Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
October-2018 Volume 16 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2018 Volume 16 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

ATPase inhibitory factor 1 inhibition improves the antitumor of YC‑1 against hepatocellular carcinoma

  • Authors:
    • Xuemei Ding
    • Jian Kong
    • Wenlei Xu
    • Shuying Dong
    • Yingrui Du
    • Changyu Yao
    • Jun Gao
    • Shan Ke
    • Shaohong Wang
    • Wenbing Sun
  • View Affiliations / Copyright

    Affiliations: Department of Hepatobiliary Surgery, Beijing Chao‑yang Hospital, Capital Medical University, Beijing 100043, P.R. China
    Copyright: © Ding et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 5230-5236
    |
    Published online on: August 3, 2018
       https://doi.org/10.3892/ol.2018.9266
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

YC‑1 is a synthetic compound, which serves as a hypoxia‑inducible factor 1‑α inhibitor or sensitizer to enhance the effect of chemotherapy. Previous studies have revealed the anti‑cancer effects of YC‑1 in various types of cancer, including hepatocellular carcinoma (HCC). ATPase inhibitory factor 1 (IF1) is upregulated in a number of human carcinomas and regulates mitochondrial bioenergetics and structure. However, whether IF1 is involved in the antitumor effects of YC‑1 against HCC remains unclear. The present study examined the function of IF1 in HCC and its potential role in YC‑1 effects within HCC cells. MTT, colony formation and Transwell assays revealed that IF1 overexpression promoted proliferation, colony formation and invasion of HCC cells, while IF1 downregulation had the opposite effects. Overexpression of IF1 reversed the inhibitory effects of YC‑1 on Huh7 cell growth and invasion activities, while downregulation of IF1 increased the sensitivity of HCCLM3 cells to YC‑1. YC‑1 treatment of HCCLM3 and Huh7 cells reduced the levels of phosphorylated (p‑) signal transducer and activator of transcription 3 (STAT3) and IF1, and increased the expression of E‑cadherin. IF1 knockdown resulted in decreased p‑STAT3 levels and increased E‑cadherin expression, while IF1 overexpression increased p‑STAT3 levels and reduced the expression of E‑cadherin. The present study demonstrated that the inhibition of IF1 improves the antitumor effects of YC‑1 in HCC cells. These findings support the clinical strategy of combining YC‑1 and an IF1 inhibitor for the treatment of HCC.

Introduction

Hepatocellular carcinoma (HCC) is the fifth most common malignancy and the second leading cause of cancer-related deaths worldwide (1). Potentially curative treatment strategies such as tumor resection, liver transplantation, or local ablation are only limited to HCC at early stage (2). Patients with advanced stage HCC show poor responses to traditional chemotherapy and sorafenib is the only approved systemic therapy for advanced HCC, however, the response rate is quite low (3,4). Therefore, new therapeutic strategies for HCC treatment are urgently needed.

1-benzyl-3-(5′-hydroxymethyl-2′-furyl) indazole (YC-1) is a synthetic compound that exhibits various potent biological and pathological activities, including antiplatelet activity, soluble guanylyl cyclase activity, suppression of hypoxia-induced factor-1α (HIF-1α), and anti-cancer activity (5). A previous report showed that YC-1 exerts antitumor effects in HCC through suppressing HIF-1α and inducing S cell cycle arrest or G0-G1 cell cycle arrest (6,7). YC-1 also enhanced chemosensitivity in HCC via inhibition of signal transducer and activator of transcription (STAT3) activity (8). Our previous study also suggested that YC-1 enhanced the antitumor activity of sorafenib through STAT3 in HCC (9). These studies suggest that YC-1 acts as an HIF-1α inhibitor or sensitizer to enhance the effect of chemotherapeutics, however, the precise mechanisms underlying the antitumor effects of YC-1 against HCC have not been fully elucidated.

