Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
March-2018 Volume 39 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March-2018 Volume 39 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Fra‑1 enhances the radioresistance of colon cancer cells to X‑ray or C‑ion radiation

  • Authors:
    • Satoshi Endo
    • Mayumi Fujita
    • Shigeru Yamada
    • Kaori Imadome
    • Fumiaki Nakayama
    • Tetsuro Isozaki
    • Takeshi Yasuda
    • Takashi Imai
    • Hisahiro Matsubara
  • View Affiliations / Copyright

    Affiliations: Department of Frontier Surgery, Chiba University Graduate School of Medicine, Chiba 260‑8670, Japan, Department of Basic Medical Sciences for Radiation Damage, National Institutes for Quantum and Radiological Science and Technology, Japan, Hospital of The National Institute of Radiological Sciences, National Institutes for Quantum and Radiological Science and Technology, Japan, National Institute of Radiological Sciences, National Institutes for Quantum and Radiological Science and Technology, Japan
    Copyright: © Endo et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 1112-1118
    |
    Published online on: January 19, 2018
       https://doi.org/10.3892/or.2018.6223
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Fos‑related antigen 1 (Fra‑1) has roles in a variety of cell functions, including cell proliferation, differentiation, transformation, and invasiveness, and it is upregulated in various cancers. We investigated the role of Fra‑1 in cellular radioresistance using cells of two human colorectal cancer cell lines, SW620 and SW480. We found that SW620 cells are more sensitive than SW480 cells at doses greater than 6 Gy for X‑ray or 3 Gy for carbon‑ion (C‑ion) radiation. Fra‑1 expression tended to be decreased by the radiation in a dose‑dependent manner in both cell lines; of note, a greater reduction of Fra‑1 expression was observed in SW620 cells, especially at 6 Gy of X‑ray or 3 Gy of C‑ion irradiation, than in SW480 cells, indicating a possible association between Fra‑1 downregulation and cellular radiosensitivity. Knockdown of Fra‑1 in SW480 cells significantly increased the radiosensitivity to X‑ray or C‑ion radiation. On the other hand, overexpression of Fra‑1 in SW620 cells significantly enhanced the radioresistance to C‑ion radiation, suggesting a role of Fra‑1 in radioresistance. Furthermore, we found that downregulation of Fra‑1 protein in irradiated SW620 cells was regulated via protein degradation through a proteasome‑dependent pathway. Overall, our results indicate a role of Fra‑1 in radioresistance to both X‑ray and C‑ion radiation for colorectal cancer cell lines.

Introduction

Fos-related antigen 1 (Fra-1) protein forms activator protein-1 complexes in association with members of the JUN family, which drives the expression of genes involved in various biological processes, including cell proliferation, differentiation, transformation, and invasiveness, in several cancer cell lines (1–3). Fra-1 is usually absent in normal epithelial cells but is upregulated in various cancers, such as lung, breast, colon, prostate, brain, head and neck, esophagus, ovary, and nasopharynx cancers (3–13). Increased Fra-1 expression has been shown to be correlated with tumor stage in esophageal squamous cell carcinoma (8), and high levels of Fra-1 expression are associated with severe malignancy in breast cancer progression (13); thus, Fra-1 is recognized as a prognostic factor for certain cancers (2,8).

Colorectal cancer is currently the most common gastrointestinal malignancy, and it remains the third most common cancer and second leading cause of cancer-related death in developed countries (14). Although surgical resection is the first choice of treatment for colorectal cancer, radiation therapy and chemotherapy are also essential interventions in colorectal cancer treatment. In addition, many patients with local recurrences are not eligible for surgical resection, and they are frequently referred for radiotherapy. However, the results of conventional photon radiotherapy are still far from satisfactory, with many studies in the literature reporting a 50% 1-year survival rate and a 10% 3-year survival rate (15). Thus, the role of photon radiotherapy is often described as mere pain control (16). Carbon-ion (C-ion) beam therapy is well known for its high linear energy transfer (LET), and it has some unique advantages over photon irradiation, including more accurate dose distribution (17–19), a high rate of double-strand breaks of the DNA chain (20,21), and high relative biologic effectiveness of tumor cell killing (22–24). Thus, C-ion radiotherapy is expected to become a promising alternative to surgery for colorectal cancer treatment. Previous research has shown that C-ion radiotherapy may be a safe and effective treatment option for locally recurrent rectal cancer and may serve as an alternative to surgery (25–31).

The radiation dose required for tumor control varies widely among human tumors and depends on a range of factors, such as inherent cellular radiosensitivity, repair and repopulation phenomena, and tumor hypoxia (32–34). Since resistance to radiation is one of the reasons for treatment failure, the identification of key factors involved in cancer radioresistance is important for developing an effective method of chemoradiotherapy. A previous study reported that downregulation of Fra-1 reduced the radioresistance of a prostate cancer cell line, PC-3, after treatment with 4-Gy photon beam irradiation (35). However, there are no published studies of the role of Fra-1 in radioresistance to X-ray or C-ion radiation for colorectal cancer cells.

