent accumulation in mitochondria. Briefly, 5×105 cells were collected and resuspended in 500 µl PBS with JC-1 (10 µmol/l) for 20 min at 37°C. MMP alterations were reflected by a fluorescence emission shift from 550 nm (red) to 525 nm (green). Cells were analyzed by flow cytometry with Cell Quest software version 5.1 (BD Biosciences).

Apoptosis detection

The cell apoptosis proportion in each group treated with LBP (100, 200 and 400 µg/ml) for 6 h and 250 µmol/l H2O2 for another 6 h were determined by an Annexin-V/propidium iodide (PI) double-stain assay, according to the manufacturer's protocol (Roche Diagnostics, Indianapolis, IN, USA). Briefly, both floating and trypsinized adherent cells (5×105) of the five experimental groups were collected and resuspended in 500 µl PBS containing 0.5 µg/ml Annexin-V-fluorescein isothiocyanate for 20 min. Subsequently, 400 µl PBS with 50 µg/ml PI was added to cells for 5 min at room temperature in the dark. The analysis of cell apoptosis rate was immediately conducted with a flow cytometer and CellQuest software version 5.1 (BD Biosciences).

Superoxide dismutase (SOD) and lactate dehydrogenase (LDH) detection

The cell supernatant of each group was collected. The activity of the antioxidant enzyme SOD was determined using the total SOD assay kit with WST-8 (Beyotime Institute of Biotechnology) according to the manufacturer's protocol. During the reaction process of SOD detection, 2-iodophenyl-3-nitrophenyl tetrazolium chloride was catalyzed to formazin, which could be detected by a microplate reader. The activity of LDH was detected with a LDH assay kit (Beyotime Institute of Biotechnology), according to the manufacturer's protocol.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

The mRNA expression levels of survivin, hypoxia inducible factor 1-α (HIF1-α) and Bcl-2 apoptosis regulator (Bcl-2), Bcl-2 associated X apoptosis regulator (Bax) in each group was measured by RT-qPCR. Total RNA was extracted from cells using an RNeasy kit, and 1 µg RNA was reverse transcribed to cDNA using a Quantiscript Reverse Transcriptase kit (both Qiagen, Inc., Valencia, CA, USA), according to the manufacturer's protocol. PCR amplification was performed for 15 sec at 95°C, followed by 40 cycles of denaturation at 95°C for 15 sec and annealing/extension at 60°C for 25 sec in an ABI 7300 Thermocycler (Applied Biosystems; Thermo Fisher Scientific, Inc.) with Fast SYBR-Green Master Mix (Applied Biosystems; Thermo Fisher Scientific, Inc.). GAPDH was used as the reference gene; primer sequences are displayed in Table I. The quantification was identified by 2−ΔΔCq method (25).

Table I.

Primers used in the reverse transcription-quantitative polymerase chain reaction.

Table I.

Primers used in the reverse transcription-quantitative polymerase chain reaction.

NameDirectionSequence (5′-3′)Size (base pairs)
GAPDHForward CCATCTTCCAGGAGCGAGAT222
Reverse TGCTGATGATCTTGAGGCTG
SurvivinForward GGACCACCGCATCTCTACAT191
Reverse TTGGTTTCCTTTGCATGGGG
HIF1-αForward CAGTCGACACAGCCTGGATA210
Reverse CCACCTCTTTTGGCAAGCAT
BaxForward AACATGGAGCTGCAGAGGAT208
Reverse AACATGGAGCTGCAGAGGAT
Bcl-2Forward TTCTTTGAGTTCGGTGGGGT207
Reverse CTTCAGAGACAGCCAGGAGA

[i] HIF1-α, hypoxia inducible factor 1-α; Bcl-2, Bcl-2 apoptosis regulator; Bax, Bcl-2 associated X apoptosis regulator.

Western blot analysis

Cells were harvested, washed twice with PBS, lysed using lysis buffer (50 mM Tris-Cl, 150 mM NaCl, 0.02% NaN2, 100 µg/ml phenylmethanesulfonyl fluoride, 1 µg/ml aprotinin, and 1% Triton X-100) and centrifuged at a speed of 12,000 × g for 30 min at 4°C. The supernatant was subsequently collected from the lysate and protein concentration was determined by a bicinchoninic acid protein assay (Beyotime Institute of Biotechnology). A total of 10 µg proteins were boiled and separated by 10% SDS-PAGE, followed by transfer onto polyvinylidene fluoride (PVDF) membranes. Membranes were blocked with 5% non-fat dry milk in PBS for 1 h at 37°C and incubated with the following primary antibodies at 4°C overnight: Anti-survivin (cat. no. ab76424; 1:5,000), anti-HIF1-α (cat. no. ab51608; 1:1,000), anti-Bax (cat. no. ab53154; 1:1,000), anti-Bcl-2 (cat. no. ab59348; 1:1,000), anti-GAPDH (cat. no. ab9485; 1:2,500; all Abcam, Cambridge, MA, USA). Subsequently, proteins were incubated with horseradish peroxidase-conjugated goat anti-rabbit secondary antibody (cat. no. ab6721; 1:5,000; Abcam). PVDF membranes were exposed to X-ray film and immunoreactive bands were detected with an enhanced chemiluminescence detection kit (GE Healthcare Life Sciences). Finally, protein density was detected by Bio-Rad ChemiDoc XRS+ System with Image Lab Software version 4.1 (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Statistical analysis