ATPase inhibitory factor 1 (IF1) is encoded by the ATPIF1 gene that is located in chromosomes 1 and 4 of human and mouse genomes, respectively (10). IF1 is implicated in the control of both mitochondrial bioenergetics and structure by regulating the activity and oligomerization of the F1Fo-ATPsynthase (hereinafter referred to as ATP synthase) (11–16). The function of IF1 as an ATP synthase inhibitor is regulated by matrix pH under conditions of mitochondrial de-energization and by the phosphorylation of S39 under several physiological situations, such as progression through the cell cycle, hypoxia, and rapid changes in metabolic demand (11). A previous study demonstrated that overexpression of HIF-1α by hypoxia or CoCl2 treatment augmented IF1 protein levels in a rat hepatic epithelial cell line (17). The pathway may be suitable to the mechanism of IF1 in HCC. Some studies showed that IF is upregulated in many human carcinomas and the level of IF1 expression in HCC, gliomas, and gastric cancers correlates with aggressiveness and invasiveness of tumors and poor prognosis in patients (14,18). Whether IF1 is involved in the antitumor effect of YC-1 against HCC remains unclear.

In the present study, we examined the function of IF1 in HCC cells and the potential role or involvement of IF1 in the antitumor effects of YC-1 in the HCCLM3 and Huh7 HCC cell lines in vitro.

Materials and methods

Cell lines and cell culture

Human HCC cell line Huh7 was obtained from the American Type Culture Collection (Manassas, VA, USA). The human HCC cell line HCCLM3 was obtained from the China Center for Type Culture Collection and Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Cells were maintained in high-glucose Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin and 100 µg/ml streptomycin (Thermo Fisher Scientific, Inc., Waltham, MA, USA) in a humidified atmosphere of 5% CO2 at 37°C. Cell lines were immediately expanded and frozen down such that cell lines could be restarted every 3 months from a frozen vial of the same batch of cells. No further authentication was done. All cell lines were routinely tested to rule out mycoplasma contamination. YC-1 was obtained from Sigma-Aldrich (Merck KGaA, Darmstadt, Germany).

Establishment of stable knockdown or overexpression cell lines

Lentiviral vectors encoding the human IF1 gene (NM_016311.4) and shRNA-IF1 (CACCATGAAGAAGAAATCGTT) were constructed by Beijing LiKeli BioTECH Co. Ltd. (Beijing, China) and designated as LV-IF1 and LV-shRNA-IF1, respectively. The empty vectors (LV-Ctrl or LV-shRNA-Ctrl) were used as a negative control. The lentiviral vectors were transfected into HCC cells with a multiplicity of infection of 20 to 30 in the presence of polybrene (2 µg/ml). At 48 h after transfection, transfected cells were selected for 2 weeks with 2 µg/ml puromycin (Sigma-Aldrich; Merck KGaA). Pooled populations of knockdown cells and overexpression cells, which were obtained 2 weeks after drug selection without subcloning, were used in in vitro experiments.

Proliferation assay

Cell proliferation was analyzed using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Briefly, HCC cells were seeded in 96-well plates at a density of 3×103 cells/well and treated with various concentrations of YC-1 for 24, 48, or 72 h. MTT solution was added to each well at a final concentration of 0.5 mg/ml and cells were incubated for 4 h. Formazan crystals resulting from MTT reduction were then dissolved by the addition of 150 µl dimethyl sulfoxide per well. The absorbance was measured at 570 nm using an automated ELISA plate reader.

Colony formation assay

Six-well dishes were seeded with 1×103 cells and cells were cultured for 24 h. The cells were then incubated in the presence of various concentrations of YC-1 for 24 h in complete medium, washed with media, and allowed to grow in complete medium for 2 weeks. The obtained colonies were washed with PBS, fixed in 4% paraformaldehyde for 20 min at room temperature, washed with PBS, and then stained with crystal violet. The stained colonies were then counted.

Invasion assay

Cell invasion assays were performed using a modified Boyden chamber (Costar; Corning Inc., Corning, NY, USA) that was precoated with Matrigel. HCCLM3 or Huh7 cells (2×104 cells per well) and 10 µM YC-1 were added into the upper chamber, and 600 µl DMEM with 10% FBS were added into the lower chamber. The chambers were incubated for 24 h. After removing the filter inserts and the cells on the upper side of the filter, the migrated cells on the lower chamber were stained with crystal violet for 20 min, washed with PBS, and photographed under an inverted fluorescence microscope (Olympus IX51) equipped with an Olympus Qcolor 3 digital camera (both Olympus Corp., Tokyo, Japan). Migration was assessed by counting the number of stained cells from 5 random fields at magnification, ×10.