Herein, we used two human colon cancer cell lines, SW620 and SW480, and demonstrated that Fra-1 has a role in the radioresistance to both X-ray and C-ion radiation.

Materials and methods

Cell culture and reagents

Cells of the human colon cancer cell lines SW620 and SW480 were purchased from ATCC (Manassas, VA, USA) and cultured in Dulbecco's modified Eagle's medium (DMEM; Nissui, Tokyo, Japan) supplemented with 10% fetal bovine serum (FBS; HyClone, Logan, UT, USA), and penicillin/streptomycin (Gibco, Carlsbad, CA, USA).

Irradiation

Cells were irradiated with X-rays or C-ions at room temperature. X-rays were produced by a PANTAK HF-320S generator (Shimadzu Corp., Kyoto, Japan), at 200 kVp and 20 mA, and filtered with 0.5 mm Al and 0.5 mm Cu (36). C-ions were accelerated by the Heavy-Ion Medical Accelerator in Chiba at the National Institute of Radiological Sciences, Chiba, Japan (37). The initial energy of the C-ion beams was 290 MeV/nucleon, and the LET value was 80 keV/µm with a monoenergetic beam (20). An outline of the experimental procedures after irradiation is shown in Fig. 1.

Figure 1.

An outline of the experimental procedures after irradiation.

siRNA transfection

The cells were transiently transfected with siRNA specific for Fra-1 using Lipofectamine 2000 Reagent (Invitrogen, Carlsbad, CA, USA), as previously described (8). The sequences of the Fra-1 siRNA were as follows: Sense, agaaaucugggcugcagcgagagau, and antisense, aucucucgcug cagcccagauuucu. Fra-1 protein expression was evaluated by western blotting, and Fra-1 downregulation was confirmed at 48 h after siRNA transfection by comparison with the Fra-1 expression level of the cells transfected with scrambled negative control siRNA (Invitrogen).

Lentivirus production and transduction

The coding sequence of the human FRA1 gene was amplified from cDNA derived from SW480 cells by PCR using a gene-specific primer set: Sense, ggggacaagtttgtacaaaaaagcaggcttcaccatgttccgagacttcggggaacccggcccg, and antisense, ggggaccactttgtacaagaaagctgggtctcacaaagcgaggagggttggagagccaag. The PCR fragment was introduced into a pDONR221 vector for cloning of the gene, in accordance with the instructions for Gateway Cloning Technology (Invitrogen), and confirmed by sequencing. Then, this gene was transferred by LR recombination from its entry clone into a pLenti7.3V5-DEST vector containing Emerald Green Fluorescent Protein (EmGFP). pLenti7.3/V5-GW/lacZ was the construct for the negative control. Lentiviral stocks were produced in 293FT cells in accordance with a modification of the manufacturer's protocol (Invitrogen). Briefly, 18 µl of FuGENE 6 was diluted in 0.6 ml of Opti-MEM I medium, and then 1.5 µg of plasmid DNA and 4.5 µg of packaging mix (Applied Biological Materials Inc., Richmond, BC, Canada) were added to this medium. These transfection complexes were incubated at room temperature and added to 5 ml of Opti-MEM I containing 6×106 cells. After incubation at 37°C for 8 h, the culture medium was replaced with 5 ml of DMEM supplemented with 10% heat-inactivated FBS. Virus-containing supernatants were harvested 48 h after transfection and then centrifuged at 3,000 rpm at 4°C for 15 min and passed through a 0.45-µm Millex-HV filter to remove debris. The virus was precipitated at 4°C overnight by adding 3.3 ml of cold 40% PEG6000, to concentrate the virus, and then suspended in 100 µl of phosphate-buffered saline (PBS). Then, 1×105 cells were transduced by 10 µl of the virus preparation in the presence of 6 µg/ml hexadimethrine bromide (Polybrene) for 48 h. Fra-1 protein expression was evaluated by western blotting, and upregulation of Fra-1 was confirmed at 48 h after lentivirus transfection by comparison with the Fra-1 expression level of the cells transfected with the negative control.

Colony formation assay

Cell survival curves were determined by a colony formation assay as previously described, with some modifications (38). Briefly, cell cultures at 70% confluence were rinsed with PBS and detached with 0.1% trypsin/PBS. Cell numbers were determined with a hemocytometer. Cells were plated in triplicate onto 60-mm diameter plastic dishes and incubated for 12 days, whereupon the colonies were fixed and stained with 1% methylene blue in 30% methanol. Colonies consisting of more than 50 cells were scored as surviving colonies.

