Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
October-2019 Volume 18 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2019 Volume 18 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Valosin‑containing protein promotes metastasis of osteosarcoma through autophagy induction and anoikis inhibition via the ERK/NF‑κβ/beclin‑1 signaling pathway

Expression of Concern in: /10.3892/ol.2026.15806
  • Authors:
    • Xin Hua Long
    • Yun Fei Zhou
    • Min Lan
    • Shan Hu Huang
    • Zhi Li Liu
    • Yong Shu
  • View Affiliations / Copyright

    Affiliations: Department of Emergency Surgery, The First Affiliated Hospital of Nanchang University, Nanchang, Jiangxi 330006, P.R. China, Department of Orthopedics, The First People's Hospital of Foshan, Foshan, Guangdong 528000, P.R. China, Department of Orthopedics, The First Affiliated Hospital of Nanchang University, Nanchang, Jiangxi 330006, P.R. China
  • Pages: 3823-3829
    |
    Published online on: August 6, 2019
       https://doi.org/10.3892/ol.2019.10716
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Valosin‑containing protein (VCP) promotes the development of metastasis in osteosarcoma (OS) via the PI3K/Akt signaling pathway. However, inhibition of the PI3K/Akt pathway does not completely reverse VCP‑mediated invasion and migration of OS, suggesting that VCP‑mediated OS invasion and migration involves additional mechanisms. In the present study, a positive correlation between the expression of VCP and cell autophagy was observed among OS tissues. Inhibiting VCP may decrease the survival of malignant cells; however, an autophagy stimulator may compensate for VCP inhibition and promote malignant cell survival. Altering the level of autophagy did not affect cell invasiveness or migration. ERK, NF‑κβ and beclin‑1 protein expression levels were markedly decreased following VCP inhibition. These findings indicated that VCP may induce autophagy and enhance anoikis resistance without affecting cell invasiveness or migration. Via anoikis resistance, VCP may promote metastasis in OS. Therefore, targeting of the ERK/NF‑κβ/beclin‑1 signaling pathway may be an effective therapeutic strategy for the management of OS.

Introduction

Osteosarcoma (OS) is the most common primary malignant bone tumor which frequently develops in children and adolescents. Although there have been improvements in diagnosis and treatment, the 5-year survival rate of patients with OS remains unchanged (1). This is due in part to an 80% prevalence of micro-metastases to the lungs at diagnosis (2). Lung metastasis is the leading cause of mortality in patients with OS (2). As with other types of tumor, the development of metastasis in OS is a complex, multi-step and multi-gene process (3). Therefore, clarification of the molecular mechanisms of invasion, and identification of new molecular targets are necessary for the development of effective treatments.

Valosin-containing protein (VCP), also known as p97 in mammals, is involved in a variety of cellular functions. Studies have identified VCP expression in various tumor types, in addition to an association between tumorigenesis and the development of metastasis (4–7). In previous studies, the role of VCP in metastatic OS was investigated. The results illustrated that VCP was involved in the invasion and migration of OS cells, in part through the activation of the PI3K/Akt signaling pathway, and the upregulation of matrix metallopeptidase (MMP)-2 and MMP-9 (8). Furthermore, inhibition of the PI3K/Akt pathway did not completely reverse the VCP-mediated invasion and migration of OS, suggesting that VCP-mediated OS invasion and migration may involve other mechanisms. Upon further investigation, VCP was revealed to inhibit apoptosis by activating the NF-κβ signaling. However, the details of this molecular mechanism are yet to be elucidated.

The role of autophagy in tumorigenesis has become a focus of biomedical research (9). The role of autophagy in tumorigenesis and tumor drug resistance is well delineated (10–13); however, the role of tumor cell autophagy in tumor metastasis remains unclear. In the development of metastasis, cells undergo local infiltration and penetration of the vasculature, subsequently entering the circulation for dissemination throughout the body (14,15). Tumor cells must separate from the cell matrix during this process (16). Apoptosis occurs following separation from the matrix in a process called anoikis (17). A growing number of studies have suggested that autophagy provides a mechanism for stromal-isolation of cells to resist anoikis (18,19). In a lung metastasis model of hepatocellular carcinoma, inhibition of autophagy significantly reduced metastasis of hepatoma cells to the lung. Inhibition of autophagy did not affect cell invasiveness, migration or epithelial-mesenchymal transition, but decreased the ability of liver cancer cells to resist anoikis and implant in the lung (20). These studies strongly suggested that autophagy promoted metastasis by mediating cellular resistance to anoikis. However, the role of anoikis resistance in the metastasis of OS remains to be investigated.

