Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
July-2017 Volume 14 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2017 Volume 14 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

MicroRNA expression profiling in patients with hepatocellular carcinoma of familial aggregation and hepatitis B virus infection

  • Authors:
    • Er‑Lei Zhang
    • Jin Gu
    • Zun‑Yi Zhang
    • Ke‑Shuai Dong
    • Bin‑Yong Liang
    • Zhi‑Yong Huang
  • View Affiliations / Copyright

    Affiliations: Hepatic Surgery Center, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei 430030, P.R. China
  • Pages: 971-976
    |
    Published online on: May 16, 2017
       https://doi.org/10.3892/ol.2017.6178
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Numerous studies have suggested that microRNAs (miRNAs) potently affect hepatocarcinogenesis. However, the miRNA expression profiling in patients with hepatocellular carcinoma (HCC) of familial aggregation and hepatitis B virus (HBV) infection has not been elucidated. In the present study, the plasma miRNA expression profiles of 3 patients with HCC with familial aggregation of HCC and HBV infection and 1 healthy volunteer were examined by microarray analysis, in order to identify relevant miRNAs involved in the pathogenesis of HCC with familial aggregation and HBV infection. The results indicated that 26 miRNAs exhibited a ≥20‑fold increase or decrease in the plasma of patients with HCC, compared with the healthy control (24 upregulated and 2 downregulated). Among these altered miRNAs, 15 of them have been reported in HCC. The other 11 miRNAs have never been reported in HCC. These differentially‑expressed miRNAs may be potential molecular markers for HCC pathogenesis and development.

Introduction

Hepatocellular carcinoma (HCC) remains one of the most prevalent malignant diseases in the world (1). Chronic infection with the hepatitis B virus (HBV) is the most important risk factor for HCC, accounting for 55% of global incidences and >80% of cases in Asia and sub-Saharan Africa (2). Patients infected with HBV are known to be at an increased risk of developing HCC over their lifetime (3–5). Previous studies have reported familial aggregation of HCC (6,7), and previous meta-analyses have indicated that family history of HCC increases the risk of HCC in patients with viral hepatitis, independently of hepatitis (8). A previous study examined the effect of a family history of HCC on the incidence of HCC in the entire population who were screened for HBV seromarkers, and elucidated that family history of HCC multiplied the risk of HCC at each stage of HBV infection (7). Although numerous molecular studies have revealed that the HBV-encoded X (HBx) protein performs a critical role in hepatocarcinogenesis in patients with HBV-associated HCC (9–12), the mechanisms underlying familial clustering-associated carcinogenesis remain to be fully elucidated.

MicroRNAs (miRNAs/miRs) comprise a class of highly-conserved noncoding RNAs of ~22 nucleotides in length (13). Mature miRNAs may interact with the 3′-untranslated regions (UTRs) of target mRNAs to form RNA-induced silencing complexes, resulting in the inhibition of translation or mRNA cleavage (14). Previous studies have revealed that miRNAs may regulate gene expression at the posttranscriptional level and performs a role in regulating epigenetic machinery, including DNA methylation and histone modification (15–18). Since miRNAs perform important roles in various pivotal biological processes, dysregulated miRNA expression has been implicated in a variety of human diseases, including chronic HBV infection and hepatocarcinogenesis (19). An increasing amount of evidence has indicated that dysregulation of miRNAs has important roles in HBV infection and HBV-associated HCC (9,20–22). Numerous studies have demonstrated that the HBx protein is associated with the regulation of miRNAs, which affects basic tumor processes, including cellular proliferation, differentiation and metastasis (12,23–27). In addition, a family history of HCC increases the risk of HCC, even following adjustment for other risk factors, and in patients without hepatitis serum markers (28). However, little is known regarding the association between miRNAs and family aggregation of HCC in patients with HBV infection.

In the present study, microarray analysis was performed to study the miRNA profile in the plasma of patients with HCC with familial aggregation of HCC and HBV infection, compared with the healthy control. The present study may help improve understanding of the key roles of miRNAs in the progression of HCC, and pave the way to future studies on the molecular mechanism of hepatocarcinogenesis.

Materials and methods

Patients and samples

A total of 3 patients with HCC with a history of familial aggregation of HCC and HBV infection underwent liver resection at the Hepatic Surgery Center, Tongji Hospital, Tongji Medical College, Huazhonog University of Science and Technology (Wuhan, China) between December 2011 and March 2012. Blood samples were obtained from these 3 patients prior to liver resection. HCC was diagnosed based on cytohistological evidence from resected specimens. These patients were not treated with any radiochemotherapy prior to blood drawing. Blood collected from a healthy volunteer was used as a control. The baseline information of all enrolled subjects is presented in Table I. Written consent for sample collection was obtained from all the patients, and the protocol was approved by the Institutional Research Ethics Committee of Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology.

Table I.

Baseline information of 3 patients with HCC and 1 volunteer.

Table I.