For the radiosensitivity analysis, non-irradiated cells or cells irradiated with X-rays at 1, 2, 4, 6, or 8 Gy or C-ions at 0.5, 1, 2, 3, or 4 Gy were used. The cells were trypsinized and counted immediately after irradiation. Eighty cells for non-irradiated cells or 150, 300, 1,500, or 3,000 cells for X-ray irradiation at 1, 2, 4, 6, or 8 Gy or C-ion irradiation at 0.5, 1, 2, 3, or 4 Gy were plated onto 60-mm diameter dishes, respectively. The surviving fraction was normalized to that of the non-irradiated control.

To assess the clonogenicity of the Fra-1 siRNA-transfected or lentivirus-transfected cells, cells were treated with siRNA or lentivirus vector for 48 h before irradiation. Immediately after irradiation, the cells were trypsinized, and the same numbers of cells as that used in the radiosensitivity analysis were plated onto dishes containing fresh media; colony-forming assays were then performed.

Protein sampling and western blotting

Non-irradiated or irradiated cells were trypsinized and counted immediately after irradiation, and the same number of non-irradiated and irradiated cells was plated onto dishes containing fresh media. Two days after irradiation, cells were lysed with RIPA lysis buffer containing PMSF and sodium orthovanadate (Santa Cruz Biotechnology, Dalla, TX, USA) and then used for the western blotting.

For the proteasome inhibitor treatment, two patterns of schedule were used: 1) 10 nM of epoxomicin (proteasome inhibitor; Peptide Institute Inc., Osaka, Japan) was added to the culture media immediately before cell irradiation, and the cells were cultured for 48 h in a 5% CO2 incubator at 37°C and then lysed, or 2) 10 nM of epoxomicin was added to the culture media 48 h after irradiation, and the cells were cultured in a 5% CO2 incubator at 37°C for 24 h. The cells were then lysed with RIPA lysis buffer and used for the western blotting.

Immunoblotting was performed as previously described (37). Primary antibodies for human Fra-1 (Santa Cruz Biotechnology) and GAPDH (Trevigen, Bristol, UK) with horseradish peroxidase-conjugated anti-mouse IgG or anti-rabbit IgG (Amersham Biosciences, Buckinghamshire, UK) were used for this study. Protein bands were detected by enhanced chemiluminescence and imaged using a Lumino image analyzer (LAS4000; Fujifilm, Tokyo, Japan).

Quantitative real-time PCR

Quantitative real-time PCR (qRT-PCR) was performed on a LightCycler 480 with Probes Master (Roche Diagnostics, Basel, Switzerland) as previously described (38). The Universal Probe Library (UPL; Roche Diagnostics) probes and primer sequences for the Fra-1 (FOSL1) and GAPDH genes were as follows: FOSL1 (UPL probe: 26) sense, aggaactgaccgacttcctg, and antisense, cagctctaggcgctccttc; GAPDH (UPL probe: 60) sense, agccacatcgctcagaca, and antisense, gcccaatacgaccaaatcc.

Statistical analysis

Statistical analyses were performed using unpaired Student's t-tests or Mann-Whitney U-tests. P-values of <0.05 was considered to indicate a statistically significant difference.

Results

Role of Fra-1 in radioresistance

Surviving fractions of SW620 and SW480 cells were determined after X-ray or C-ion irradiation. Sensitivity to X-ray or C-ion irradiation differed between the cell lines; SW620 showed lower surviving fractions than SW480 at doses greater than 6 Gy for X-ray or 3 Gy for C-ion radiation (Fig. 2). Of note, SW620 cells showed a greater decrease in Fra-1 after 6 Gy for X-ray or 3 Gy for C-ion irradiation than SW480 cells (Fig. 3A and B for X-ray and Fig. 3C and D for C-ion irradiation, respectively).

Figure 2.

Radiosensitivity of SW620 and SW480 cells to X-ray or C-ion irradiation. The clonogenic survival curves of SW620 and SW480 cells after X-ray or C-ion irradiation were determined. Data are presented as the means ± standard deviations of triplicate samples. *P<0.05 vs. SW480.

Figure 3.

Fra-1 expression of SW620 and SW480 cells. Fra-1 expression of non-irradiated cells (No IR) vs. 4 or 6-Gy X-ray-irradiated SW620 (A) or SW480 (B) cells and 2 or 3-Gy C-ion-irradiated SW620 (C) or SW480 (D) cells were determined, respectively. Bands and quantitative densitometric results for Fra-1 protein are shown. n=3, *P<0.05, **P<0.01 vs. No IR.

To investigate a possible association between Fra-1 downregulation and cellular radiosensitivity, we first treated SW480 cells with Fra-1 siRNA. The effectiveness of Fra-1 reduction with siRNA transfection is shown in Fig. 4A. Downregulation of Fra-1 in siRNA-treated SW480 cells showed increased radiosensitivity to 8-Gy X-ray radiation (Fig. 4C) and to 2-, 3-, or 4-Gy C-ion radiation (Fig. 4E), compared with that of the scrambled negative control-treated SW480 cells.

Figure 4.