As a member of the adenosine triphosphate superfamily, VCP is closely associated with energy metabolism. VCP participates in the regulation of protein degradation by inducing autophagy (21), and is also closely associated with the development of numerous diseases. Ozsoy et al (22) revealed that VCP-induced autophagy is a prominent mechanism in the development of pre-eclampsia. Whether VCP promotes OS metastasis via autophagy-induced anoikis resistance is unclear, and requires further investigation.

ERK, a member of the mitogen-activated protein kinase (MAPK) family, transmits signals from cell surface receptors to the nucleus, and serves a key role in signal transduction (23,24). The MAPK family has a number of members, including ERK1/2, p38 and c-Jun N-terminal kinase (25). ERK1 (44 kDa) and ERK2 (42 kDa) are the most thoroughly studied (26–29). They are widely expressed and integral to the regulation of cell growth, development and differentiation (30). Phosphorylation of ERK1/2 and activation of the nuclear transcription factor NF-κβ exerts a biological effect, such as regulating other proteins. Copetti et al (31,32) demonstrated that the autophagy-promoting protein beclin-1 was able to bind to NF-κβ. Activated NF-κβp65 is able to promote beclin-1 expression by binding to the autophagy-promoting protein beclin-1. Numerous studies (33–35) have also confirmed that VCP regulates the ERK/NF-κβ signaling pathway, which is involved in a number of biological processes, including cell proliferation, apoptosis, protein degradation and DNA damage repair, in addition to tumorigenesis. Therefore, it is hypothesized that VCP may activate the ERK1/2/NF-κβ/beclin-1 pathway, inducing autophagy-mediated anoikis resistance, and subsequently promoting OS metastasis.

The present study aimed to demonstrate that VCP overexpression activates the ERK/NF-κβ/beclin-1 pathway, enhances autophagy-mediated anoikis resistance and promotes the metastasis of OS. Successful completion of this study may increase the understanding of VCP in OS metastasis, and ultimately facilitate the development of effective treatments for metastatic OS.

Materials and methods

Patient specimens

A total of 24 paired samples of OS and paraneoplastic tissue were obtained from patients (10 males and 14 females; age range, 9–35 years; mean age, 17±5 years) with OS who underwent surgery at The First Hospital Affiliated with Nanchang University (Nanchang, China) between January 2010 and December 2017. None of the patients received chemotherapy or radiotherapy prior to surgical resection. Written informed consent was obtained from all patients, and the study was approved by the Ethics Committee of The First Hospital Affiliated with Nanchang University.

Cell lines

The human osteosarcoma cell line 143B was purchased from the Cell Bank of the Type Culture Collection of the Chinese Academy of Sciences. 143B cells were cultured in Dulbecco's Modified Eagle Medium (DMEM; Gibco; Thermo Fisher Scientific, Inc.), supplemented with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.), 100 U/ml of penicillin and 100 U/ml of streptomycin. Cells were cultured at 37°C with 5% CO2.

Lentivirus vector construction and transfection

To construct siRNA vectors for the downregulation of VCP, reverse complement sequences as well as nonfunctional negative sequences (Invitrogen; Thermo Fisher Scientific, Inc.; Table I) were cloned into the lentivirus vector GV159 (Invitrogen; Thermo Fisher Scientific, Inc.). Fresh medium was administered to 143B cells, and they were cultured to ~80% confluence. Virus particles incorporating lentivirus vector for the downregulation of VCP (LV-down-VCP; MOI=20) and the cell transfection enhancer polybrene (6 µg/ml; Invitrogen; Thermo Fisher Scientific, Inc.) were added to the appropriate cultures [LV-down-VCP and negative lentivirus vector (Neg-LV)], and incubated at 37°C, 5% CO2 for 6–8 h. The medium was collected and replaced with fresh medium at 6 h after transfection. Transfection efficiency was evaluated using a fluorescence microscope 24 h post-transfection. 143B cells transfected with Neg-LV served as the control. A total of 6 independent experiments were performed, and subsequent experiments were started 324 h after transfection.

Table I.

Small interfering RNA sequence targeting valosin-containing protein and non-targeting negative control sequence.

Table I.

Small interfering RNA sequence targeting valosin-containing protein and non-targeting negative control sequence.

OligomerSequence (5′→3′)
siRNA-F TGCTGTACAGGTCATCATCATTGTCTGTTTTGGCCACTGACTGACAGACAATGGATGACCTGTA
siRNA-R CCTGTACAGGTCATCCATTGTCTGTCAGTCAGTGGCCAAAACAGACAATGATGATGACCTGTAC
Negative-F TGCTGAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT
Negative-R CCTGAAATGTACTGCGTGGAGACGTCAGTCAGTGGCCAAAACGTCTCCACGCGCAGTACATTTC
Autophagy intervention experiment

Autophinib and spermidine trihydrochloride were purchased form Sigma-Aldrich (Merck KGaA). Concentrations were adjusted to 10 mM for storage according to the manufacturer's instructions. For cell treatment, autophinib and spermidine trihydrochloride were added to the cell culture medium at final concentrations of 20 and 30 nM, respectively, and incubated at 37°C with 5% CO2 for 6 h. For cells treated with RNA interference and autophagy agonists, the drug treatment was performed 24 h after transfection.