Baseline information of 3 patients with HCC and 1 volunteer.

PatientSexAge, yearsDiagnosisEdmondson-steiner gradeFamily history of HCCSampling date
1F42HBV/HCCIIOne sister and one brother2011–12–24
2M43HBV/HCCITwo brothers2012-01-28
3M38HBV/HCCIIFather and one brother2012-03-17
ControlM38Healthy–None2012-03-18

[i] HCC, hepatocellular carcinoma; HBV, hepatitis B virus; F, female; M, male.

Familial aggregation of HCC is defined as having a first degree relative (including parents, siblings and children) with HCC (7). The diagnosis of familial aggregation of HCC of these 3 patients was confirmed with the help of a standardized questionnaire that was given to all patients at the baseline visit. Other family members also received liver resection or medical treatment at Tongji Hospital with the diagnosis of HCC. Their blood samples are no longer available as they have passed away.

miRNA microarray analysis

Plasma samples were acquired by high-speed centrifugation (12,000 × g at 4°C for 10 min) and stored at −80°C. Agilent human miRNA V16.0 from Agilent Technologies (Santa Clara, CA, USA) was used to identify differentiated miRNAs between familial patients with HCC with HBV infection and the healthy volunteer. All protocols were performed by the professional Shanghai Biological Corporation (Shanghai, China).

Data analysis

According to the results of microarray analysis, the miRNAs that exhibited ≥20-fold increase or decrease in the plasma of patients with HCC compared with the healthy control were selected. To evaluate the list of differentially-expressed miRNAs in the context of the current literature, the names of these differentially-expressed miRNAs were used as a keyword for online searches and detailed information was extracted. The following databases were utilized: PubMed (https://www.ncbi.nlm.nih.gov/pubmed/), Web of Science (http://www.webofknowledge.com/) and Google Scholar (http://scholar.google.com) search.

Results

Microarray results of the differentially-expressed miRNAs in the plasma of patients with HCC

Microarray results identified 37 miRNAs with a significant difference in expression between the patients with HCC and the healthy control, including 30 upregulated and 7 downregulated (Fig. 1) (27). Among the differentially expressed miRNAs, 26 miRNAs exhibited a ≥20-fold increase or decrease in the plasma of patients with HCC, compared with the healthy control.

Figure 1.

Heatmap of differentially-expressed miRNAs in the plasma of a healthy control and 3 patients with HCC with family history of HCC and hepatitis B virus infection using microarray analysis. miRNA/miR, microRNA; HCC, hepatocellular carcinoma; hsa, Homo sapiens.

By searching the databases of PubMed, Web of Science and Google Scholar, 15 of these differentially-expressed miRNAs have been extensively reported in HCC, and 12 of them have been fully elucidated for their roles in the progression of hepatocarcinogenesis (Table II). Notably, the remaining 11 miRNAs (10 upregulated and 1 downregulated) have never been reported in liver cancer (Table III). Among them, the levels of plasma miR-3188, miR-374a, miR-4271, miR-1471, miR-188-5p, miR-1183, miR-3610, miR-454, miR-324-3p and miR-484 were significantly increased in patients with HCC compared with the healthy control, corresponding to a fold-change of 124.5, 121.4, 96.8, 96.3, 82.1, 81.9, 64.8, 62.9, 48.7 and 29.4, respectively (P<0.05). Comparing the patients with HCC with the healthy control, only plasma miR-216b level was significantly downregulated with a fold-change of 127.6 (P<0.01). The expression status of miR-216b was investigated in 150 HCC tissues, and it was observed that miR-216b expression was downregulated in 90 patients compared with normal liver tissues. The 5-year overall survival and disease-free survival rates were significantly improved in HCC patients with increased miR-216b expression in comparison with the downregulated miR-216b expression group (P<0.001) (27).

Table II.

miRNAs have been reported in HCC, which exhibited at least a 20-fold increase or decrease in plasma expression of patients with HCC compared with the healthy control.

Table II.

miRNAs have been reported in HCC, which exhibited at least a 20-fold increase or decrease in plasma expression of patients with HCC compared with the healthy control.