(A) Fra-1 expression of Fra-1 siRNA vs. scrambled negative control (NC)-transfected SW480 cells. The reduction of Fra-1 levels with siRNA transfection was determined by western blotting. Band and quantitative densitometric results for Fra-1 protein are shown. n=3, *P<0.05 vs. scrambled NC. (B) Fra-1 expression of Fra-1 lentivirus vector vs. NC vector-transfected SW620 cells. The over-expression of Fra-1 levels with lentivirus transfection was determined by western blotting. Band and quantitative densitometric results for Fra-1 protein are shown. n=3, *P<0.05 vs. NC. Role of Fra-1 in the clonogenicity of SW480 and SW620 cells in (C-F). The clonogenicity of Fra-1 siRNA-vs. scrambled negative control (NC)-transfected SW480 cells after X-ray irradiation (C) or C-ion irradiation (E) is shown. The clonogenicity of Fra-1 lentivirus vector- vs. negative control vector (NC)-transfected SW620 cells after X-ray irradiation (D) or C-ion irradiation (F) is shown, n=3. Data are presented as the means ± standard deviations of triplicate samples. *P<0.05, **P<0.01, ***P<0.001 vs. NC.

To further clarify the significance of Fra-1 in radioresistance, we next overexpressed Fra-1 in SW620 cells via transfection with a lentivirus vector. Fra-1 induction with lentivirus transfection is shown in Fig. 4B. Further, overexpression of Fra-1 in lentivirus-transfected SW620 cells tended to increase the resistance to X-ray radiation (Fig. 4D) and significantly enhanced the resistance to C-ion radiation at doses greater than 2 Gy (Fig. 4F). Overall, the results indicate that Fra-1 has some role in radioresistance to X-ray or C-ion radiation for SW480 and SW620 cells.

Fra-1 levels in irradiated SW620 cells were downregulated by protein degradation through a proteasome pathway

To identify the molecular mechanisms modulating Fra-1 levels after irradiation, we first compared the changes of Fra-1 protein and the corresponding FOSL1 transcript levels in SW620 and SW480 cells after X-ray or C-ion irradiation. Although Fra-1 protein levels significantly decreased after irradiation with 6-Gy X-ray or 3-Gy C-ion radiation (Fig. 5A-D), no alteration in the Fra-1 transcript, FOSL1, levels was found for either the SW620 (Fig. 5A and B) or the SW480 cell lines (Fig. 5C and D), which indicates discrepancies between the reduction of Fra-1 protein and transcript levels in the irradiated cells.

Figure 5.

Expression of Fra-1 transcripts in irradiated SW620 or SW480. Expression of Fra-1 transcripts (FOSL1) of X-ray 6 Gy irradiated, or C-ion 3 Gy irradiated, SW620 (A and B) or SW480 (C and D) are shown, n=3, respectively. Data represent the means ± SD values of triplicate samples.

The expression of Fra-1 protein is known to be highly regulated by proteasomal degradation (39). To clarify whether proteasomal degradation was involved in the reduction of the Fra-1 protein levels observed in the irradiated cells, C-ion-irradiated SW620 cells were further studied, because a clear discrepancy between the Fra-1 protein and transcript levels was observed in these cells (Figs. 3C and 5B). Pre-treatment of SW620 cells with the proteasome inhibitor epoxomicin and continued treatment for another 48 h after irradiation (Fig. 6A) blocked the Fra-1 degradation of these irradiated cells compared with that of the non-epoxomicin-treated SW620 cells (Fig. 6B-D). Of note, epoxomicin treatment from 48 h after C-ion irradiation (Fig. 7A) failed to block the reduction of Fra-1 (Fig. 7B-D), which indicates that the degradation of Fra-1 via the proteasome occurred at some time during the first 48 h after irradiation.

Figure 6.

Role of proteasome in Fra-1 degradation in first 48 h post C-ion irradiation. Time course of the epoxomicin treatment of SW620 cells is shown in (A). Fra-1 expression levels in non-irradiated cells (No IR) vs. C-ion 3 Gy irradiated SW620 with or without the epoxomicin treatment were determined by western blotting (B). Quantitative densitometric results for Fra-1 protein without epoxomicin treatment (C) or with epoxomicin treatment (D) are shown, respectively. n=3, *P<0.05 vs. No IR.

Figure 7.

Role of proteasome in Fra-1 degradation from 48 to 72 h post C-ion irradiation. Time course of the epoxomicin treatment of SW620 cells was shown in (A). Fra-1 expression levels in non-irradiated cells (No IR) vs. C-ion 3 Gy irradiated SW620 with or without the epoxomicin treatment were determined by western blotting (B). Quantitative densitometric results for Fra-1 protein without epoxomicin treatment (C) or with epoxomicin treatment (D) are shown, respectively. n=3, **P<0.01 vs. No IR.