Western blot analysis

Equivalent amounts of whole cell extracts were subjected to SDS-PAGE and transferred to nitrocellulose membranes. The membranes were blocked with 5% non-fat milk for 2 h and then incubated with primary antibodies overnight at 4°C, followed by incubation with the appropriate HRP-conjugated secondary antibody for 1.5 h at room temperature. Immunoreactivity was detected with SuperSignal West Pico substrate (Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. Primary antibodies anti-IF1, anti-E-cadherin, anti-phosphorylated (p-)STAT3, and anti-β-actin were obtained from CST (Danvers, MA, USA). Horseradish peroxidase (HRP)-labeled anti-mouse and anti-rabbit secondary antibodies were from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA). All other antibodies were purchased from Abcam (Cambridge, MA, USA).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total mRNA was extracted using the TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and RT was performed using an RT-PCR kit (TransGen Biotech Co., Ltd., Beijing, China). qPCR experiments were conducted on an DNA Engine Opticon System (MJ Research Inc.; Bio-Rad Laboratories, Inc.) using SYBR-Green PCR Master Mix kit in triplicate specific primers. The sequences of primers to determine the expression of the target gene were listed as follows: IF1 forward, 5′-GGGCCTTCGGAAAGAGAG-3′ and reverse, 5′-TTCAAAGCTGCCAGTTGTTC-3′; and glyceraldehydes 3-phosphate dehydrogenase (GAPDH) forward, 5′-CGGAGTCAACGGATTTGGTCGTAT-3′ and reverse, 5′-AGCCTTCTCCATGGTGGTGAAGAC-3′. The PCR thermocycling conditions consisted of 5 min at 95°C followed by 40 cycles of denaturation for 30 sec at 95°C, annealing for 30 sec at 56°C and a primer extension for 30 sec at 72°C. Relative gene expression levels were quantified using the 2−∆∆Cq method (19).

Statistical analysis

All values are expressed as the mean ± standard error of the mean. The data were analyzed using Student's t-test or the analysis of variance test with Tukey's post hoc test. P<0.05 was considered to indicate a statistically significant difference. GraphPad Prism 5 (GraphPad Software Inc., San Diego, CA, USA) was used for these analyses.

Results

IF1 regulates the proliferation and invasion of HCC cells

To investigate the function of IF1 in HCC, we first examined the expression of IF1 in HCCLM3 and Huh7 cell lines. Western blot analysis revealed that the expression of IF1 was higher in HCCLM3 cells compared with Huh7 cells (Fig. 1A). To examine the effects of altered IF1 expression, we transfected a lentiviral expression vector that expresses IF1 in Huh7 cells (Huh7-LV-IF1) or shRNA for IF1 knockdown in HCCLM3 cells (HCCLM3-shRNA-IF1) and generated stable cell lines, together with the appropriate controls (Huh7-LV-Ctrl and HCCLM3-shRNA-Ctrl) and RT-qPCR was used to confirm the results (Fig. 1B).

Figure 1.

IF1 regulates proliferation and invasion of HCC cells. (A) Western blot analysis of IF1 in Huh7 and HCCLM3 cells. Actin was used as loading control. (B) Lentiviral overexpression of IF1 in Huh7 cells (Huh7-LV-IF1 or Huh7-LV-Ctrl) or IF1 shRNA in HCCLM3 cells (HCCLM3-shRNA-IF1 or HCCLM3-shRNA-Ctrl). Western blot analysis and RT-qPCR were performed for the indicated proteins and genes. ***P<0.001 vs. LV-shRNA-Ctrl. (C) MTT assays, (D) colony formation assays and (E) invasion assays of HCC cells with IF1 overexpression or IF1 shRNA knockdown compared with the appropriate controls (scale bars, 200 µm). ***P<0.001, as indicated. IF1, inhibitory factor 1; HCC, hepatocellular carcinoma; shRNA, short hairpin RNA; Ctrl, control; OD, optical density; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide.

We next performed a series of assays to clarify the function of IF1 in HCC cells. We found that knockdown of IF1 could significantly inhibit the proliferation, colony formation and invasion activities of HCCLM3 cells compared with controls (Fig. 1C-E). In contrast, overexpression of IF1 in Huh7 cells resulted in increased proliferation, colony formation and invasion (Fig. 1C-E). Together these results indicated a role for IF1 in regulating proliferation and invasion of HCC cells.