miRNA nameSequenceFold-changeTargetsPublished yearChrHBx regulation
hsa-miR-215 GTCTGTCAATTCATAGGTCAT277.3PTPRT2014chr1Yes
hsa-miR-3188CCCCGTATCCGCA124.5mTOR2016chr19No
hsa-miR-23b GGTAATCCCTGGCAATG102.9c-Met2009chr9No
hsa-miR-18a CTATCTGCACTAGATGCA97.3ER-α2009chr13Yes/no
hsa-miR-320aTCGCCCTCTCAAC88.3GNAI12012chr8No
hsa-miR-199a-3p TAACCAATGTGCAGACTACT63.7mTOR/c-Met2010chr1No
hsa-miR-151-5p ACTAGACTGTGAGCTCC61.2RhoGDIA2010chr8No
hsa-miR-140-5p CTACCATAGGGTAAAACCACT38.2TGF-β2013chr16No
hsa-miR-130b ATGCCCTTTCATCATTGC34.9PPAR-γ2014chr22No
hsa-miR-197 GCTGGGTGGAGAAGGTG33.8CD822014chr1No
hsa-miR-148b ACAAAGTTCTGTGATGCAC33.4NA2014chr12No
hsa-miR-30a CTTCCAGTCGAGGATG31.1SNAI12014chr6No
hsa-miR-7 ACAACAAAATCACTAGTCTTCC24.5CCNE12013chr9Yes
hsa-miR-30c GCTGAGAGTGTAGGATGT24.4NA2014chr1No
hsa-miR-194 TCCACATGGAGTTGCT22.2NA2014chr1No
hsa-miR-138-2* AACCCTGGTGTCGTGA−106.3Cyclin D32012chr16Yes/no

[i] Yes/no means these miRNAs have been reported differently between HBV-associated HCC and HCC with no HBV infection. miRNA/miR, microRNA; HCC, hepatocellular carcinoma; chr, chromosome; HBx, hepatitis B virus-encoded X protein; hsa, Homo sapiens; PTPRT, protein tyrosine phosphatase receptor type T; ER-α, estrogen receptor-α; GNAI1, guanine nucleotide-binding protein (G protein); mTOR, mechanistic target of rapamycin; TGF-β, transforming growth factor β; PPAR-γ, peroxisome proliferator-activated receptor γ; CD82, cluster of differentiation 82; NA, not available; SNAI1, snail homolog 1; CCNE1, cyclin E1.

Table III.

miRNAs have never been reported in HCC, which exhibited at least a 20-fold increase or decrease in expression of patients with HCC compared with the healthy control.

Table III.

miRNAs have never been reported in HCC, which exhibited at least a 20-fold increase or decrease in expression of patients with HCC compared with the healthy control.

miRNA nameSequenceFold-changeChr
hsa-miR-374a CACTTATCAGGTTGTATTATAA121.4chrX
hsa-miR-4271 CCCCACCTTTTCTTCC96.8chr3
hsa-miR-1471 ACACCTGGCTCCACA96.3chr2
hsa-miR-188-5pCCCTCCACCATGC82.1chrX
hsa-miR-1183 TGCCCACTCTCACCA81.9chr7
hsa-miR-3610CGGCGCCTCCTT64.8chr8
hsa-miR-454 ACCCTATAAGCAATATTGCAC62.9chr17
hsa-miR-324-3p CCAGCAGCACCTGGGG48.7chr17
hsa-miR-484 ATCGGGAGGGGACTGA29.4chr16
hsa-miR-216b TCACATTTGCCTGCAG−127.6chr2

[i] miRNA/miR, microRNA; HCC, hepatocellular carcinoma; chr, chromosome; hsa, Homo sapiens.

Discussion

Dysregulation of miRNAs is involved in the initiation and progression of various cancers, including HCC (19). Previous studies revealed that common and specific mechanisms exist at the miRNA level during HBV-induced hepatocarcinogenesis (29), and miRNAs may function as potential biomarkers for HBV-associated HCC (20,30). In addition, family history of HCC may improve the risk of HCC at each stage of HBV infection (7). The present study aimed to identify the plasma miRNAs that are differentially expressed in patients with HCC with familial aggregation of HCC and HBV infection.

In the present study, by virtue of microarray analysis, specific groups of miRNAs were identified, whose expression is significantly altered in the plasma of patients with HCC with familial aggregation of HCC and HBV infection. A total of 37 differently-expressed miRNAs were identified, and among them, 26 miRNAs exhibited ≥20-fold-changes in the plasma of patients with HCC compared with the healthy controls. By reviewing the available literature published in previous years, among these 37 differentially expressed miRNAs, 15 miRNAs have been reported in HCC, and 12 miRNAs of them have been elaborated for the detailed molecular mechanism in the progression of HCC (Table II). The remaining 11 miRNAs have never been studied in liver cancer (Table III). Among the 11 differentially dysregulated miRNAs, the function of miR-374a, miR-188-5p, miR-1183, miR-454, miR-324-3p, miR-484, miR-3188, and miR-216b have been studied in human cancers (27,31–43); however, the exact function of miR-4271, miR-1471 and miR-3610 remains unclear.