Western blotting

Total protein was extracted from the OS tissues and cell lines using radioimmunoprecipitation assay lysis buffer (Beijing Solarbio Science & Technology Co., Ltd.) containing 60 µg/ml phenylmethylsulfonyl fluoride. Protein concentrations were determined using a Bradford assay. Proteins (15 µg/lane) were separated by SDS-PAGE using a 5% concentrated gel and 15% separating gel. Following electrophoresis, the protein was transferred to a nitrocellulose membrane and the membrane was blocked with 5% skimmed milk for 30 min at room temperature. Western blot analysis was conducted using primary antibodies against VCP (cat. no. ab36047), ERK (cat. no. ab79853), NF-κβ (cat. no. ab16502), beclin-1 (cat. no. ab62557) and LC3 (cat. no. ab62721; all Abcam; dilution, 1:2,000) and GAPDH (cat. no. sc-48166, Santa Cruz Biotechnology, Inc.; dilution, 1:5,000) and horseradish peroxidase-conjugated secondary antibodies (cat. nos. sc-2004 and sc-2020, Santa Cruz Biotechnology, Inc.; dilution, 1:5,000). Membranes were incubated with primary antibodies at 4°C for ~12 h (overnight), and subsequently with secondary antibodies at room temperature for 2–3 h. Immune complexes were detected using a pro-light HRP kit (Pierce; Thermo Fisher Scientific, Inc.). The strip gray value was determined using ImageJ software (version 1.46; National Institutes of Health). A total of 6 independent experiments were performed.

Migration assay

Cell migration was assessed using a wound healing assay to determine the ability of cells to move into a cellular space in two-dimensions, in vitro. In brief, cells were cultured to confluence in six-well tissue culture dishes, to a density of ~5×106 cells/well. The wound was created by dragging a rubber policeman (Thermo Fisher Scientific, Inc.) across the center of the plate. Cultures were rinsed with PBS and replaced with fresh medium alone or containing 10 g/l BSA (Gibco; Thermo Fisher Scientific, Inc.), and incubated at 37°C for 24 h. BSA was only used in place of FBS in the wound healing experiments. Images were captured using a light microscope at 0 and 24 h, and the migration distance was determined using ImageJ Software (National Institutes of Health).

Transwell invasion assay

The invasiveness of OS cells was assessed using the BD BioCoat™ BD Matrigel™ Invasion Chamber (BD Bioscience) according to the manufacturer's protocol. Cells (2×105) were resuspended in serum-free DMEM and added to the upper chambers; the medium in the lower chambers contained 5% FBS as a chemo-attractant. At 24 h, cells that had migrated through the Matrigel-coated membrane were stained with Diff-Quik (Sysmex Corporation, Kobe) at room temperature in Diff-Quik A for 10–20 sec, Diff-Quik B for 5–10 sec and Diff-Quik C for 5–10 sec, and images were captured under a light microscope (magnification, ×200).

MTT assay

Osteosarcoma 143B cells (2×106 cells) were cultured in suspension for 7 days and subsequently cultured for 6 h. MTT solution (5 mg/ml; 500 µl/well) was added to a 24-well plate, incubated for 4 h at 37°C, 1 ml DMSO was added to each well, and the plate was agitated for 10 min to completely dissolve the crystals. The absorbance at 490 nm was measured using a microplate spectrophotometer.

Statistical analysis

All statistical analyses were conducted using SPSS software (version 13.0; SPSS Inc., Chicago, IL, USA). Data are expressed as the mean ± standard deviation. Bivariate correlation analysis (Spearman's Rho) was performed to evaluate the association between VCP expression and autophagy in OS tissues. One-way analysis of variance followed by a Fisher's Least Significant Difference test was used to analyze multiple samples. P<0.05 was considered to indicate a statistically significant difference.

Results

Correlation between VCP expression and autophagy in OS tissues

To investigate the association between VCP expression and autophagy in OS, VCP and autophagy-associated proteins beclin-1 and microtubule-associated protein 1A/1B-light chain 3 (LC3)-I/II were analyzed in 24 tissue samples from patients with OS, using western blot analysis. The association between VCP and autophagy-associated proteins was evaluated by bivariate correlation (Spearman's Rho). The results revealed that VCP, beclin-1 and LC3-I/II expression was greater in OS tissues compared with paracancerous tissues (Fig. 1). There was a positive correlation between increased expression levels of VCP and autophagy (Spearman's Rho=0.658; data not shown). Therefore, increased expression levels of VCP may contribute to cell autophagy in OS.