Data is expressed as the mean ± standard deviation of three independent experiments. Statistical analyses were performed using SPSS 18.0 (SPSS, Inc., Chicago, IL, USA) and significance was calculated with one-way analysis of variance followed by Dunnett's post hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

LBP protects the proliferative ability of HTR8/SVneo cells injured with H2O2

To identify the effects of LBP on the proliferation of HTR8/SVneo cells injured by H2O2, a CCK8 assay was conducted in each experimental group (control, H2O2, LBP1 + H2O2, LBP2 + H2O2 and LBP3 + H2O2 groups). The results revealed that the cell proliferation ability of the H2O2 group was significantly reduced by 250 µmol/l H2O2 in a time-dependent manner, compared with the control group (P<0.01). When pre-treated with LBP for 6 h prior to the addition of H2O2, proliferation in the LBP1 + H2O2, LBP2 + H2O2 and LBP3 + H2O2 groups significantly increased in a dose-dependent manner, compared with the H2O2 group (P<0.05), indicating that LBP may protect the cell proliferation ability of HTR8/SVneo cells injured by H2O2 (Fig. 1).

Figure 1.

LBP protects the proliferative ability of HTR8/SVneo cells from H2O2 injury. A cell counting kit-8 assay was conducted to detect cell proliferation in each group. ##P<0.01 vs. control group; *P<0.05, **P<0.01 vs. H2O2 group. OD, optical density; LBP, Lycium barbarum polysaccharide; H2O2, hydrogen peroxide.

LBP reduces ROS levels in HTR8/SVneo cells injured by H2O2

Intracellular ROS levels were measured using the oxygen-sensitive fluorescent dye DCTH-DA. The assay results revealed that the accumulation of ROS in HTR8/SVneo cells was significantly increased in the H2O2 group, compared with the control (P<0.01). Furthermore, a significant decrease in ROS formation was detected in the LBP1 + H2O2, LBP2 + H2O2 and LBP3 + H2O2 groups, in a dose-dependent manner, compared with the H2O2 group (P<0.05; Fig. 2A).

Figure 2.

LBP decreases ROS and LDH levels, and increases SOD activity in HTR8/SVneo cells injured by H2O2. (A) Levels of ROS were detected by a 2′,7′-dichlorofluorescin diacetate assay. (B) The activity of the antioxidant enzyme SOD and (C) LDH leakage in the cell supernatant was determined. ##P<0.01 vs. control group; *P<0.05 and **P<0.01 vs. H2O2 group. H2O2, hydrogen peroxide; LBP, Lycium barbarum polysaccharide; ROS, reactive oxygen species; SOD, superoxide dismutase; LDH, lactate dehydrogenase.

LBP increases SOD levels and decreases LDH levels in HTR8/SVneo cells injured by H2O2

LDH leakage reflects cytotoxicity and mitochondrial damage (26). Levels of antioxidant enzyme SOD and leaked LDH in the cell supernatant were determined by the corresponding assay kits. Decreased SOD activity and increased LDH activity was detected in the H2O2 group, compared with the control group (P<0.01). LBP increased SOD activity and decreased LDH activity in dose-dependent manner, compared with H2O2 group (P<0.05; Fig. 2B and C).

LBP reduces the percentage of cells with MMP disruption in HTR8/SVneo cells injured by H2O2

The percentage of cells with MMP disruption was measured by JC-1 assay. The percentage of cells with MMP disruption in the H2O2 group was significantly increased compared with the control group (P<0.01). The percentage of cells with MMP disruption in the LBP1 + H2O2, LBP2 + H2O2 and LBP3 + H2O2 groups decreased significantly in a dose-dependent manner, when pretreated with different concentrations of LBP (100, 200 and 400 µg/ml) prior to H2O2 injury, compared with the H2O2 group (P<0.05; Fig. 3A). These results indicate that LBP may reduce MMP disruption in HTR8/SVneo cells with H2O2-induced injury.

Figure 3.

LBP reduces the percentage of cells with MMP disruption and inhibits cell apoptosis in HTR8/SVneo cells injured by H2O2. (A) MMP disruption was detected by a JC-1 assay. (B) Apoptosis was detected by an Annexin-V/propidium iodide double-stain assay and flow cytometry. ##P<0.01 vs. control group; *P<0.05, **P<0.01 vs. H2O2 group. H2O2, hydrogen peroxide; LBP, Lycium barbarum polysaccharide; MMP, mitochondrial membrane potential.