Of these 11 miRNAs, miR-216b exhibited a 127.6-fold decrease in expression in the plasma of patients with HCC compared with that of the healthy control. Deng et al (44) firstly observed miR-216b expression in nasopharyngeal carcinoma and indicated that miR-216b was downregulated in nasopharyngeal carcinoma cell lines and specimens. miR-216b may suppress tumor growth and invasion by targeting KRAS, which performs an important role in the initiation and progression of HBV-associated HCC in mice models (45). Other studies have also revealed that miR-216b functions as a tumor-suppressor gene in colorectal and pancreatic cancers (46,47). The function of miR-216b in the pathogenesis of HCC was then studied. The present results indicated that miR-216b expression was significantly lower (P<0.001) in tumor tissues compared with adjacent liver tissues, and its expression was associated with tumor size, HBV infection, HBV-DNA quantity and incidence of portal vein tumor thrombosis (27). Prognostic analysis revealed that the 5-year overall survival and disease-free survival rates were significantly improved in patients with HCC with increased miR-216b expression in comparison with the downregulated miR-216b expression group (P<0.001). In an in vitro study, miR-216b inhibited cellular proliferation, migration and invasion of HCC by directly targeting insulin-like growth factor mRNA binding protein 2, and was downregulated by HBx (27). When a miR-216b-specific inhibitor was used to block miR-216b expression in SMMC-7721 cells, in vitro and in vivo assays revealed a significant increase in proliferation, migration and invasion, compared with control SMMC-7721 cells (27).

Cai et al (31) demonstrated that miR-374a may activate Wnt/β-catenin signaling to promote breast cancer metastasis and may perform as a therapeutic target for early metastatic breast cancer. Wnt/β-catenin signaling has been demonstrated to perform an important role in the development and promotion of liver cancer metastasis (48), and the HBx protein is essential for the activation of Wnt/β-catenin signaling in hepatoma cells (49). The expression of miR-374a was investigated in tumor tissues and adjacent normal tissues in the present study, and it was identified that no difference was observed between HCC and para-HCC tissue. The function of miR-374a in HBV-associated HCC requires additional study. A previous study indicated that miR-1183 and miR-188-5p may represent specific predictors of response to chemoradiotherapy in rectal cancer (32). miR-188-5p is involved in the process of prostate cancer by regulating lysosomal protein transmembrane 4 β (LAPTM4B) (33). The downregulation of miR-188-5p is an independent prognostic factor for poor overall and biochemical recurrence-free survival rates, restoration of miR-188-5p in prostate cancer (PCa) cells significantly suppresses proliferation, migration and invasion in vitro and inhibits tumor growth and metastasis in vivo (33); Overexpression of miR-188-5p in PC-3 cells may significantly enhance the chemosensitivity of the cells to adriamycin (33). The miR-188-5p/LAPTM4B/phosphoinositide-3 kinase/protein kinase B regulatory network performs an important role in PCa progression and chemotherapeutic drug sensitivity (33). Recently, Fang et al (50) indicated that miR-188-5p was significantly decreased in HCC tissue, and that overexpression of miR-188-5p suppresses tumor cellular proliferation and metastasis by directly targeting fibroblastic growth factor 5 in HCC. However, in the present study, miR-188-5p exhibited an 82.1-fold increase in the plasma of patients with HCC compared with the healthy control. This demonstrated that the expression of miRNAs in the serum cannot completely reflect its expression in the tissue.

Hu et al (34) detected the serum miRNA profiling in patients with breast cancer. Normalized by the two endogenous control miRNAs, the authors revealed that the serum miR-324-3p expression may act as a non-invasive prediction biomarker for breast cancer. Macconi et al (35) indicated that miR-324-3p promotes renal fibrosis by targeting prolyl endopeptidase. In addition, a previous study revealed that miR-324-3p targets the promoter of RelA, commonly known as p65, a subunit of nuclear factor-kB, and significantly induced the endogenous RelA mRNA and protein expression in PC12 cells (36). The present results also demonstrated that miR-324-3p exhibited a 48.7-fold increase in the plasma of patients with HCC compared with the control, which may be considered as a biomarker in HCC.

miR-484 has been identified to be increased in the serum of patients with breast and pancreatic cancer (37). The present results revealed that miR-484 exhibited a 29.7-fold-change in expression in patients with HCC compared with the healthy control. These findings indicated that miR-484 may be produced as a result of processes common to these three cancers. The study by Wang et al (38) also indicated that miR-484 may function as an oncogene, suppress translation of mitochondrial fission protein (Fis1) and inhibit Fis1-mediated fission and apoptosis.