Figure 1.

Western blot analysis of the expression levels of VCP, beclin-1 and LC3-I/II. Expression levels in OS tissues were higher than those in paracancerous tissues. VCP, valosin-containing protein; LC3-I/II, microtubule-associated protein 1A/1B-light chain 3-I/II; OS, osteosarcoma.

VCP induces autophagy to enhance anoikis resistance

To determine if VCP was able to induce autophagy and anoikis resistance, VCP expression was inhibited in 143B cells by RNA interference. After 7 days in suspension culture, LC3-II/I expression levels and cell survival were analyzed (Fig. 2). The results illustrated that VCP inhibition lead to a significant decrease in LC3-II/I expression (Fig. 2A) and cell survival (Fig. 2B). Further studies performed with an autophagy inhibitor autophinib and autophagy stimulator spermidine trihydrochloride revealed that autophagy inhibitors and stimulator could cause relative changes in the levels of autophagy-related proteins in cells (Fig. 2A), and inhibiting autophagy decreased cell survival; conversely, autophagy stimulation promoted cell survival and counteracted the changes caused by VCP inhibition (Fig. 2B). Collectively, these results indicate that VCP induced autophagy to enhance cell survival and possibly anoikis resistance.

Figure 2.

Autophagy-related protein expression levels and cell survival in each group. (A) Downregulation of VCP expression can inhibit autophagy-related protein expression levels. LC3-II/I expression represents the level of autophagy in a cell. (B) MTT assay was used to detect cell survival after 7 days in suspension culture. (C) Representative images of LC3-I and LC3-II levels in each group according to western blotting. N=6. Data are presented as the mean ± standard deviation. *P<0.05 vs. Neg-LV. Neg-LV, 143B cells transfected with negative lentivirus vector; LV-down-VCP, 143B cells transfected with lentivirus vector-downregulating VCP; VCP, valosin-containing protein; LC3-I/II, microtubule-associated protein 1A/1B-light chain 3-I/II; OS, osteosarcoma; OD, optical density.

VCP promotes migration and invasion in OS cells via enhanced cell survival induced by autophagy

To identify whether VCP expression effects autophagy, and may therefore alter the malignant phenotype of OS cells, lentivirus vectors and autophagy-inhibitory and stimulating agents were used to treat OS cells. Wound-healing and Matrigel-invasion assays were used to evaluate the malignant phenotype of OS cells. The results demonstrated that after 24 h, the migration rate and number of invaded cells were reduced in cells where VCP was downregulated, compared with those transfected with Neg-LV. By contrast, there was no marked difference in the migration rate and invasive ability of cells treated with autophagy inhibitor or stimulator, compared with that of Neg-LV cells (Fig. 3). Collectively, the results revealed that VCP can induce cell autophagy and promote OS cell invasiveness or migration, but altering autophagy levels in vitro did not affect cell invasiveness or migration.

Figure 3.

Invasion and migration potential of osteosarcoma cells was determined using Matrigel and wound-healing assays, respectively. (A) Cell migration. (B) Cell invasion. VCP, valosin-containing protein; Neg-LV, 143B cells transfected with negative lentivirus vector; LV-down-VCP, 143B cells transfected with lentivirus vector-downregulating VCP.

VCP induces autophagy via the ERK/NF-κβ/beclin-1 signaling pathway

To investigate the mechanism by which VCP induced autophagy, 143B cells were treated with LV-down-VCP vector, and the expression levels of VCP, ERK, NF-κβ and autophagy-associated protein beclin-1 were determined using western blotting. The results illustrated that VCP inhibition led to a marked decrease in the expression levels of ERK, NF-κβ and beclin-1 (Fig. 4).

Figure 4.

Western blotting was used to detect proteins of the ERK/NF-κβ/beclin-1 signaling pathway. VCP inhibition resulted in markedly decreased expression levels of ERK, NF-κβ (p65) and beclin-1. ERK, extracellular signal-regulated protein kinase; NF-κβ, nuclear factor κβ; VCP, valosin-containing protein; Neg-LV, 143B cells transfected with negative lentivirus vector; LV-down-VCP, 143B cells transfected with lentivirus vector-downregulating VCP.

Discussion

OS lung metastases are frequently present at diagnosis and confer high rates of mortality in patients with OS. Despite the emergence of a number of novel chemotherapeutical regimens, the clinical outcome for patients with metastatic OS remains poor (36). Therefore, clarification of the molecular mechanism of invasion, and identification of new molecular targets are imperative to the development of effective treatments for OS.