Discussion

An understanding of the molecular mechanisms involved in radioresistance is necessary for improving the clinical outcomes of cancer radiotherapy. In this study, we demonstrated that Fra-1 has a significant role in the radioresistance of two colorectal cancer cell lines, SW620 and SW480. It is well known that irradiation, especially high LET radiation such as C-ion irradiation, induces cell cycle delay at the G2 phase, arresting the cells at the G2 checkpoint for DNA repair and/or committing them to undergo apoptosis (40). Cyclin A, an important factor for the initiation of DNA replication, is known as a transcriptional target of Fra-1 (41). Thus, greater reduction of Fra-1 may interrupt DNA repair, which could induce cell death.

Fra-1 is known to be involved in various biological processes (1,2). In order to avoid the potential pathological effects of Fra-1 overexpression, the stability of the Fra-1 protein is highly regulated by phosphorylation-dependent proteasomal degradation (39). Thus, Fra-1 is usually absent in normal epithelial cells, but it is upregulated in several cancers (2). Several studies have suggested that the stability of the Fra-1 protein is regulated by phosphorylation upon ERK-MAPK pathway activation (39,42–44). The upstream signaling effectors, such as proteins encoded by oncogenic KRAS, found in colon carcinoma cell lines have been shown to result in constitutive ERK activation, followed by Fra-1 accumulation (38). To clarify whether Fra-1 phosphorylation status is involved in the Fra-1 degradation of irradiated cells, we also determined whether irradiation reduced the phospho-Fra-1 (p-Fra-1) levels in SW620 cells, as Fra-1 de-phosphorylation causes Fra-1 to become unstable and be degraded via the proteasome. Treatment of irradiated SW620 cells with epoxomicin for 48 h upon irradiation clearly blocked the downregulation of Fra-1 (Fig. 6); therefore, we hypothesized that the remaining undegraded Fra-1 contained many of the dephosphorylated Fra-1 proteins, which were destined to be degraded via the proteasome but remained because we had blocked this proteasome function. However, the levels of p-Fra-1 in the epoxomicin-treated SW620 cells were unchanged even after irradiation; the remaining undegraded Fra-1 following epoxomicin treatment did not contain dephosphorylated Fra-1 proteins, and most of them were phosphorylated Fra-1 (data not shown). These results indicate that the dephosphorylation of Fra-1 is not the trigger of proteasomal degradation upon irradiation. We also intended to check the levels of ubiquitinated Fra-1, but we could not detect the ubiquitination of Fra-1 protein (data not shown). Thus far, we have not yet discovered how irradiation leads to Fra-1 degradation via the proteasome, without the involvement of dephosphorylation or ubiquitination of Fra-1, and further studies are required to solve this question.

In conclusion, we found that Fra-1 has a role in the radioresistance to X-ray or C-ion irradiation. To our knowledge, this is the first study indicating the role of Fra-1 in the radioresistance of colorectal cancer cells. In addition, we observed Fra-1 degradation within 48 h after irradiation. It would be of interest to further study whether Fra-1 level could be a candidate as an early response marker to reflect the effectiveness of radiotherapy.

Acknowledgements

This work was supported in part by JSPS KAKENHI grant no. 22591394 for TI and grant no. 23791467 for MF from the Japan Society for the Promotion of Science. We thank Yoshimi Shoji for technical assistance. We would like to thank Enago (www.enago.jp) for the English language review.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

Fra-1

Fos-related antigen 1

C-ion

carbon ion

RBE

relative biologic effectiveness

HRP

horseradish peroxidase

References

1 

Eferl R and Wagner EF: AP-1: A double-edged sword in tumorigenesis. Nat Rev Cancer. 3:859–868. 2003. View Article : Google Scholar : PubMed/NCBI

2 

Young MR and Colburn NH: Fra-1 a target for cancer prevention or intervention. Gene. 379:1–11. 2006. View Article : Google Scholar : PubMed/NCBI

3 

Hu YC, Lam KY, Law S, Wong J and Srivastava G: Identification of differentially expressed genes in esophageal squamous cell carcinoma (ESCC) by cDNA expression array: Overexpression of Fra-1, Neogenin, Id-1, and CDC25B genes in ESCC. Clin Cancer Res. 7:2213–2221. 2001.PubMed/NCBI

4 

Ramos-Nino ME, Scapoli L, Martinelli M, Land S and Moss-man BT: Microarray analysis and RNA silencing link fra-1 to cd44 and c-met expression in mesothelioma. Cancer Res. 63:3539–3545. 2003.PubMed/NCBI

5 

Hapke S, Kessler H, Luber B, Benge A, Hutzler P, Höfler H, Schmitt M and Reuning U: Ovarian cancer cell proliferation and motility is induced by engagement of integrin alpha(v)beta3/Vitronectin interaction. Biol Chem. 384:1073–1083. 2003. View Article : Google Scholar : PubMed/NCBI

6 

Kustikova O, Kramerov D, Grigorian M, Berezin V, Bock E, Lukanidin E and Tulchinsky E: Fra-1 induces morphological transformation and increases in vitro invasiveness and motility of epithelioid adenocarcinoma cells. Mol Cell Biol. 18:7095–7105. 1998. View Article : Google Scholar : PubMed/NCBI