Overexpression of IF1 reduced the inhibitory effects of YC-1 in Huh7 cells

We next examined whether IF1 could impact the effects of YC-1 on HCC cells using Huh7-LV-IF1 and Huh7-LV-Ctrl cells. Consistent with previous studies on YC-1 anti-cancer effects, we found that YC-1 treatment reduced the proliferation, colony formation and invasion activities of Huh7 cells (Fig. 2). However, Huh7 cells with overexpression of IF1 showed reduced sensitivity to the negative effects of YC-1 on proliferation and attenuated the YC-1-induced inhibition of invasion (Fig. 2).

Figure 2.

IF1 overexpression reverses the inhibitory effects of YC-1 in Huh7 cells. (A) MTT assays of Huh7 cells with IF1 overexpression or controls treated with various concentrations of YC-1 for 24 h. (B) Colony formation assays in Huh7 cells with IF1 overexpression or controls cultured with 10 or 20 µM YC-1 for 14 days. (C) Invasion assays of Huh7 cells with IF1 overexpression or controls in the presence of 10 µM YC-1 for 24 h (scale bars, 200 µm). IF1, inhibitory factor 1; Ctrl, control; OD, optical density; YC-1, 1-benzyl-3-(5′-hydroxymethyl-2′-furyl) indazole.

Knockdown of IF1 elevated the sensitivity of HCCLM3 cells to YC-1

We next evaluated the effect of IF1 knockdown on the sensitivity of HCC cells to YC-1. We found that HCCLM3 cells with knockdown of IF1 showed elevated sensitivity to the inhibitory effects of YC-1 on cell proliferation, colony formation and invasion activities compared with cells transfected with the shRNA control (Fig. 3).

Figure 3.

Knockdown of IF1 increases the sensitivity of HCCLM3 cells to YC-1. (A) MTT assays of HCCLM3 cells with IF1 knockdown or control shRNA in the presence of various concentrations of YC-1 for 24 h. (B) Colony formation assays in HCCLM3 cells with IF1 knockdown or control shRNA in the presence of 10 or 20 µM YC-1 for 14 days. (C) Invasion assays of HCCLM3 cells with IF1 knockdown or control shRNA in the presence of 10 µM YC-1 for 24 h (scale bars, 200 µm). IF1, inhibitory factor 1; shRNA, short hairpin RNA; Ctrl, control; OD, optical density; YC-1, 1-benzyl-3-(5′-hydroxymethyl-2′-furyl) indazole; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide.

STAT3 activation is involved in the effect of IF1 on YC-1 treatment in HCC cells

To investigate the underlying mechanism of the role of IF1 in the effect of YC-1 on HCC cells, we examined a panel of several molecular factors by western blot analysis. YC-1 treatment in HCCLM3 and Huh7 cells decreased the expression of p-STAT3 and IF1 and increased the expression of E-cadherin (Fig. 4). IF1 knockdown significantly reduced the levels of p-STAT3 and increased the expression of E-cadherin, while IF1 overexpression increased the expression of p-STAT3 and decreased the expression of E-cadherin (Fig. 4).

Figure 4.

STAT3 is involved in the effect of IF1 in YC-1-induced inhibitory activities in HCC cells. Western blot analysis of the indicated proteins in (A) HCCLM3 cell lines with IF knockdown or control shRNA and (B) Huh7 cell lines with IF1 overexpression or controls treated with 10 µM YC-1 for 24 h. Actin was used as a normalization control. IF1, inhibitory factor 1; shRNA, short hairpin RNA; Ctrl, control; STAT3, signal transducer and activator of transcription 3; p-, phosphorylated; YC-1, 1-benzyl-3-(5′-hydroxymethyl-2′-furyl) indazole.

Discussion

In the present study, we provided evidence that IF1 plays an important role in the antitumor effects of YC-1 in HCC. Our results demonstrated that IF1 was involved in the proliferation, colony formation and invasion activities of HCC cells. Overexpression of IF1 reversed the inhibitory effects of YC-1 in Huh7 cells, and knockdown of IF1 elevated the sensitivity of HCCLM3 cells to YC-1. STAT3 signaling pathways may also be involved in the process. Our results suggest that inhibition of IF1 could improve the antitumor effects of YC-1 against HCC.