LBP inhibits cell apoptosis induced by H2O2 in HTR8/SVneo cells

An Annexin-V/PI double-stain assay was performed to detect the apoptosis status of each group. The apoptosis rate of the H2O2 group significantly increased compared with control group (P<0.01); apoptosis in the LBP1 + H2O2, LBP2 + H2O2 and LBP3 + H2O2 groups was significantly decreased in a dose-dependent manner, compared with the H2O2 group (P<0.05; Fig. 3B). This indicated that LBP may inhibit H2O2-induced apoptosis in HTR8/SVneo cells.

LBP regulates the expression of apoptosis-associated factors in HTR8/SVneo cells injured by H2O2

To detect whether the protective function of LBP on HTR8/SVneo cells injured by H2O2 was via regulation of apoptosis-associated factors, RT-qPCR (Fig. 4A) and western blot analysis (Fig. 4B and C) was performed to detect the expression of survivin, HIF1-α, Bax and Bcl-2 in TR8/SVneo cells treated with H2O2 and/or LBP. The results revealed that the mRNA and protein levels of survivin, HIF1-α and Bcl-2 decreased significantly in H2O2 group compared with control group, and significantly increased in the LBP treated groups in a dose dependent manner (P<0.05). The mRNA and protein levels of Bax exhibited the opposite trend (P<0.05).

Figure 4.

LBP regulates the expression of apoptosis-associated factors in HTR8/SVneo cells injured by H2O2. (A) Reverse transcription-quantitative polymerase chain reaction was performed to detect the mRNA levels of survivin, HIF1-α, Bax and Bcl-2 in TR8/SVneo cells treated with H2O2 and/or LBP. (B) Western blot analysis was performed to detect the protein levels of survivin, HIF1-α, Bax and Bcl-2 in TR8/SVneo cells treated with H2O2 and/or LBP. (C) Relative protein levels were determined by densitometric analysis. ##P<0.01 vs. control group; *P<0.05, **P<0.01 vs. H2O2 group. H2O2, hydrogen peroxide; LBP, Lycium barbarum polysaccharide; HIF1-α, hypoxia inducible factor 1-α; Bax, Bax, Bcl-2 associated X apoptosis regulator; Bcl-2, Bcl-2 apoptosis regulator.

Discussion

Pregnancy complications, including PE, cause marked damage to normal fetal development, which is associated with abnormal cytotrophoblast differentiation and invasion. As a key factor of the cellular oxidative stress cascade, H2O2 is considered an important component in placental oxidative ischemia/reperfusion stress. LBP has been reported to protect the testes from high-temperature injury, and improve immune ability and oxidative free radical resistance (27). However, whether LBP reduces H2O2-induced injury in trophoblast cells remains unclear.

LBPs are efficient free radical scavengers in vivo and may be useful in counteracting oxidative stress associated with aging (28,29). Therefore, the function of LBPs on oxidative injury in trophoblast cells in vitro was investigated in the present study. At present, H2O2 is the most commonly used substance to construct a cell model of oxidative stress in various research fields (30,31). In the present study, an oxidative injury model was established in trophoblast cells injured by H2O2 and the effects of LBP were examined, including those on oxidative stress, MMP and cell apoptosis. The proliferative ability of human trophoblast HTR8/SVneo cells following various treatments was evaluated with aCCK-8 assay and revealed that proliferation was reduced by H2O2 and LBP reduced the damage caused by H2O2 in a dose-dependent manner.

Oxidative stress is the imbalance of oxidative and anti-oxidative factors in cells, resulting in more ROS production than ROS elimination, causing cell and tissue damage (32). Abundant ROS accumulate when the placenta is under conditions of ischemia hypoxia, and trophoblast cells suffer from oxidative stress when pregnancy complications exist (33–36). The present study demonstrated that H2O2 treatment of cells resulted in abundant ROS accumulation in trophoblast cells, and LBP decreased the levels of ROS and oxidative stress induced by H2O2. Following this, the potential effect of LBP on antioxidant levels in H2O2 injured trophoblast HTR8/SVneo cells was also investigated. SOD is the most important antioxidant in the defense system of antioxidative injury (37). The latest LBP chemical component analysis demonstrated that all glycopeptides in LBP act as the eliminators of lipid peroxide active components (38–40). Thus, it was speculated that as an anti-oxidant, LBP may decrease trophoblast cell injury induced by oxygen free radicals and protect cell development and differentiation. The results of the present study demonstrated that LBP significantly increased SOD activity and reduced ROS levels simultaneously, to protect cells from oxidative injury. Disruption of the cell membrane induced by oxidative stress or apoptosis may mediate the release of enzymes from the cytoplasm into the culture media, including LDH, which is relatively stable. By detecting the amount of LDH leakage into culture media, the cytomembrane integrity was measured. The results indicated that LDH leakage was attenuated by LBP treatment in H2O2 injured trophoblast cells.