7 

Diesch J, Sanij E, Gilan O, Love C, Tran H, Fleming NI, Ellul J, Amalia M, Haviv I, Pearson RB, et al: Widespread FRA1-dependent control of mesenchymal transdifferentiation programs in colorectal cancer cells. PLoS One. 9:e889502014. View Article : Google Scholar : PubMed/NCBI

8 

Usui A, Hoshino I, Akutsu Y, Sakata H, Nishimori T, Murakami K, Kano M, Shuto K and Matsubara H: The molecular role of Fra-1 and its prognostic significance in human esophageal squamous cell carcinoma. Cancer. 118:3387–3396. 2012. View Article : Google Scholar : PubMed/NCBI

9 

Zhang W, Hart J, McLeod HL and Wang HL: Differential expression of the AP-1 transcription factor family members in human colorectal epithelial and neuroendocrine neoplasms. Am J Clin Pathol. 124:11–19. 2005. View Article : Google Scholar : PubMed/NCBI

10 

Zerbini LF, Wang Y, Cho JY and Libermann TA: Constitutive activation of nuclear factor kappaB p50/p65 and Fra-1 and JunD is essential for deregulated interleukin 6 expression in prostate cancer. Cancer Res. 63:2206–2215. 2003.PubMed/NCBI

11 

Mann B, Gelos M, Siedow A, Hanski ML, Gratchev A, Ilyas M, Bodmer WF, Moyer MP, Riecken EO, Buhr HJ and Hanski C: Target genes of beta-catenin-T cell-factor/lymphoid-enhancer-factor signaling in human colorectal carcinomas. Proc Natl Acad Sci USA. 96:pp. 1603–1608. 1999; View Article : Google Scholar : PubMed/NCBI

12 

Fung LF, Lo AK, Yuen PW, Liu Y, Wang XH and Tsao SW: Differential gene expression in nasopharyngeal carcinoma cells. Life Sci. 67:923–936. 2000. View Article : Google Scholar : PubMed/NCBI

13 

Belguise K, Kersual N, Galtier F and Chalbos D: FRA-1 expression level regulates proliferation and invasiveness of breast cancer cells. Oncogene. 24:1434–1444. 2005. View Article : Google Scholar : PubMed/NCBI

14 

Siegel RL, Miller KD and Jemal A: Cancer statistics, 2017. CA Cancer J Clin. 67:7–30. 2017. View Article : Google Scholar : PubMed/NCBI

15 

Yamada S, Shinoto M, Endo S, Yasuda S, Imada H, Kamada T and Tsujii H: Carbon ion radiotherapy for patients with locally recurrent cancer. Proceedings of NIRS-IMP Joint Symposium on Carbon Ion Therapy and Radiation Emergency Med. 1–47. 2012.

16 

Lingareddy V, Ahmad NR and Mohiuddin M: Palliative reirradiation for recurrent rectal cancer. Int J Radiat Oncol Biol Phys. 38:785–790. 1997. View Article : Google Scholar : PubMed/NCBI

17 

Tsuji H and Kamada T: A review of update clinical results of carbon ion radiotherapy. Jpan J Clin Oncol. 42:670–685. 2012. View Article : Google Scholar

18 

Fokas E, Kraft G, An H and Engenhart-Cabillic R: Ion beam radiobiology and cancer: Time to update ourselves. Biochim Biophys Acta. 1796:216–229. 2009.PubMed/NCBI

19 

Schulz-Ertner D and Tsujii H: Particle radiation therapy using proton and heavier ion beams. J Clin Oncol. 25:953–964. 2007. View Article : Google Scholar : PubMed/NCBI

20 

Tsuchida Y, Tsuboi K, Ohyama H, Ohno T, Nose T and Ando K: Cell death induced by high-linear-energy transfer carbon beams in human glioblastoma cell lines. Brain Tumor Pathol. 15:71–76. 1998. View Article : Google Scholar : PubMed/NCBI

21 

Nakano T, Suzuki Y, Ohno T, Kato S, Suzuki M, Morita S, Sato S, Oka K and Tsujii H: Carbon beam therapy overcomes the radiation resistance of uterine cervical cancer originating from hypoxia. Clin Cancer Res. 12:2185–2190. 2006. View Article : Google Scholar : PubMed/NCBI

22 

Suzuki M, Kase Y, Yamaguchi H, Kanai T and Ando K: Relative biological effectiveness for cell-killing effect on various human cell lines irradiated with heavy-ion medical accelerator in Chiba (HIMAC) carbon-ion beams. Int J Radiat Oncol Biol Phys. 48:241–250. 2000. View Article : Google Scholar : PubMed/NCBI