IF1 is an inhibitor of the mitochondrial H (+)-ATP synthase, and several studies have suggested that IF1 is involved in tumor progression. IF1 was shown to be an independent prognostic factor in non-small cell lung cancer (13). In the liver, IF1 could downregulate oxidative phosphorylation and induce a tumor-promoting metabolic state (20). Another study showed that IF1 was a prognostic marker in gastric cancer and that IF1 contributes to proliferation and invasion of human gastric cancer cells (14). Silencing of IF1 in bladder cancer inhibited cell growth via cell cycle arrest (15). A study in HCC showed that a reciprocal activation between IF1 and NF-κB drives angiogenesis and metastasis (16). Analysis of IF1 expression in tumors in breast and colon cancer patient cohorts revealed its relevance as a predictive marker for clinical outcome (21). Another report showed that upregulation of IF1 in human tumors mediated the metabolic shift of cancer cells to a Warburg phenotype (22). Our results also showed that knockdown of IF1 inhibited the proliferation, colony formation and invasion activities of HCC cells, while IF1 overexpression had the opposite effect.

YC-1 functions to inhibit HIF-1α and suppress tumor progression (23), and the direct inhibiting growth of tumor is limit. Indeed, resistance to YC-1 necessitates the use of increased therapeutic doses and can result in increased adverse side effects. A previous study on HCC cells showed that YC-1 exhibited an antiproliferative effect and arrests the cell cycle in G0-G1, however, the IC50 value was about 46 µM (24). Notably, our previous study demonstrated that YC-1 enhanced the antitumor activity of sorafenib through inhibition of STAT3 in HCC (9). Another report showed that YC-1 could potentiate the apoptotic effect of licochalcone A on human epithelial ovarian carcinoma cells via activation of death receptor and mitochondrial pathways (25). These studies suggest YC-1 could be also used as a sensitizer to enhance the effect of chemotherapeutics. Our current results demonstrated that increased IF1 expression reduced the inhibitory effects of YC-1 and knockdown of IF1 enhanced the growth and invasion suppressive effects of YC-1 in HCC cells. These findings indicate that IF1 may be involved in the effects of YC-1 on HCC cells and suggest that a combination of silencing IF1 and YC-1 may be a useful strategy for HCC treatment.

STAT3 is a central mediator of cancer metastasis and a target of anticancer drugs for blocking tumor metastasis. STAT3 is activated by its binding to various ligands, such as interleukin-6 (IL-6), interferon, and IL-10 (26–29). Numerous studies have revealed that the JAK/STAT signaling pathway is involved in several aspects of tumorigenesis, including proliferation, apoptosis, angiogenesis, and metastasis (30,31). Activated STAT3 has been reported in various human cancers, and elevated level of activated STAT3 is associated with poor prognosis. Our results showed that overexpression of IF1 could induce the levels of p-STAT3, while IF1 knockdown reduced p-STAT3 levels. Another study showed that YC-1 could inhibit STAT3 activity by enhancing the polyubiquitination of p-STAT3 (705) and overexpression of STAT3 reversed YC-1-induced cell death. YC-1 may also suppress the expression of p-STAT3 through inhibiting SHP-1 activity. Together this suggests that STAT3 may function as a bridge in the interaction between IF1 and YC-1.

In conclusion, our results demonstrate that inhibition of IF1 improves the antitumor effects of YC-1 in HCC cells. This finding supports the clinical development of combining YC-1 and an IF1 inhibitor for the treatment of HCC.

Acknowledgements

Not applicable.

Funding

The present study was supported by the National Natural Science Foundation of China (grant nos. 81572957 and 81502650).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

WS conceived and supervised the study, and helped to draft the manuscript. JG, SW and SK participated in the design of the study. XD and JK performed the experiments and drafted the manuscript. SD, WX, YD and CY analyzed the data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that there are no competing interests.