Oxidative stress is one of the main causes of cell apoptosis, through the mitochondria-dependent or independent pathways (41). Mitochondrial dysfunction caused by damage to structural integrity induces oxidative stress and the release of ROS (42). In addition, the apoptosis rates may reflect the degree of oxidative stress (43–45). The present research demonstrated an increased percentage of cells with MMP disruption and apoptosis in trophoblast cells injured by H2O2, whereas LBP could markedly alleviate these effects. Furthermore, it was revealed that the function of LBP in protecting trophoblast cells from H2O2-induced injury may be via regulation of apoptosis-associated factors, including survivin, HIF1-α, Bax and Bcl-2.

Survivin is an important member of the inhibitor of apoptosis protein family that regulates apoptosis and cell division (46). Previous research has demonstrated that the expression of survivin in embryonic development promotes tissue stability and differentiation (47,48). The inhibition of survivin expression in the early stage of embryonic development results in embryonic deformities (49). HIF1-α is highly expressed in anaerobic conditions, and promotes cell proliferation and tumor angiogenesis in cancer (50,51). Previous studies demonstrated that HIF1-α overexpression is associated with tumor aggressiveness in human neoplasms (52,53). HIF1-α knockdown promotes cell apoptosis by downregulating surviving, and upregulating caspase-3 and other apoptosis-promoting factors (54). Bcl-2 family members directly regulate death signals, or act indirectly through the intrinsic pathways of apoptosis, including regulation of pro-apoptotic factor release from the mitochondria. Aberrant excess expression of Bcl-2 inhibits cell apoptosis and induces tumor development, including in gastric, lung, papillary thyroid and ovarian cancer (55–58). Bax interacts with Bcl-2 to suppress its apoptosis-inhibiting effects. The data of the present study indicated that H2O2 may suppress the mRNA and protein expression of survivin, HIF1-α and Bcl-2, and facilitate Bax expression to promote apoptosis and oxidative stress. LBP pre-treatment promoted the expression of survivin, HIF1-α and Bcl-2, and decreased Bax expression to inhibit apoptosis and oxidative stress. Taken together, the results of the present study suggest that LBP alleviated H2O2-induced oxidative stress through altering MMP, inhibiting cell apoptosis and regulating the expression of apoptosis-associated factors in HTR8/SVneo cells.

In summary, an H2O2-injured HTR8/SVneo trophoblast cell model was constructed and LBP was demonstrated to reduce oxidative stress and apoptosis via regulating the expression of apoptosis-associated factors. Future research should focus on elucidating the mechanism of LBP in oxidative stress alleviation in trophoblast cells. Increased trophoblast cell protection from oxidative stress and apoptosis in pregnancy may provide improved treatment outcomes for individuals with pregnancy complications. In the future, the authors of the present study will examine the effects of LBP from a mechanistic view, in order to identify the receptors and downstream signals involved.

Acknowledgements

Not applicable.

Funding

Not applicable.

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors' contributions

JL designed the study; JL and ZD performed the flow cytometry to investigate the role of LBP on ROS, mitochondria and apoptosis regulation; YY detected cell viability; BM and YW did the RT-qPCR and western blotting assays; XX analyzed and interpreted all the experiments' data, drafted the manuscript and revised it.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Kim YM, Chaiworapongsa T, Gomez R, Bujold E, Yoon BH, Rotmensch S, Thaler HT and Romero R: Failure of physiologic transformation of the spiral arteries in the placental bed in preterm premature rupture of membranes. Am J Obstet Gynecol. 187:1137–1142. 2002. View Article : Google Scholar : PubMed/NCBI

2 

Pardi G, Marconi AM and Cetin I: Pathophysiology of intrauterine growth retardation: Role of the placenta. Acta Paediatr Suppl. 423:170–172. 1997. View Article : Google Scholar : PubMed/NCBI

3 

Hauspurg A, Ying W, Hubel CA, Michos ED and Ouyang P: Adverse pregnancy outcomes and future maternal cardiovascular disease. Clin Cardiol. 41:239–246. 2018. View Article : Google Scholar : PubMed/NCBI

4 

Hannan NJ, Binder NK, Beard S, Nguyen TV, Kaitu'u-Lino TJ and Tong S: Melatonin enhances antioxidant molecules in the placenta, reduces secretion of soluble fms-like tyrosine kinase 1 (sFLT) from primary trophoblast but does not rescue endothelial dysfunction: An evaluation of its potential to treat preeclampsia. PLoS One. 13:e01870822018. View Article : Google Scholar : PubMed/NCBI