Previous studies have demonstrated that miR-454 acts as an oncogene or tumor suppressor in cancer (39–41). miR-454 has been reported to be decreased in tissue of patients with esophageal cancer compared with normal tissue, which may perform as novel molecular markers of esophageal cancer (39). Niu et al (40) demonstrated that miR-454 expression was downregulated in osteosarcoma tissues, acting as a tumor suppressor gene in osteosarcoma. The miR-454 expression was increased in colorectal cancer (CRC) tissues and CRC cells. Overexpression of miR-454 promoted the proliferation and anchorage-independent growth of CRC cells and its oncogenic effect was mediated chiefly through direct suppression of cylindromatosis expression (41). In the present study, miR-454 exhibited a 62.9-fold increase in the plasma of patients with HCC in comparison with the healthy control, demonstrating that miR-454 may function as an oncogene. A total of 110 pairs of HCC tissues and para-cancer tissues were compared, and the results revealed that miR-454 was significantly increased in 83 HCC tissues compared with para-cancer tissues. The 5-year overall survival and disease-free survival rates were significantly improved in patients with low expression of miR-454 (data unpublished). Until recently, Yu et al (42) indicated that miR-454 expression was upregulated in HCC cell lines and tissues. Knockdown of miR-454 inhibited HCC cellular proliferation, invasion and epithelial mesenchymal transition (EMT), whereas overexpression of miR-454 promoted HCC cellular proliferation and invasion and EMT, which was consistent with the present results. miR-3188 directly targets mTOR to stimulate its own expression, and participates in FOXO1-mediated repression of cell growth, tumorigenesis and nasopharyngeal carcinoma chemotherapy resistance (43). However, miR-3188 has never been studied in HCC, and the aim of the present study was to investigate the function of miR-3188 in the pathogenesis of HCC.

In conclusion, the present study (in a small sample size) identified a list of differentially-expressed miRNA candidates in the plasma of patients with familial HCC with HBV infection compared with the healthy control. A total of 11 of these miRNAs have not previously been reported in the molecular pathogenesis of hepatocarcinogenesis. These differentially expressed miRNAs in the plasma of patients with HCC with familial aggregation of HCC and HBV infection may lay the foundation for additional studies on the role of miRNAs in the pathogenesis of HCC, and provide the basal work for future study of the molecular mechanisms of HCC. Additional studies are necessary in order to understand the regulatory mechanisms of these miRNAs in the process of hepatocarcinogenesis.

References

1 

Zhang EL, Liang BY, Chen XP and Huang ZY: Severity of liver cirrhosis: A key role in the selection of surgical modality for Child-Pugh A hepatocellular carcinoma. World J Surg Oncol. 13:1482015. View Article : Google Scholar : PubMed/NCBI

2 

Kew MC: Epidemiology of chronic hepatitis B virus infection, hepatocellular carcinoma, and hepatitis B virus-induced hepatocellular carcinoma. Pathol Biol (Paris). 58:273–277. 2010. View Article : Google Scholar : PubMed/NCBI

3 

Yang HI, Lu SN, Liaw YF, You SL, Sun CA, Wang LY, Hsiao CK, Chen PJ, Chen DS and Chen CJ; Taiwan Community-Based Cancer Screening Project Group, : Hepatitis B e antigen and the risk of hepatocellular carcinoma. N Engl J Med. 347:168–174. 2002. View Article : Google Scholar : PubMed/NCBI

4 

Lok AS: Prevention of hepatitis B virus-related hepatocellular carcinoma. Gastroenterology. 127 Suppl 1:S303–S309. 2004. View Article : Google Scholar : PubMed/NCBI

5 

Mair RD, Valenzuela A, Ha NB, Ayoub WS, Daugherty T, Lutchman GA, Garcia G, Ahmed A and Nguyen MH: Incidence of hepatocellular carcinoma among US patients with cirrhosis of viral or nonviral etiologies. Clin Gastroenterol Hepatol. 10:1412–1417. 2012. View Article : Google Scholar : PubMed/NCBI

6 

Yu MW, Chang HC, Liaw YF, Lin SM, Lee SD, Liu CJ, Chen PJ, Hsiao TJ, Lee PH and Chen CJ: Familial risk of hepatocellular carcinoma among chronic hepatitis B carriers and their relatives. J Natl Cancer Inst. 92:1159–1164. 2000. View Article : Google Scholar : PubMed/NCBI

7 

Loomba R, Liu J, Yang HI, Lee MH, Lu SN, Wang LY, Iloeje UH, You SL, Brenner D and Chen CJ; REVEAL-HBV Study Group, : Synergistic effects of family history of hepatocellular carcinoma and hepatitis B virus infection on risk for incident hepatocellular carcinoma. Clin Gastroenterol Hepatol. 11:1636–1645.e1-3. 2013. View Article : Google Scholar : PubMed/NCBI

8 

Turati F, Edefonti V, Talamini R, Ferraroni M, Malvezzi M, Bravi F, Franceschi S, Montella M, Polesel J, Zucchetto A, et al: Family history of liver cancer and hepatocellular carcinoma. Hepatology. 55:1416–1425. 2012. View Article : Google Scholar : PubMed/NCBI

9 

Xie KL, Zhang YG, Liu J, Zeng Y and Wu H: MicroRNAs associated with HBV infection and HBV-related HCC. Theranostics. 4:1176–1192. 2014. View Article : Google Scholar : PubMed/NCBI

10 

Zhao Z, Hu Y, Shen X, Lao Y, Zhang L, Qiu X, Hu J, Gong P, Cui H, Lu S, et al: HBx represses RIZ1 expression by DNA methyltransferase 1 involvement in decreased miR-152 in hepatocellular carcinoma. Oncol Rep. 37:2811–2818. 2017.PubMed/NCBI