23 

Tobias CA, Blakely EA, Alpen EL, Castro JR, Ainsworth EJ, Curtis SB, Ngo FQ, Rodriguez A, Roots RJ, Tenfordf T and Yang TC: Molecular and cellular radiobiology of heavy ions. Int J Radiat Oncol Biol Phys. 8:2109–2120. 1982. View Article : Google Scholar : PubMed/NCBI

24 

Allen C, Borak TB, Tsujii H and Nickoloff JA: Heavy charged particle radiobiology: Using enhanced biological effectiveness and improved beam focusing to advance cancer therapy. Mutat Res. 711:150–157. 2011. View Article : Google Scholar : PubMed/NCBI

25 

Yamada S, Kamada T, Ebner DK, Shinoto M, Terashima K, Isozaki Y, Yasuda S, Makishima H, Tsuji H, Tsujii H, et al: Carbon-ion radiation therapy for pelvic recurrence of rectal cancer. Int J Radiat Oncol Biol Phys. 96:93–101. 2016. View Article : Google Scholar : PubMed/NCBI

26 

Combs SE, Kieser M, Habermehl D, Weitz J, Jäger D, Fossati P, Orrechia R, Engenhart-Cabillic R, Pötter R, Dosanjh M, et al: Phase I/II trial evaluating carbon ion radiotherapy for the treatment of recurrent rectal cancer: The PANDORA-01 trial. BMC Cancer. 12:1372012. View Article : Google Scholar : PubMed/NCBI

27 

Matsuzaki H, Ishihara S, Kawai K, Nishikawa T, Tanaka T, Kiyomatsu T, Hata K, Nozawa H, Yamada S and Watanabe T: Late sacral recurrence of rectal cancer treated by heavy ion radiotherapy: A case report. Surg Case Rep. 2:1092016. View Article : Google Scholar : PubMed/NCBI

28 

Yamada S, Shinoto M, Shigeo Y, Imada H, Kato H, Kamada T and Tsujii H: Current status and perspective of heavy ion beam therapy for patients with pelvic recurrence after primarily resected rectal cancer. Gan To Kagaku Ryoho. 36:1263–1266. 2009.(In Japanese). PubMed/NCBI

29 

Mobaraki A, Ohno T, Yamada S, Sakurai H and Nakano T: Cost-effectiveness of carbon ion radiation therapy for locally recurrent rectal cancer. Cancer Sci. 101:1834–1839. 2010. View Article : Google Scholar : PubMed/NCBI

30 

Habermehl D, Wagner M, Ellerbrock M, Büchler MW, Jäkel O, Debus J and Combs SE: Reirradiation using carbon ions in patients with locally recurrent rectal cancer at HIT: First results. Ann Surg Oncol. 22:2068–2074. 2015. View Article : Google Scholar : PubMed/NCBI

31 

Isozaki Y, Yamada S, Kawashiro S, Yasuda S, Okada N, Ebner D, Tsuji H, Kamada T and Matsubara H: Carbon-ion radiotherapy for isolated para-aortic lymph node recurrence from colorectal cancer. J Surg Oncol. 116:932–938. 2017. View Article : Google Scholar : PubMed/NCBI

32 

Peters LJ, Brock WA, Chapman JD and Wilson G: Predictive assays of tumor radiocurability. Am J Clin Oncol. 11:275–287. 1988. View Article : Google Scholar : PubMed/NCBI

33 

West CM: Invited review: Intrinsic radiosensitivity as a predictor of patient response to radiotherapy. Br J Radiol. 68:827–837. 1995. View Article : Google Scholar : PubMed/NCBI

34 

Ishikawa K, Koyama-Saegusa K, Otsuka Y, Ishikawa A, Kawai S, Yasuda K, Suga T, Michikawa Y, Suzuki M, Iwakawa M and Imai T: Gene expression profile changes correlating with radioresistance in human cell lines. Int J Radiat Oncol Biol Phys. 65:234–245. 2006. View Article : Google Scholar : PubMed/NCBI

35 

Kajanne R, Miettinen P, Tenhunen M and Leppä S: Transcription factor AP-1 promotes growth and radioresistance in prostate cancer cells. Int J Oncol. 35:1175–1182. 2009.PubMed/NCBI

36 

Fujita M, Otsuka Y, Yamada S, Iwakawa M and Imai T: X-ray irradiation and Rho-kinase inhibitor additively induce invasiveness of the cells of the pancreatic cancer line, MIAPaCa-2, which exhibits mesenchymal and amoeboid motility. Cancer Sci. 102:792–798. 2011. View Article : Google Scholar : PubMed/NCBI

37 

Fujita M, Imadome K, Shoji Y, Isozaki T, Endo S, Yamada S and Imai T: Carbon-ion irradiation suppresses migration and invasiveness of human pancreatic carcinoma cells MIAPaCa-2 via Rac1 and RhoA degradation. Int J Radiat Oncol Biol Phys. 93:173–180. 2015. View Article : Google Scholar : PubMed/NCBI