5 

Wan J, Hu Z, Zeng K, Yin Y, Zhao M, Chen M and Chen Q: The reduction in circulating levels of estrogen and progesterone in women with preeclampsia. Pregnancy Hypertens. 11:18–25. 2018. View Article : Google Scholar : PubMed/NCBI

6 

Nagai R, Watanabe K, Wakatsuki A, Hamada F, Shinohara K, Hayashi Y, Imamura R and Fukaya T: Melatonin preserves fetal growth in rats by protecting against ischemia/reperfusion-induced oxidative/nitrosative mitochondrial damage in the placenta. J Pineal Res. 45:271–276. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Okatani Y, Wakatsuki A, Shinohara K, Taniguchi K and Fukaya T: Melatonin protects against oxidative mitochondrial damage induced in rat placenta by ischemia and reperfusion. J Pineal Res. 31:173–178. 2001. View Article : Google Scholar : PubMed/NCBI

8 

Aris A, Benali S, Ouellet A, Moutquin JM and Leblanc S: Potential biomarkers of preeclampsia: Inverse correlation between hydrogen peroxide and nitric oxide early in maternal circulation and at term in placenta of women with preeclampsia. Placenta. 30:342–347. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Straszewski-Chavez SL, Abrahams VM and Mor G: The role of apoptosis in the regulation of trophoblast survival and differentiation during pregnancy. Endocr Rev. 26:877–897. 2005. View Article : Google Scholar : PubMed/NCBI

10 

Fukushima K, Miyamoto S, Tsukimori K, Kobayashi H, Seki H, Takeda S, Kensuke E, Ohtani K, Shibuya M and Nakano H: Tumor necrosis factor and vascular endothelial growth factor induce endothelial integrin repertories, regulating endovascular differentiation and apoptosis in a human extravillous trophoblast cell line. Biol Reprod. 73:172–179. 2005. View Article : Google Scholar : PubMed/NCBI

11 

Huppertz B, Frank HG, Kingdom JC, Reister F and Kaufmann P: Villous cytotrophoblast regulation of the syncytial apoptotic cascade in the human placenta. Histochem Cell Biol. 110:495–508. 1998. View Article : Google Scholar : PubMed/NCBI

12 

Lewis MP, Clements M, Takeda S, Kirby PL, Seki H, Lonsdale LB, Sullivan MH, Elder MG and White JO: Partial characterization of an immortalized human trophoblast cell-line, TCL-1, which possesses a CSF-1 autocrine loop. Placenta. 17:137–146. 1996. View Article : Google Scholar : PubMed/NCBI

13 

Smith SC, Baker PN and Symonds EM: Increased placental apoptosis in intrauterine growth restriction. Am J Obstet Gynecol. 177:1395–1401. 1997. View Article : Google Scholar : PubMed/NCBI

14 

Crocker IP, Cooper S, Ong SC and Baker PN: Differences in apoptotic susceptibility of cytotrophoblasts and syncytiotrophoblasts in normal pregnancy to those complicated with preeclampsia and intrauterine growth restriction. Am J Pathol. 162:637–643. 2003. View Article : Google Scholar : PubMed/NCBI

15 

Ishihara N, Matsuo H, Murakoshi H, Laoag-Fernandez JB, Samoto T and Maruo T: Increased apoptosis in the syncytiotrophoblast in human term placentas complicated by either preeclampsia or intrauterine growth retardation. Am J Obstet Gynecol. 186:158–166. 2002. View Article : Google Scholar : PubMed/NCBI

16 

DiFederico E, Genbacev O and Fisher SJ: Preeclampsia is associated with widespread apoptosis of placental cytotrophoblasts within the uterine wall. Am J Pathol. 155:293–301. 1999. View Article : Google Scholar : PubMed/NCBI

17 

Moindjie H, Santos ED, Gouesse RJ, Swierkowski-Blanchard N, Serazin V, Barnea ER, Vialard F and Dieudonne MN: Preimplantation factor is an anti-apoptotic effector in human trophoblasts involving p53 signaling pathway. Cell Death Dis. 7:e25042016. View Article : Google Scholar : PubMed/NCBI

18 

Wang Z, Liu Y, Sun Y, Mou Q, Wang B, Zhang Y and Huang L: Structural characterization of LbGp1 from the fruits of Lycium barbarum L. Food Chem. 159:137–142. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Varoni MV, Gadau SD, Pasciu V, Baralla E, Serra E, Palomba D and Demontis MP: Investigation of the effects of Lycium barbarum polysaccharides against cadmium induced damage in testis. Exp Mol Pathol. 103:26–32. 2017. View Article : Google Scholar : PubMed/NCBI

20 

Po KK, Leung JW, Chan JN, Fung TK, Sánchez-Vidaña DI, Sin EL, So KF, Lau BW and Siu AM: Protective effect of Lycium Barbarum polysaccharides on dextromethorphan-induced mood impairment and neurogenesis suppression. Brain Res Bull. 134:10–17. 2017. View Article : Google Scholar : PubMed/NCBI