11 

Wu Y, Zhang J, Zhang H and Zhai Y: Hepatitis B virus X protein mediates yes-associated protein 1 upregulation in hepatocellular carcinoma. Oncol Lett. 12:1971–1974. 2016.PubMed/NCBI

12 

Xu C, Zhou W, Wang Y and Qiao L: Hepatitis B virus-induced hepatocellular carcinoma. Cancer Lett. 345:216–222. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Huang S and He X: The role of microRNAs in liver cancer progression. Br J Cancer. 104:235–240. 2011. View Article : Google Scholar : PubMed/NCBI

14 

Valencia-Sanchez MA, Liu J, Hannon GJ and Parker R: Control of translation and mRNA degradation by miRNAs and siRNAs. Genes Dev. 20:515–524. 2006. View Article : Google Scholar : PubMed/NCBI

15 

Braconi C, Huang N and Patel T: MicroRNA-dependent regulation of DNA methyltransferase-1 and tumor suppressor gene expression by interleukin-6 in human malignant cholangiocytes. Hepatology. 51:881–890. 2010.PubMed/NCBI

16 

Wei X, Xiang T, Ren G, Tan C, Liu R, Xu X and Wu Z: miR-101 is down-regulated by the hepatitis B virus × protein and induces aberrant DNA methylation by targeting DNA methyltransferase 3A. Cell Signal. 25:439–446. 2013. View Article : Google Scholar : PubMed/NCBI

17 

Wei X, Tan C, Tang C, Ren G, Xiang T, Qiu Z, Liu R and Wu Z: Epigenetic repression of miR-132 expression by the hepatitis B virus × protein in hepatitis B virus-related hepatocellular carcinoma. Cell Signal. 25:1037–1043. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Dong Y and Wang A: Aberrant DNA methylation in hepatocellular carcinoma tumor suppression (Review). Oncol Lett. 8:963–968. 2014.PubMed/NCBI

19 

Liu WH, Yeh SH and Chen PJ: Role of microRNAs in hepatitis B virus replication and pathogenesis. Biochim Biophys Acta. 1809:678–685. 2011. View Article : Google Scholar : PubMed/NCBI

20 

Zhou J, Yu L, Gao X, Hu J, Wang J, Dai Z, Wang JF, Zhang Z, Lu S, Huang X, et al: Plasma microRNA panel to diagnose hepatitis B virus-related hepatocellular carcinoma. J Clin Oncol. 29:4781–4788. 2011. View Article : Google Scholar : PubMed/NCBI

21 

Fu Y, Wei X, Tang C, Li J, Liu R, Shen A and Wu Z: Circulating microRNA-101 as a potential biomarker for hepatitis B virus-related hepatocellular carcinoma. Oncol Lett. 6:1811–1815. 2013.PubMed/NCBI

22 

Katayama Y, Maeda M, Miyaguchi K, Nemoto S, Yasen M, Tanaka S, Mizushima H, Fukuoka Y, Arii S and Tanaka H: Identification of pathogenesis-related microRNAs in hepatocellular carcinoma by expression profiling. Oncol Lett. 4:817–823. 2012.PubMed/NCBI

23 

Wang Y, Lu Y, Toh ST, Sung WK, Tan P, Chow P, Chung AY, Jooi LL and Lee CG: Lethal-7 is down-regulated by the hepatitis B virus × protein and targets signal transducer and activator of transcription 3. J Hepatol. 53:57–66. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Kong G, Zhang J, Zhang S, Shan C, Ye L and Zhang X: Upregulated microRNA-29a by hepatitis B virus X protein enhances hepatoma cell migration by targeting PTEN in cell culture model. PLoS One. 6:e195182011. View Article : Google Scholar : PubMed/NCBI

25 

Wu G, Yu F, Xiao Z, Xu K, Xu J, Tang W, Wang J and Song E: Hepatitis B virus X protein downregulates expression of the miR-16 family in malignant hepatocytes in vitro. Br J Cancer. 105:146–153. 2011. View Article : Google Scholar : PubMed/NCBI

26 

Xu X, Fan Z, Kang L, Han J, Jiang C, Zheng X, Zhu Z, Jiao H, Lin J, Jiang K, et al: Hepatitis B virus X protein represses miRNA-148a to enhance tumorigenesis. J Clin Invest. 123:630–645. 2013.PubMed/NCBI

27 

Liu FY, Zhou SJ, Deng YL, Zhang ZY, Zhang EL, Wu ZB, Huang ZY and Chen XP: MiR-216b is involved in pathogenesis and progression of hepatocellular carcinoma through HBx-miR-216b-IGF2BP2 signaling pathway. Cell Death Dis. 6:e16702015. View Article : Google Scholar : PubMed/NCBI