References

1 

Forner A, Llovet JM and Bruix J: Hepatocellular carcinoma. Lancet. 379:1245–1255. 2012. View Article : Google Scholar : PubMed/NCBI

2 

Xu XL, Liu XD, Liang M and Luo BM: Radiofrequency ablation versus hepatic resection for small hepatocellular carcinoma: Systematic review of randomized controlled trials with meta-analysis and trial sequential analysis. Radiology. 287:461–472. 2018. View Article : Google Scholar : PubMed/NCBI

3 

Niu L, Liu L, Yang S, Ren J, Lai PBS and Chen GG: New insights into sorafenib resistance in hepatocellular carcinoma: Responsible mechanisms and promising strategies. Biochim Biophys Acta. 1868:564–570. 2017.PubMed/NCBI

4 

Bruix J, Cheng AL, Meinhardt G, Nakajima K, De Sanctis Y and Llovet J: Prognostic factors and predictors of sorafenib benefit in patients with hepatocellular carcinoma: Analysis of two phase III studies. J Hepatol. 67:999–1008. 2017. View Article : Google Scholar : PubMed/NCBI

5 

Chun YS, Yeo EJ and Park JW: Versatile pharmacological actions of YC-1: Anti-platelet to anticancer. Cancer Lett. 207:1–7. 2004. View Article : Google Scholar : PubMed/NCBI

6 

Yeo EJ, Ryu JH, Chun YS, Cho YS, Jang IJ, Cho H, Kim J, Kim MS and Park JW: YC-1 induces S cell cycle arrest and apoptosis by activating checkpoint kinases. Cancer Res. 66:6345–6352. 2006. View Article : Google Scholar : PubMed/NCBI

7 

Lau CK, Yang ZF, Lam CT, Tam KH, Poon RT and Fan ST: Suppression of hypoxia inducible factor-1alpha (HIF-1alpha) by YC-1 is dependent on murine double minute 2 (Mdm2). Biochem Biophys Res Commun. 348:1443–1448. 2006. View Article : Google Scholar : PubMed/NCBI

8 

Lau CK, Yang ZF, Lam SP, Lam CT, Ngai P, Tam KH, Poon RT and Fan ST: Inhibition of Stat3 activity by YC-1 enhances chemo-sensitivity in hepatocellular carcinoma. Cancer Biol Ther. 6:1900–1907. 2007. View Article : Google Scholar : PubMed/NCBI

9 

Kong J, Kong F, Gao J, Zhang Q, Dong S, Gu F, Ke S, Pan B, Shen Q, Sun H, et al: YC-1 enhances the anti-tumor activity of sorafenib through inhibition of signal transducer and activator of transcription 3 (STAT3) in hepatocellular carcinoma. Mol Cancer. 13:72014. View Article : Google Scholar : PubMed/NCBI

10 

García-Bermúdez J and Cuezva JM: The ATPase inhibitory factor 1 (IF1): A master regulator of energy metabolism and of cell survival. Biochim Biophys Acta. 1857:1167–1182. 2016. View Article : Google Scholar : PubMed/NCBI

11 

Garcia-Ledo L, Nuevo-Tapioles C, Cuevas-Martin C, Martínez-Reyes I, Soldevilla B, González-Llorente L and Cuezva JM: Overexpression of the ATPase inhibitory factor 1 favors a non-metastatic phenotype in breast cancer. Front Oncol. 7:692017. View Article : Google Scholar : PubMed/NCBI

12 

Faccenda D, Nakamura J, Gorini G, Dhoot GK, Piacentini M, Yoshida M and Campanella M: Control of mitochondrial remodeling by the ATPase inhibitory factor 1 unveils a pro-survival relay via OPA1. Cell Rep. 18:1869–1883. 2017. View Article : Google Scholar : PubMed/NCBI

13 

Gao YX, Chen L, Hu XG, Wu HB, Cui YH, Zhang X, Wang Y, Liu XD and Bian XW: ATPase inhibitory factor 1 expression is an independent prognostic factor in non-small cell lung cancer. Am J Cancer Res. 6:1141–1148. 2016.PubMed/NCBI

14 

Yin T, Lu L, Xiong Z, Wei S and Cui D: ATPase inhibitory factor 1 is a prognostic marker and contributes to proliferation and invasion of human gastric cancer cells. Biomed Pharmacother. 70:90–96. 2015. View Article : Google Scholar : PubMed/NCBI