21 

Liu WJ, Jiang HF, Rehman FU, Zhang JW, Chang Y, Jing L and Zhang JZ: Lycium barbarum polysaccharides decrease hyperglycemia-aggravated ischemic brain injury through maintaining mitochondrial fission and fusion balance. Int J Biol Sci. 13:901–910. 2017. View Article : Google Scholar : PubMed/NCBI

22 

Liu L, Lao W, Ji QS, Yang ZH, Yu GC and Zhong JX: Lycium barbarum polysaccharides protected human retinal pigment epithelial cells against oxidative stress-induced apoptosis. Int J Ophthalmol. 8:11–16. 2015.PubMed/NCBI

23 

Zhang XJ, Yu HY, Cai YJ and Ke M: Lycium barbarum polysaccharides inhibit proliferation and migration of bladder cancer cell lines BIU87 by suppressing Pi3K/AKT pathway. Oncotarget. 8:5936–5942. 2017.PubMed/NCBI

24 

Tian JY, Chen WW, Cui J, Wang H, Chao C, Lu ZY and Bi YY: Effect of Lycium bararum polysaccharides on methylmercury-induced abnormal differentiation of hippocampal stem cells. Exp Ther Med. 12:683–689. 2016. View Article : Google Scholar : PubMed/NCBI

25 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

26 

Datta S and Chakrabarti N: Age related rise in lactate and its correlation with lactate dehydrogenase (LDH) status in post-mitochondrial fractions isolated from different regions of brain in mice. Neurochem Int. 118:23–33. 2018. View Article : Google Scholar : PubMed/NCBI

27 

Shan T, Shan T, Liu F, Zheng H and Li G: Effects of Lycium barbarum polysaccharides on the damage to human endometrial stromal cells induced by hydrogen peroxide. Mol Med Rep. 15:879–884. 2017. View Article : Google Scholar : PubMed/NCBI

28 

Gao Y, Wei Y, Wang Y, Gao F and Chen Z: Lycium barbarum: A traditional chinese herb and a promising anti-aging agent. Aging Dis. 8:778–791. 2017. View Article : Google Scholar : PubMed/NCBI

29 

Lin CL, Wang CC, Chang SC, Inbaraj BS and Chen BH: Antioxidative activity of polysaccharide fractions isolated from Lycium barbarum Linnaeus. Int J Biol Macromol. 45:146–151. 2009. View Article : Google Scholar : PubMed/NCBI

30 

Bittner L, Wyck S, Herrera C, Siuda M, Wrenzycki C, van Loon B and Bollwein H: Negative effects of oxidative stress in bovine spermatozoa on in vitro development and DNA integrity of embryos. Reprod Fertil Dev. May 1–2018.(Epub ahead of print). View Article : Google Scholar : PubMed/NCBI

31 

Che X, Zhao Q and Li D: Expression of thioredoxin-2 in human lens epithelial cells with oxidative damage and its significance. Zhong Nan Da Xue Xue Bao Yi Xue Ban. 43:253–259. 2018.(In Chinese). PubMed/NCBI

32 

Kupsco A and Schlenk D: Oxidative stress, unfolded protein response, and apoptosis in developmental toxicity. Int Rev Cell Mol Biol. 317:1–66. 2015. View Article : Google Scholar : PubMed/NCBI

33 

Poston L, Igosheva N, Mistry HD, Seed PT, Shennan AH, Rana S, Karumanchi SA and Chappell LC: Role of oxidative stress and antioxidant supplementation in pregnancy disorders. Am J Clin Nutr. 94 6 Suppl:1980S–1985S. 2011. View Article : Google Scholar : PubMed/NCBI

34 

Deepa D, Jayakumari N and Thomas SV: Oxidative stress is increased in women with epilepsy: Is it a potential mechanism of anti-epileptic drug-induced teratogenesis? Ann Indian Acad Neurol. 15:281–286. 2012. View Article : Google Scholar : PubMed/NCBI

35 

Kovacic P and Somanathan R: Mechanism of teratogenesis: Electron transfer, reactive oxygen species, and antioxidants. Birth Defects Res C Embryo Today. 78:308–325. 2006. View Article : Google Scholar : PubMed/NCBI

36 

Burton GJ and Jauniaux E: Placental oxidative stress: From miscarriage to preeclampsia. J Soc Gynecol Investig. 11:342–352. 2004. View Article : Google Scholar : PubMed/NCBI

37 

Su Y, Han W and Cao Y: Association between activities of SOD, MDA and Na+-K+-ATPase in peripheral blood of patients with acute myocardial infarction and the complication of varying degrees of arrhythmia. Hellenic J Cardiol. Apr 24–2018.(Epub ahead of print).