VCP is involved in the development of various types of tumor (37–40), and thus, may serve as a potential tumor marker. Previous studies have revealed that VCP expression levels in OS samples with pulmonary metastasis were higher compared with those without pulmonary metastatic disease. Inhibition of VCP expression may suppress OS metastasis by modulating the Akt/NF-κβ signaling pathway (8). However, our previous study revealed that inhibition of the PI3K/NF-κβ pathway does not completely reverse VCP-mediated invasion and migration of OS (Long et al, unpublished data). Other mechanisms of VCP-mediated OS invasion and migration may be involved.

Further investigation into autophagy and anoikis resistance may highlight novel mechanisms involved in OS metastasis. In the late stages of metastasis, autophagy may compensate for the loss of external signals that promote and maintain metabolism, and delay apoptosis, therefore allowing cells to reconnect with the extracellular matrix, and ultimately increase viability. Autophagy supports the adjustment of metastatic cells to the altered matrix environment, and allows cells to enter a dormant state (41). In the present study, the expression levels of VCP and autophagy-associated proteins beclin-1 and LC3-II/I were detected in 24-paired samples of OS and paracancerous tissues. The results revealed a positive correlation between the expression of VCP and autophagy-associated proteins. Therefore, an increase in VCP expression levels may promote autophagy in OS. Silencing VCP expression in 143B cells using an RNA interference technique resulted in significantly decreased expression levels of LC3-II/I, suggesting that VCP is able to induce autophagy. Furthermore, VCP inhibition resulted in reduced cell survival following 7 days in suspension culture, suggesting that VCP may also enhance anoikis resistance. Autophagy inhibition decreased cell survival after seven days in suspension culture, and conversely, autophagy stimulation promoted cell survival and counteracted the decrease caused by VCP inhibition. Autophagy did not affect cell invasiveness or migration. Collectively, the results indicate that VCP induced autophagy and enhanced cell survival. to promote OS metastasis, but altering autophagy levels in vitro did not affect cell invasiveness or migration.

The ERK/NF-κβ signaling pathway induces anoikis and promotes autophagy (42,43). Specifically, the inhibition of autophagy by beclin-1 silencing reduces liver cancer metastasis, by reducing the resistance of malignant cells to apoptosis (44). In the present study, VCP inhibition resulted in decreased levels of ERK, NF-κβ and beclin-1 protein expression, in addition to decreased migration and invasiveness compared with the Neg-LV group. VCP may increase the metastatic potential of OS through the promotion of autophagy via the ERK/NF-κβ/Beclin-1 signaling pathway.

In conclusion, in the present study, VCP promoted migration and invasion in OS by inducing autophagy and possibly inhibiting anoikis via the ERK/NF-κβ/beclin-1 signaling pathway. These results may enhance the development of novel treatment strategies for patients with OS.

Acknowledgements

Not applicable.

Funding

The present study was supported by the Education Department Foundation of Jiangxi Province (grant no. GTJ160237).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request

Authors' contributions

XHL organized and analysed the data, and wrote the manuscript. YFZ and ML completed the cell experiments. SHH and ZLL performed surgery, specimen collection and tissue experiments. YS contributed to the project design and experiment management.

Ethics approval and consent to participate

The present study was approved by the Ethics Committee of The First Hospital Affiliated with Nanchang University. Written informed consent was obtained from all participants.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Niswander LM and Kim SY: Stratifying osteosarcoma: Minimizing and maximizing therapy. Curr Oncol Rep. 12:266–270. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Munajat I, Zulmi W, Norazman MZ and Wan Faisham WI: Tumour volume and lung metastasis in patients with osteosarcoma. J Orthop Surg (Hong Kong). 16:182–185. 2008. View Article : Google Scholar : PubMed/NCBI

3 

Steeg PS: Tumor metastasis: Mechanistic insights and clinical challenges. Nat Med. 12:895–904. 2006. View Article : Google Scholar : PubMed/NCBI

4 

Ewens CA, Kloppsteck P, Förster A, Zhang X and Freemont PS: Structural and functional implications of phosphorylation and acetylation in the regulation of the AAA+ protein p97. Biochem Cell Biol. 88:41–48. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Wang Q, Song C and Li CC: Molecular perspectives on p97-VCP: Progress in understanding its structure and diverse biological functions. J Struct Biol. 146:44–57. 2004. View Article : Google Scholar : PubMed/NCBI

6 

Lass A, Kujawa M, McConnell E, Paton AW, Paton JC and Wójcik C: Decreased ER-associated degradation of alpha-TCR induced by Grp78 depletion with the SubAB cytotoxin. Int J Biochem Cell Biol. 40:2865–2879. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Livingstone M, Ruan H, Weiner J, Clauser KR, Strack P, Jin S, Williams A, Greulich H, Gardner J, Venere M, et al: Valosin-containing protein phosphorylation at Ser784 in response to DNA damage. Cancer Res. 65:7533–7540. 2005. View Article : Google Scholar : PubMed/NCBI