28 

Hassan MM, Spitz MR, Thomas MB, Curley SA, Patt YZ, Vauthey JN, Glover KY, Kaseb A, Lozano RD, El-Deeb AS, et al: The association of family history of liver cancer with hepatocellular carcinoma: A case-control study in the United States. J Hepatol. 50:334–341. 2009. View Article : Google Scholar : PubMed/NCBI

29 

Zhang ZZ, Liu X, Wang DQ, Teng MK, Niu LW, Huang AL and Liang Z: Hepatitis B virus and hepatocellular carcinoma at the miRNA level. World J Gastroenterol. 17:3353–3358. 2011. View Article : Google Scholar : PubMed/NCBI

30 

Tan Y, Ge G, Pan T, Wen D, Chen L, Yu X, Zhou X and Gan J: A serum microRNA panel as potential biomarkers for hepatocellular carcinoma related with hepatitis B virus. PLoS One. 9:e1079862014. View Article : Google Scholar : PubMed/NCBI

31 

Cai J, Guan H, Fang L, Yang Y, Zhu X, Yuan J, Wu J and Li M: MicroRNA-374a activates Wnt/β-catenin signaling to promote breast cancer metastasis. J Clin Invest. 123:566–579. 2013.PubMed/NCBI

32 

Della Vittoria, Scarpati G, Falcetta F, Carlomagno C, Ubezio P, Marchini S, De Stefano A, Singh VK, D'Incalci M, De Placido S and Pepe S: A specific miRNA signature correlates with complete pathological response to neoadjuvant chemoradiotherapy in locally advanced rectal cancer. Int J Radiat Oncol Biol Phys. 83:1113–1119. 2012. View Article : Google Scholar : PubMed/NCBI

33 

Zhang H, Qi S, Zhang T, Wang A, Liu R, Guo J, Wang Y and Xu Y: miR-188-5p inhibits tumour growth and metastasis in prostate cancer by repressing LAPTM4B expression. Oncotarget. 6:6092–6104. 2015. View Article : Google Scholar : PubMed/NCBI

34 

Hu Z, Dong J, Wang LE, Ma H, Liu J, Zhao Y, Tang J, Chen X, Dai J, Wei Q, et al: Serum microRNA profiling and breast cancer risk: The use of miR-484/191 as endogenous controls. Carcinogenesis. 33:828–834. 2012. View Article : Google Scholar : PubMed/NCBI

35 

Macconi D, Tomasoni S, Romagnani P, Trionfini P, Sangalli F, Mazzinghi B, Rizzo P, Lazzeri E, Abbate M, Remuzzi G and Benigni A: MicroRNA-324-3p promotes renal fibrosis and is a target of ACE inhibition. J Am Soc Nephrol. 23:1496–1505. 2012. View Article : Google Scholar : PubMed/NCBI

36 

Dharap A, Pokrzywa C, Murali S, Pandi G and Vemuganti R: MicroRNA miR-324-3p induces promoter-mediated expression of RelA gene. PLoS One. 8:e794672013. View Article : Google Scholar : PubMed/NCBI

37 

Zearo S, Kim E, Zhu Y, Zhao JT, Sidhu SB, Robinson BG and Soon PSh: MicroRNA-484 is more highly expressed in serum of early breast cancer patients compared to healthy volunteers. BMC Cancer. 14:2002014. View Article : Google Scholar : PubMed/NCBI

38 

Wang K, Long B, Jiao JQ, Wang JX, Liu JP, Li Q and Li PF: miR-484 regulates mitochondrial network through targeting Fis1. Nat Commun. 3:7812012. View Article : Google Scholar : PubMed/NCBI

39 

Liu SG, Qin XG, Zhao BS, Qi B, Yao WJ, Wang TY, Li HC and Wu XN: Differential expression of miRNAs in esophageal cancer tissue. Oncol Lett. 5:1639–1642. 2013.PubMed/NCBI

40 

Niu G, Li B, Sun J and Sun L: miR-454 is down-regulated in osteosarcomas and suppresses cell proliferation and invasion by directly targeting c-Met. Cell Prolif. 48:348–355. 2015. View Article : Google Scholar : PubMed/NCBI

41 

Liu L, Nie J, Chen L, Dong G, Du X, Wu X, Tang Y and Han W: The oncogenic role of microRNA-130a/301a/454 in human colorectal cancer via targeting Smad4 expression. PLoS One. 8:e555322013. View Article : Google Scholar : PubMed/NCBI

42 

Yu L, Gong X, Sun L, Yao H, Lu B and Zhu L: miR-454 functions as an oncogene by inhibiting CHD5 in hepatocellular carcinoma. Oncotarget. 6:39225–39234. 2015.PubMed/NCBI

43 

Zhao M, Luo R, Liu Y, Gao L, Fu Z, Fu Q, Luo X, Chen Y, Deng X, Liang Z, et al: miR-3188 regulates nasopharyngeal carcinoma proliferation and chemosensitivity through a FOXO1-modulated positive feedback loop with mTOR-p-PI3K/AKT-c-JUN. Nat Commun. 7:113092016. View Article : Google Scholar : PubMed/NCBI