38 

Schoppet M, Tailhades J, Kulkarni K and Cryle MJ: Precursor Manipulation in Glycopeptide Antibiotic Biosynthesis: Are β-Amino Acids Compatible with the Oxidative Cyclization Cascade? J Org Chem. Apr 30–2018.(Epub ahead of print). View Article : Google Scholar : PubMed/NCBI

39 

Chen L, Li W, Qi D and Wang D: Lycium barbarum polysaccharide protects against LPS-induced ARDS by inhibiting apoptosis, oxidative stress, and inflammation in pulmonary endothelial cells. Free Radic Res. 52:480–490. 2018. View Article : Google Scholar : PubMed/NCBI

40 

Varoni MV, Pasciu V, Gadau SD, Baralla E, Serra E, Palomba D and Demontis MP: Possible antioxidant effect of Lycium barbarum polysaccharides on hepatic cadmium-induced oxidative stress in rats. Environ Sci Pollut Res Int. 24:2946–2955. 2017. View Article : Google Scholar : PubMed/NCBI

41 

Sinha K, Das J, Pal PB and Sil PC: Oxidative stress: The mitochondria-dependent and mitochondria-independent pathways of apoptosis. Arch Toxicol. 87:1157–1180. 2013. View Article : Google Scholar : PubMed/NCBI

42 

Chen S, Lv X, Hu B, Zhao L, Li S, Li Z, Qing X, Liu H, Xu J and Shao Z: Critical contribution of RIPK1 mediated mitochondrial dysfunction and oxidative stress to compression-induced rat nucleus pulposus cells necroptosis and apoptosis. Apoptosis. Apr 28–2018.(Epub ahead of print). View Article : Google Scholar

43 

Ahmadian E, Khosroushahi AY, Eftekhari A, Farajnia S, Babaei H and Eghbal MA: Novel angiotensin receptor blocker, azilsartan induces oxidative stress and NFkB-mediated apoptosis in hepatocellular carcinoma cell line HepG2. Biomed Pharmacother. 99:939–946. 2018. View Article : Google Scholar : PubMed/NCBI

44 

Liang J, Wu S, Xie W and He H: Ketamine ameliorates oxidative stress-induced apoptosis in experimental traumatic brain injury via the Nrf2 pathway. Drug Des Devel Ther. 12:845–853. 2018. View Article : Google Scholar : PubMed/NCBI

45 

Sarvestani Namazi N, Firouzi Saberi S, Falak R, Karimi MY, Gholami Davoodzadeh M, Rangbar A and Hosseini A: Phosphodiesterase 4 and 7 inhibitors produce protective effects against high glucose-induced neurotoxicity in PC12 cells via modulation of the oxidative stress, apoptosis and inflammation pathways. Metab Brain Dis. Apr 30–2018.(Epub ahead of print).

46 

Zhang Z, Wang H, Jin Z, Cai X, Gao N, Cui X, Liu P, Zhang J, Yang S and Yang X: Downregulation of survivin regulates adult hippocampal neurogenesis and apoptosis, and inhibits spatial learning and memory following traumatic brain injury. Neuroscience. 300:219–228. 2015. View Article : Google Scholar : PubMed/NCBI

47 

Ambrosini G, Adida C and Altieri DC: A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma. Nat Med. 3:917–921. 1997. View Article : Google Scholar : PubMed/NCBI

48 

Kawasaki H, Altieri DC, Lu CD, Toyoda M, Tenjo T and Tanigawa N: Inhibition of apoptosis by survivin predicts shorter survival rates in colorectal cancer. Cancer Res. 58:5071–5074. 1998.PubMed/NCBI

49 

Adida C, Crotty PL, McGrath J, Berrebi D, Diebold J and Altieri DC: Developmentally regulated expression of the novel cancer anti-apoptosis gene survivin in human and mouse differentiation. Am J Pathol. 152:43–49. 1998.PubMed/NCBI

50 

Magnon C, Opolon P, Ricard M, Connault E, Ardouin P, Galaup A, Métivier D, Bidart JM, Germain S, Perricaudet M and Schlumberger M: Radiation and inhibition of angiogenesis by canstatin synergize to induce HIF-1alpha-mediated tumor apoptotic switch. J Clin Invest. 117:1844–1855. 2007. View Article : Google Scholar : PubMed/NCBI

51 

Fujiwara S, Nakagawa K, Harada H, Nagato S, Furukawa K, Teraoka M, Seno T, Oka K, Iwata S and Ohnishi T: Silencing hypoxia-inducible factor-1alpha inhibits cell migration and invasion under hypoxic environment in malignant gliomas. Int J Oncol. 30:793–802. 2007.PubMed/NCBI