8 

Long XH, Zhang ZH, Liu ZL, Huang SH and Luo QF: Inhibiting valosin-containing protein suppresses osteosarcoma cell metastasis via AKT/nuclear factor of kappa B signaling pathway in vitro. Indian J Pathol Microbiol. 56:190–195. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Lin L and Baehrecke EH: Autophagy, cell death, and cancer. Mol Cell Oncol. 2:e9859132015. View Article : Google Scholar : PubMed/NCBI

10 

Zhao Z, Zhao J, Xue J, Zhao X and Liu P: Autophagy inhibition promotes epithelial-mesenchymal transition through ROS/HO-1 pathway in ovarian cancer cells. Am J Cancer Res. 6:2162–2177. 2016.PubMed/NCBI

11 

Wu HM, Shao LJ, Jiang ZF and Liu RY: Gemcitabine-induced autophagy protects human lung cancer cells from apoptotic death. Lung. 194:959–966. 2016. View Article : Google Scholar : PubMed/NCBI

12 

Peng Y, Miao H, Wu S, Yang W, Zhang Y, Xie G, Xie X, Li J, Shi C, Ye L, et al: ABHD5 interacts with BECN1 to regulate autophagy and tumorigenesis of colon cancer independent of PNPLA2. Autophagy. 12:2167–2182. 2016. View Article : Google Scholar : PubMed/NCBI

13 

Yin L, Liu S, Li C, Ding S, Bi D, Niu Z, Han L, Li W, Gao D, Liu Z and Lu J: CYLD downregulates Livin and synergistically improves gemcitabine chemosensitivity and decreases migratory/invasive potential in bladder cancer: The effect is autophagy-associated. Tumour Biol. 37:12731–12742. 2016. View Article : Google Scholar : PubMed/NCBI

14 

Nguyen DX, Bos PD and Massagué J: Metastasis: From dissemination to organ-specific colonization. Nat Rev Canc. 9:274–284. 2009. View Article : Google Scholar

15 

Vanharanta S and Massagué J: Origins of metastatic traits. Cancer Cell. 24:410–421. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Liotta LA and Kohn EC: The microenvironment of the tumour-host interface. Nature. 411:375–379. 2001. View Article : Google Scholar : PubMed/NCBI

17 

Gilmore AP: Anoikis. Cell Death Differ. 12 (Suppl 2):S1473–S1477. 2005. View Article : Google Scholar

18 

Lock R and Debnath J: Extracellular matrix regulation of autophagy. Curr Opin Cell Biol. 20:583–588. 2008. View Article : Google Scholar : PubMed/NCBI

19 

Debnath J: Detachment-induced autophagy during anoikis and lumen formation in epithelial acini. Autophagy. 4:351–353. 2008. View Article : Google Scholar : PubMed/NCBI

20 

Peng YF, Shi YH, Ding ZB, Ke AW, Gu CY, Hui B, Zhou J, Qiu SJ, Dai Z and Fan J: Autophagy inhibition suppresses pulmonary metastasis of HCC in mice via impairing anoikis resistance and colonization of HCC cells. Autophagy. 9:2056–2068. 2013. View Article : Google Scholar : PubMed/NCBI

21 

Wiederstein JL, Nolte H, Günther S, Piller T, Baraldo M, Kostin S, Bloch W, Schindler N, Sandri M, Blaauw B, et al: Skeletal muscle-specific methyltransferase METTL21C trimethylates p97 and regulates autophagy-associated protein breakdown. Cell Rep. 23:1342–1356. 2018. View Article : Google Scholar : PubMed/NCBI

22 

Ozsoy AZ, Cayli S, Sahin C, Ocakli S, Sanci TO and Ilhan DB: Altered expression of p97/Valosin containing protein and impaired autophagy in preeclamptic human placenta. Placenta. 67:45–53. 2018. View Article : Google Scholar : PubMed/NCBI

23 

Li L, Zhao GD, Shi Z, Qi LL, Zhou LY and Fu ZX: The Ras/Raf/MEK/ERK signaling pathway and its role in the occurrence and development of HCC. Oncol Lett. 12:3045–3050. 2016. View Article : Google Scholar : PubMed/NCBI

24 

Zhang S, Shi R, Chen S, Wei X, Zhou Q and Wang Y: All-trans retinoic acid inhibits the proliferation of SGC7901 cells by regulating caveolin-1 localization via the ERK/MAPK signaling pathway. Oncol Lett. 15:1523–1528. 2018.PubMed/NCBI

25 

Yan KH, Yao CJ, Hsiao CH, Lin KH, Lin YW, Wen YC, Liu CC, Yan MD, Chuang SE, Lai GM and Lee LM: Mefloquine exerts anticancer activity in prostate cancer cells via ROS-mediated modulation of Akt, ERK, JNK and AMPK signaling. Oncol Lett. 5:1541–1545. 2013. View Article : Google Scholar : PubMed/NCBI