38 

Fujita M, Otsuka Y, Imadome K, Endo S, Yamada S and Imai T: Carbon-ion radiation enhances migration ability and invasiveness of the pancreatic cancer cell, PANC-1, in vitro. Cancer Sci. 103:677–683. 2012. View Article : Google Scholar : PubMed/NCBI

39 

Basbous J, Jariel-Encontre I, Gomard T, Bossis G and Piechaczyk M: Ubiquitin-independent-versus ubiquitin-dependent proteasomal degradation of the c-Fos and Fra-1 transcription factors: Is there a unique answer? Biochimie. 90:296–305. 2008. View Article : Google Scholar : PubMed/NCBI

40 

Sasaki H, Yatagai F, Kanai T, Furusawa Y, Hanaoka F, Zhu WG and Mehnati P: Dependence of induction of interphase death of Chinese hamster ovary cells exposed to accelerated heavy ions on linear energy transfer. Radiat Res. 148:449–454. 1997. View Article : Google Scholar : PubMed/NCBI

41 

Casalino L, Bakiri L, Talotta F, Weitzman JB, Fusco A, Yaniv M and Verde P: Fra-1 promotes growth and survival in RAS-transformed thyroid cells by controlling cyclin A transcription. EMBO J. 26:1878–1890. 2007. View Article : Google Scholar : PubMed/NCBI

42 

Vial E and Marshall CJ: Elevated ERK-MAP kinase activity protects the FOS family member FRA-1 against proteasomal degradation in colon carcinoma cells. J Cell Sci. 116:4957–4963. 2003. View Article : Google Scholar : PubMed/NCBI

43 

Casalino L, De Cesare D and Verde P: Accumulation of Fra-1 in ras-transformed cells depends on both transcriptional autoregulation and MEK-dependent posttranslational stabilization. Mol Cell Biol. 23:4401–4415. 2003. View Article : Google Scholar : PubMed/NCBI

44 

Basbous J, Chalbos D, Hipskind R, Jariel-Encontre I and Piechaczyk M: Ubiquitin-independent proteasomal degradation of Fra-1 is antagonized by Erk1/2 pathway-mediated phosphorylation of a unique C-terminal destabilizer. Mol Cell Biol. 27:3936–3950. 2007. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Endo S, Fujita M, Yamada S, Imadome K, Nakayama F, Isozaki T, Yasuda T, Imai T and Matsubara H: Fra‑1 enhances the radioresistance of colon cancer cells to X‑ray or C‑ion radiation. Oncol Rep 39: 1112-1118, 2018.
APA
Endo, S., Fujita, M., Yamada, S., Imadome, K., Nakayama, F., Isozaki, T. ... Matsubara, H. (2018). Fra‑1 enhances the radioresistance of colon cancer cells to X‑ray or C‑ion radiation. Oncology Reports, 39, 1112-1118. https://doi.org/10.3892/or.2018.6223
MLA
Endo, S., Fujita, M., Yamada, S., Imadome, K., Nakayama, F., Isozaki, T., Yasuda, T., Imai, T., Matsubara, H."Fra‑1 enhances the radioresistance of colon cancer cells to X‑ray or C‑ion radiation". Oncology Reports 39.3 (2018): 1112-1118.
Chicago
Endo, S., Fujita, M., Yamada, S., Imadome, K., Nakayama, F., Isozaki, T., Yasuda, T., Imai, T., Matsubara, H."Fra‑1 enhances the radioresistance of colon cancer cells to X‑ray or C‑ion radiation". Oncology Reports 39, no. 3 (2018): 1112-1118. https://doi.org/10.3892/or.2018.6223
Copy and paste a formatted citation
x
Spandidos Publications style
Endo S, Fujita M, Yamada S, Imadome K, Nakayama F, Isozaki T, Yasuda T, Imai T and Matsubara H: Fra‑1 enhances the radioresistance of colon cancer cells to X‑ray or C‑ion radiation. Oncol Rep 39: 1112-1118, 2018.
APA
Endo, S., Fujita, M., Yamada, S., Imadome, K., Nakayama, F., Isozaki, T. ... Matsubara, H. (2018). Fra‑1 enhances the radioresistance of colon cancer cells to X‑ray or C‑ion radiation. Oncology Reports, 39, 1112-1118. https://doi.org/10.3892/or.2018.6223
MLA
Endo, S., Fujita, M., Yamada, S., Imadome, K., Nakayama, F., Isozaki, T., Yasuda, T., Imai, T., Matsubara, H."Fra‑1 enhances the radioresistance of colon cancer cells to X‑ray or C‑ion radiation". Oncology Reports 39.3 (2018): 1112-1118.
Chicago
Endo, S., Fujita, M., Yamada, S., Imadome, K., Nakayama, F., Isozaki, T., Yasuda, T., Imai, T., Matsubara, H."Fra‑1 enhances the radioresistance of colon cancer cells to X‑ray or C‑ion radiation". Oncology Reports 39, no. 3 (2018): 1112-1118. https://doi.org/10.3892/or.2018.6223
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team