52 

Unruh A, Ressel A, Mohamed HG, Johnson RS, Nadrowitz R, Richter E, Katschinski DM and Wenger RH: The hypoxia-inducible factor-1 alpha is a negative factor for tumor therapy. Oncogene. 22:3213–3220. 2003. View Article : Google Scholar : PubMed/NCBI

53 

Zagzag D, Zhong H, Scalzitti JM, Laughner E, Simons JW and Semenza GL: Expression of hypoxia-inducible factor 1alpha in brain tumors: Association with angiogenesis, invasion, and progression. Cancer. 88:2606–2618. 2000. View Article : Google Scholar : PubMed/NCBI

54 

Li X, Liu X, Xu Y, Liu J, Xie M, Ni W and Chen S: KLF5 promotes hypoxia-induced survival and inhibits apoptosis in non-small cell lung cancer cells via HIF-1α. Int J Oncol. 45:1507–1514. 2014. View Article : Google Scholar : PubMed/NCBI

55 

Mitselou A, Peschos D, Dallas P, Charalabopoulos K, Agnantis NJ and Vougiouklakis T: Immunohistochemical analysis of expression of bcl-2 protein in papillary carcinomas and papillary microcarcinomas of the thyroid gland. Exp Oncol. 26:282–286. 2004.PubMed/NCBI

56 

Basolo F, Pollina L, Fontanini G, Fiore L, Pacini F and Baldanzi A: Apoptosis and proliferation in thyroid carcinoma: Correlation with bcl-2 and p53 protein expression. Br J Cancer. 75:537–541. 1997. View Article : Google Scholar : PubMed/NCBI

57 

Yoo NJ, Kim MS and Lee SH: Expression and mutation analyses of Fas, FLIP and Bcl-2 in granulosa cell tumor of ovary. Tumori. 98:118e–121e. 2012. View Article : Google Scholar : PubMed/NCBI

58 

Yildirim M, Suren D, Goktas S, Dilli UD, Kaya C, Copuroglu R, Yildiz M and Sezer C: The predictive role of Bcl-2 expression in operable locally advanced or metastatic gastric carcinoma. J BUON. 17:106–109. 2012.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li J, Ding Z, Yang Y, Mao B, Wang Y and Xu X: Lycium barbarum polysaccharides protect human trophoblast HTR8/SVneo cells from hydrogen peroxide‑induced oxidative stress and apoptosis. Mol Med Rep 18: 2581-2588, 2018.
APA
Li, J., Ding, Z., Yang, Y., Mao, B., Wang, Y., & Xu, X. (2018). Lycium barbarum polysaccharides protect human trophoblast HTR8/SVneo cells from hydrogen peroxide‑induced oxidative stress and apoptosis. Molecular Medicine Reports, 18, 2581-2588. https://doi.org/10.3892/mmr.2018.9274
MLA
Li, J., Ding, Z., Yang, Y., Mao, B., Wang, Y., Xu, X."Lycium barbarum polysaccharides protect human trophoblast HTR8/SVneo cells from hydrogen peroxide‑induced oxidative stress and apoptosis". Molecular Medicine Reports 18.3 (2018): 2581-2588.
Chicago
Li, J., Ding, Z., Yang, Y., Mao, B., Wang, Y., Xu, X."Lycium barbarum polysaccharides protect human trophoblast HTR8/SVneo cells from hydrogen peroxide‑induced oxidative stress and apoptosis". Molecular Medicine Reports 18, no. 3 (2018): 2581-2588. https://doi.org/10.3892/mmr.2018.9274
Copy and paste a formatted citation
x
Spandidos Publications style
Li J, Ding Z, Yang Y, Mao B, Wang Y and Xu X: Lycium barbarum polysaccharides protect human trophoblast HTR8/SVneo cells from hydrogen peroxide‑induced oxidative stress and apoptosis. Mol Med Rep 18: 2581-2588, 2018.
APA
Li, J., Ding, Z., Yang, Y., Mao, B., Wang, Y., & Xu, X. (2018). Lycium barbarum polysaccharides protect human trophoblast HTR8/SVneo cells from hydrogen peroxide‑induced oxidative stress and apoptosis. Molecular Medicine Reports, 18, 2581-2588. https://doi.org/10.3892/mmr.2018.9274
MLA
Li, J., Ding, Z., Yang, Y., Mao, B., Wang, Y., Xu, X."Lycium barbarum polysaccharides protect human trophoblast HTR8/SVneo cells from hydrogen peroxide‑induced oxidative stress and apoptosis". Molecular Medicine Reports 18.3 (2018): 2581-2588.
Chicago
Li, J., Ding, Z., Yang, Y., Mao, B., Wang, Y., Xu, X."Lycium barbarum polysaccharides protect human trophoblast HTR8/SVneo cells from hydrogen peroxide‑induced oxidative stress and apoptosis". Molecular Medicine Reports 18, no. 3 (2018): 2581-2588. https://doi.org/10.3892/mmr.2018.9274
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team