15 

Wei S, Fukuhara H, Kawada C, Kurabayashi A, Furihata M, Ogura S, Inoue K and Shuin T: Silencing of ATPase inhibitory factor 1 inhibits cell growth via cell cycle arrest in bladder cancer. Pathobiology. 82:224–232. 2015. View Article : Google Scholar : PubMed/NCBI

16 

Song R, Song H, Liang Y, Yin D, Zhang H, Zheng T, Wang J, Lu Z, Song X, Pei T, et al: Reciprocal activation between ATPase inhibitory factor 1 and NF-κB drives hepatocellular carcinoma angiogenesis and metastasis. Hepatology. 60:1659–1673. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Huang LJ, Chuang IC, Dong HP and Yang RC: Hypoxia-inducible factor 1α regulates the expression of the mitochondrial ATPase inhibitor protein (IF1) in rat liver. Shock. 36:90–96. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Wu J, Shan Q, Li P, Wu Y, Xie J and Wang X: ATPase inhibitory factor 1 is a potential prognostic marker for the migration and invasion of glioma. Oncol Lett. 10:2075–2080. 2015. View Article : Google Scholar : PubMed/NCBI

19 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

20 

Santacatterina F, Sánchez-Cenizo L, Formentini L, Mobasher MA, Casas E, Rueda CB, Martínez-Reyes I, Núñez de Arenas C, García-Bermúdez J, Zapata JM, et al: Down-regulation of oxidative phosphorylation in the liver by expression of the ATPase inhibitory factor 1 induces a tumor-promoter metabolic state. Oncotarget. 7:490–508. 2016. View Article : Google Scholar : PubMed/NCBI

21 

Sánchez-Aragó M, Formentini L, Martinez-Reyes I, García-Bermudez J, Santacatterina F, Sánchez-Cenizo L, Willers IM, Aldea M, Nájera L, Juarránz A, et al: Expression, regulation and clinical relevance of the ATPase inhibitory factor 1 in human cancers. Oncogenesis. 2:e462013. View Article : Google Scholar : PubMed/NCBI

22 

Sánchez-Cenizo L, Formentini L, Aldea M, Ortega AD, García-Huerta P, Sánchez-Aragó M and Cuezva JM: Up-regulation of the ATPase inhibitory factor 1 (IF1) of the mitochondrial H+-ATP synthase in human tumors mediates the metabolic shift of cancer cells to a Warburg phenotype. J Biol Chem. 285:25308–25313. 2010. View Article : Google Scholar : PubMed/NCBI

23 

Kong J, Kong J, Pan B, Ke S, Dong S, Li X, Zhou A, Zheng L and Sun WB: Insufficient radiofrequency ablation promotes angiogenesis of residual hepatocellular carcinoma via HIF-1α/VEGFA. PLoS One. 7:e372662012. View Article : Google Scholar : PubMed/NCBI

24 

Wang SW, Pan SL, Guh JH, Chen HL, Huang DM, Chang YL, Kuo SC, Lee FY and Teng CM: YC-1 [3-(5′-Hydroxymethyl-2′-furyl)-1-benzyl Indazole] exhibits a novel antiproliferative effect and arrests the cell cycle in G0-G1 in human hepatocellular carcinoma cells. J Pharmacol Exp Ther. 312:917–925. 2005. View Article : Google Scholar : PubMed/NCBI

25 

Lee CS, Kwak SW, Kim YJ, Lee SA, Park ES, Myung SC, Kim W, Lee MS and Lee JJ: Guanylate cyclase activator YC-1 potentiates apoptotic effect of licochalcone A on human epithelial ovarian carcinoma cells via activation of death receptor and mitochondrial pathways. Eur J Pharmacol. 683:54–62. 2012. View Article : Google Scholar : PubMed/NCBI

26 

Huynh J, Etemadi N, Hollande F, Ernst M and Buchert M: The JAK/STAT3 axis: A comprehensive drug target for solid malignancies. Semin Cancer Biol. 45:13–22. 2017. View Article : Google Scholar : PubMed/NCBI

27 

Bixel K, Saini U, Kumar Bid H, Fowler J, Riley M, Wanner R, Deepa Priya Dorayappan K, Rajendran S, Konishi I, Matsumura N, et al: Targeting STAT3 by HO3867 induces apoptosis in ovarian clear cell carcinoma. Int J Cancer. 141:1856–1866. 2017. View Article : Google Scholar : PubMed/NCBI