26 

Qi M and Elion EA: MAP kinase pathways. J Cell Sci. 118:3569–3572. 2005. View Article : Google Scholar : PubMed/NCBI

27 

Tang B, Liang W, Liao Y, Li Z, Wang Y and Yan C: PEA15 promotes liver metastasis of colorectal cancer by upregulating the ERK/MAPK signaling pathway. Oncol Rep. 41:43–56. 2019.PubMed/NCBI

28 

Huang Y, Zou Y, Lin L, Ma X and Zheng R: miR-101 regulates the cell proliferation and apoptosis in diffuse large B-cell lymphoma by targeting MEK1 via regulation of the ERK/MAPK signaling pathway. Oncol Rep. 41:377–386. 2019.PubMed/NCBI

29 

Wang D, Xu Y, Feng L, Yin P, Song SS, Wu F, Yan P and Liang Z: RGS5 decreases the proliferation of human ovarian carcinoma-derived primary endothelial cells through the MAPK/ERK signaling pathway in hypoxia. Oncol Rep. 41:165–177. 2019.PubMed/NCBI

30 

Chen Z, Gibson TB, Robinson F, Silvestro L, Pearson G, Xu B, Wright A, Vanderbilt C and Cobb MH: MAP kinase. Chem Rev. 101:2449–2476. 2001. View Article : Google Scholar : PubMed/NCBI

31 

Copetti T, Bertoli C, Dalla E, Demarchi F and Schneider C: p65/RelA modulates BECN1 transcription and autophagy. Mol Cell Biol. 29:2594–2608. 2009. View Article : Google Scholar : PubMed/NCBI

32 

Copetti T, Demarchi F and Schneider C: p65/RelA binds and activates the beclin 1 promoter. Autophagy. 5:858–859. 2009. View Article : Google Scholar : PubMed/NCBI

33 

Schweitzer K, Pralow A and Naumann M: p97/VCP promotes Cullin-RING-ubiquitin-ligase/proteasome-dependent degradation of IκBα and the preceding liberation of RelA from ubiquitinated IκBα. J Cell Mol Med. 20:58–70. 2016. View Article : Google Scholar : PubMed/NCBI

34 

McNeill H, Knebel A, Arthur JS, Cuenda A and Cohen P: A novel UBA and UBX domain protein that binds polyubiquitin and VCP and is a substrate for SAPKs. Biochem J. 384:391–400. 2004. View Article : Google Scholar : PubMed/NCBI

35 

Zhang Z, Wang Y, Li C, Shi Z, Hao Q, Wang W, Song X, Zhao Y, Jiao S and Zhou Z: The transitional endoplasmic reticulum ATPase p97 regulates the alternative nuclear factor NF-κB signaling via partial degradation of the NF-κB subunit p100. J Biol Chem. 290:19558–19568. 2015. View Article : Google Scholar : PubMed/NCBI

36 

Ando K, Heymann MF, Stresing V, Mori K, Rédini F and Heymann D: Current therapeutic strategies and novel approaches in osteosarcoma. Cancers (Basel). 5:591–616. 2013. View Article : Google Scholar : PubMed/NCBI

37 

Yamamoto S, Tomita Y, Hoshida Y, Takiguchi S, Fujiwara Y, Yasuda T, Yano M, Nakamori S, Sakon M, Monden M and Aozasa K: Expression level of valosin-containing protein is strongly associated with progression and prognosis of gastric carcinoma. J Clin Oncol. 21:2537–2544. 2003. View Article : Google Scholar : PubMed/NCBI

38 

Yamamoto S, Tomita Y, Hoshida Y, Sakon M, Kameyama M, Imaoka S, Sekimoto M, Nakamori S, Monden M and Aozasa K: Expression of valosin-containing protein in colorectal carcinomas as a predictor for disease recurrence and prognosis. Clin Cancer Res. 10:651–657. 2004. View Article : Google Scholar : PubMed/NCBI

39 

Yamamoto S, Tomita Y, Nakamori S, Hoshida Y, Nagano H, Dono K, Umeshita K, Sakon M, Monden M and Aozasa K: Elevated expression of valosin-containing protein (p97) in hepatocellular carcinoma is correlated with increased incidence of tumor recurrence. J Clin Oncol. 21:447–452. 2003. View Article : Google Scholar : PubMed/NCBI

40 

Yamamoto S, Tomita Y, Nakamori S, Hoshida Y, Iizuka N, Okami J, Nagano H, Dono K, Umeshita K, Sakon M, et al: Valosin-containing protein (p97) and Ki-67 expression is a useful marker in detecting malignant behavior of pancreatic endocrine neoplasms. Oncology. 66:468–475. 2004. View Article : Google Scholar : PubMed/NCBI