44 

Deng M, Tang H, Zhou Y, Zhou M, Xiong W, Zheng Y, Ye Q, Zeng X, Liao Q, Guo X, et al: miR-216b suppresses tumor growth and invasion by targeting KRAS in nasopharyngeal carcinoma. J Cell Sci. 124:2997–3005. 2011. View Article : Google Scholar : PubMed/NCBI

45 

Ye H, Zhang C, Wang BJ, Tan XH, Zhang WP, Teng Y and Yang X: Synergistic function of Kras mutation and HBx in initiation and progression of hepatocellular carcinoma in mice. Oncogene. 33:5133–5138. 2014. View Article : Google Scholar : PubMed/NCBI

46 

Kim SY, Lee YH and Bae YS: MiR-186, miR-216b, miR-337-3p, and miR-760 cooperatively induce cellular senescence by targeting α subunit of protein kinase CKII in human colorectal cancer cells. Biochem Biophys Res Commun. 429:173–179. 2012. View Article : Google Scholar : PubMed/NCBI

47 

Ali S, Banerjee S, Logna F, Bao B, Philip PA, Korc M and Sarkar FH: Inactivation of Ink4a/Arf leads to deregulated expression of miRNAs in K-Ras transgenic mouse model of pancreatic cancer. J Cell Physiol. 227:3373–3380. 2012. View Article : Google Scholar : PubMed/NCBI

48 

Anson M, Crain-Denoyelle AM, Baud V, Chereau F, Gougelet A, Terris B, Yamagoe S, Colnot S, Viguier M, Perret C and Couty JP: Oncogenic β-catenin triggers an inflammatory response that determines the aggressiveness of hepatocellular carcinoma in mice. J Clin Invest. 122:586–599. 2012. View Article : Google Scholar : PubMed/NCBI

49 

Cha MY, Kim CM, Park YM and Ryu WS: Hepatitis B virus X protein is essential for the activation of Wnt/beta-catenin signaling in hepatoma cells. Hepatology. 39:1683–1693. 2004. View Article : Google Scholar : PubMed/NCBI

50 

Fang F, Chang RM, Yu L, Lei X, Xiao S, Yang H and Yang LY: MicroRNA-188-5p suppresses tumor cell proliferation and metastasis by directly targeting FGF5 in hepatocellular carcinoma. J Hepatol. 63:874–885. 2015. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhang EL, Gu J, Zhang ZY, Dong KS, Liang BY and Huang ZY: MicroRNA expression profiling in patients with hepatocellular carcinoma of familial aggregation and hepatitis B virus infection. Oncol Lett 14: 971-976, 2017.
APA
Zhang, E., Gu, J., Zhang, Z., Dong, K., Liang, B., & Huang, Z. (2017). MicroRNA expression profiling in patients with hepatocellular carcinoma of familial aggregation and hepatitis B virus infection. Oncology Letters, 14, 971-976. https://doi.org/10.3892/ol.2017.6178
MLA
Zhang, E., Gu, J., Zhang, Z., Dong, K., Liang, B., Huang, Z."MicroRNA expression profiling in patients with hepatocellular carcinoma of familial aggregation and hepatitis B virus infection". Oncology Letters 14.1 (2017): 971-976.
Chicago
Zhang, E., Gu, J., Zhang, Z., Dong, K., Liang, B., Huang, Z."MicroRNA expression profiling in patients with hepatocellular carcinoma of familial aggregation and hepatitis B virus infection". Oncology Letters 14, no. 1 (2017): 971-976. https://doi.org/10.3892/ol.2017.6178
Copy and paste a formatted citation
x
Spandidos Publications style
Zhang EL, Gu J, Zhang ZY, Dong KS, Liang BY and Huang ZY: MicroRNA expression profiling in patients with hepatocellular carcinoma of familial aggregation and hepatitis B virus infection. Oncol Lett 14: 971-976, 2017.
APA
Zhang, E., Gu, J., Zhang, Z., Dong, K., Liang, B., & Huang, Z. (2017). MicroRNA expression profiling in patients with hepatocellular carcinoma of familial aggregation and hepatitis B virus infection. Oncology Letters, 14, 971-976. https://doi.org/10.3892/ol.2017.6178
MLA
Zhang, E., Gu, J., Zhang, Z., Dong, K., Liang, B., Huang, Z."MicroRNA expression profiling in patients with hepatocellular carcinoma of familial aggregation and hepatitis B virus infection". Oncology Letters 14.1 (2017): 971-976.
Chicago
Zhang, E., Gu, J., Zhang, Z., Dong, K., Liang, B., Huang, Z."MicroRNA expression profiling in patients with hepatocellular carcinoma of familial aggregation and hepatitis B virus infection". Oncology Letters 14, no. 1 (2017): 971-976. https://doi.org/10.3892/ol.2017.6178
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team