28 

Khan MW, Saadalla A, Ewida AH, Al-Katranji K, Al-Saoudi G, Giaccone ZT, Gounari F, Zhang M, Frank DA and Khazaie K: The STAT3 inhibitor pyrimethamine displays anti-cancer and immune stimulatory effects in murine models of breast cancer. Cancer Immunol Immunother. 67:13–23. 2018. View Article : Google Scholar : PubMed/NCBI

29 

Zeng R, Tang Y, Zhou H, Liu Y, Huang J, Li L, Liu W, Feng Y, Zhou Y, Chen T, et al: STAT3 mediates multidrug resistance of Burkitt lymphoma cells by promoting antioxidant feedback. Biochem Biophys Res Commun. 488:182–188. 2017. View Article : Google Scholar : PubMed/NCBI

30 

Gao P, Niu N, Wei T, Tozawa H, Chen X, Zhang C, Zhang J, Wada Y, Kapron CM and Liu J: The roles of signal transducer and activator of transcription factor 3 in tumor angiogenesis. Oncotarget. 8:69139–69161. 2017.PubMed/NCBI

31 

Kim BH, Yi EH and Ye SK: Signal transducer and activator of transcription 3 as a therapeutic target for cancer and the tumor microenvironment. Arch Pharm Res. 39:1085–1099. 2016. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Ding X, Kong J, Xu W, Dong S, Du Y, Yao C, Gao J, Ke S, Wang S, Sun W, Sun W, et al: ATPase inhibitory factor 1 inhibition improves the antitumor of YC‑1 against hepatocellular carcinoma. Oncol Lett 16: 5230-5236, 2018.
APA
Ding, X., Kong, J., Xu, W., Dong, S., Du, Y., Yao, C. ... Sun, W. (2018). ATPase inhibitory factor 1 inhibition improves the antitumor of YC‑1 against hepatocellular carcinoma. Oncology Letters, 16, 5230-5236. https://doi.org/10.3892/ol.2018.9266
MLA
Ding, X., Kong, J., Xu, W., Dong, S., Du, Y., Yao, C., Gao, J., Ke, S., Wang, S., Sun, W."ATPase inhibitory factor 1 inhibition improves the antitumor of YC‑1 against hepatocellular carcinoma". Oncology Letters 16.4 (2018): 5230-5236.
Chicago
Ding, X., Kong, J., Xu, W., Dong, S., Du, Y., Yao, C., Gao, J., Ke, S., Wang, S., Sun, W."ATPase inhibitory factor 1 inhibition improves the antitumor of YC‑1 against hepatocellular carcinoma". Oncology Letters 16, no. 4 (2018): 5230-5236. https://doi.org/10.3892/ol.2018.9266
Copy and paste a formatted citation
x
Spandidos Publications style
Ding X, Kong J, Xu W, Dong S, Du Y, Yao C, Gao J, Ke S, Wang S, Sun W, Sun W, et al: ATPase inhibitory factor 1 inhibition improves the antitumor of YC‑1 against hepatocellular carcinoma. Oncol Lett 16: 5230-5236, 2018.
APA
Ding, X., Kong, J., Xu, W., Dong, S., Du, Y., Yao, C. ... Sun, W. (2018). ATPase inhibitory factor 1 inhibition improves the antitumor of YC‑1 against hepatocellular carcinoma. Oncology Letters, 16, 5230-5236. https://doi.org/10.3892/ol.2018.9266
MLA
Ding, X., Kong, J., Xu, W., Dong, S., Du, Y., Yao, C., Gao, J., Ke, S., Wang, S., Sun, W."ATPase inhibitory factor 1 inhibition improves the antitumor of YC‑1 against hepatocellular carcinoma". Oncology Letters 16.4 (2018): 5230-5236.
Chicago
Ding, X., Kong, J., Xu, W., Dong, S., Du, Y., Yao, C., Gao, J., Ke, S., Wang, S., Sun, W."ATPase inhibitory factor 1 inhibition improves the antitumor of YC‑1 against hepatocellular carcinoma". Oncology Letters 16, no. 4 (2018): 5230-5236. https://doi.org/10.3892/ol.2018.9266
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team