41 

Guadamillas MC, Cerezo A and del Pozo MA: Overcoming anoikis-pathways to anchorage-independent growth in cancer. J Cell Sci. 124:3189–3197. 2011. View Article : Google Scholar : PubMed/NCBI

42 

Wu L, Zhang Q, Dai W, Li S, Feng J, Li J, Liu T, Xu S, Wang W, Lu X, et al: Quercetin pretreatment attenuates hepatic ischemia reperfusion-induced apoptosis and autophagy by inhibiting ERK/NF-κB pathway. Gastroenterol Res Pract 2017. 97242172017.

43 

Paoli P, Giannoni E and Chiarugi P: Anoikis molecular pathways and its role in cancer progression. Biochim Biophys Acta 1833. 3481–3498. 2013.

44 

Peng YF, Shi YH, Ding ZB, Ke AW, Gu CY, Hui B, Zhou J, Qiu SJ, Dai Z and Fan J: Autophagy inhibition suppresses pulmonary metastasis of HCC in mice via impairing anoikis resistance and colonization of HCC cells. Autophagy. 9:2056–2068. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Long XH, Zhou YF, Lan M, Huang SH, Liu ZL and Shu Y: Valosin‑containing protein promotes metastasis of osteosarcoma through autophagy induction and anoikis inhibition via the ERK/NF‑κβ/beclin‑1 signaling pathway Expression of Concern in /10.3892/ol.2026.15806. Oncol Lett 18: 3823-3829, 2019.
APA
Long, X.H., Zhou, Y.F., Lan, M., Huang, S.H., Liu, Z.L., & Shu, Y. (2019). Valosin‑containing protein promotes metastasis of osteosarcoma through autophagy induction and anoikis inhibition via the ERK/NF‑κβ/beclin‑1 signaling pathway Expression of Concern in /10.3892/ol.2026.15806. Oncology Letters, 18, 3823-3829. https://doi.org/10.3892/ol.2019.10716
MLA
Long, X. H., Zhou, Y. F., Lan, M., Huang, S. H., Liu, Z. L., Shu, Y."Valosin‑containing protein promotes metastasis of osteosarcoma through autophagy induction and anoikis inhibition via the ERK/NF‑κβ/beclin‑1 signaling pathway Expression of Concern in /10.3892/ol.2026.15806". Oncology Letters 18.4 (2019): 3823-3829.
Chicago
Long, X. H., Zhou, Y. F., Lan, M., Huang, S. H., Liu, Z. L., Shu, Y."Valosin‑containing protein promotes metastasis of osteosarcoma through autophagy induction and anoikis inhibition via the ERK/NF‑κβ/beclin‑1 signaling pathway Expression of Concern in /10.3892/ol.2026.15806". Oncology Letters 18, no. 4 (2019): 3823-3829. https://doi.org/10.3892/ol.2019.10716
Copy and paste a formatted citation
x
Spandidos Publications style
Long XH, Zhou YF, Lan M, Huang SH, Liu ZL and Shu Y: Valosin‑containing protein promotes metastasis of osteosarcoma through autophagy induction and anoikis inhibition via the ERK/NF‑κβ/beclin‑1 signaling pathway Expression of Concern in /10.3892/ol.2026.15806. Oncol Lett 18: 3823-3829, 2019.
APA
Long, X.H., Zhou, Y.F., Lan, M., Huang, S.H., Liu, Z.L., & Shu, Y. (2019). Valosin‑containing protein promotes metastasis of osteosarcoma through autophagy induction and anoikis inhibition via the ERK/NF‑κβ/beclin‑1 signaling pathway Expression of Concern in /10.3892/ol.2026.15806. Oncology Letters, 18, 3823-3829. https://doi.org/10.3892/ol.2019.10716
MLA
Long, X. H., Zhou, Y. F., Lan, M., Huang, S. H., Liu, Z. L., Shu, Y."Valosin‑containing protein promotes metastasis of osteosarcoma through autophagy induction and anoikis inhibition via the ERK/NF‑κβ/beclin‑1 signaling pathway Expression of Concern in /10.3892/ol.2026.15806". Oncology Letters 18.4 (2019): 3823-3829.
Chicago
Long, X. H., Zhou, Y. F., Lan, M., Huang, S. H., Liu, Z. L., Shu, Y."Valosin‑containing protein promotes metastasis of osteosarcoma through autophagy induction and anoikis inhibition via the ERK/NF‑κβ/beclin‑1 signaling pathway Expression of Concern in /10.3892/ol.2026.15806". Oncology Letters 18, no. 4 (2019): 3823-3829. https://doi.org/10.3892/ol.2019.10716
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team