Hsa_circ_0122913 suppresses the proliferation and osteogenic differentiation of bone marrow mesenchymal stem cells and is involved in the effects of icariin treatment via sponging miR‑501‑5p

Introduction

Osteoporosis, which is characterized by low bone mass and microarchitectural deterioration of the bone tissue, is a significant public health issue (1-3). Therefore, it has received extensive attention. With the global trend of population aging, the incidence of osteoporosis is increasing (1,2). The prevalence of osteoporosis in the elderly population in China is ~36% (4). Fractures, which can lead to chronic pain, disability, depression and other associated diseases, are the most serious complication of osteoporosis (3,5). Therefore, identifying novel biomarkers for predicting individuals at risk of osteoporosis is of great importance for the early intervention to prevent fractures.

Human bone metabolism is a complex process that involves bone absorption mediated by osteoclasts and osteoblast-mediated bone formation (6). Bone absorption and formation are stable under physiological conditions. However, disruption of this balance, which can lead to impaired osteoblast and osteoclast activities, can result in osteoporosis (7).

Bone marrow mesenchymal stem cells (BMSCs), which were first isolated from bone marrow and named by Friedenstein et al (8) in 1976, are closely associated with the occurrence and development of osteoporosis. Abnormal BMSC differentiation, proliferation and senescence are the most common causes of osteoporosis (9). BMSCs are normally differentiate into osteoblasts, chondrocytes and adipocytes, while their differentiation can be affected by several factors, including age (10) and intracellular biological factors (11). When only a few BMSCs differentiate into osteoblasts, which in turn results in reduced bone formation, osteoporosis can occur (11,12). Furthermore, it has been reported that BMSC senescence is regulated by several factors, such as DNA damage, oxidative stress and mitogenic signals (13,14). Therefore, emerging evidence has suggested that BMSC senescence plays a significant role in the occurrence of osteoporosis (15,16).

Although circular RNAs (circRNAs/circ) are classified as non-coding RNAs, several of them exert protein-coding potential (17,18). Owing to their loop structure, without 3' and 5' ends, circRNAs are more stable compared with linear RNAs and less prone to degradation by exonucleases (4,19). In addition, previous studies indicated that circRNAs, possessing numerous miRNA binding sites, could act as competing endogenous RNAs (ceRNAs) via sponging microRNAs (miRNAs), thus playing an essential regulatory role in the progression of several diseases, including osteoporosis (19-21). For example, a study revealed that circ_0001052 was involved in the regulation of BMSC differentiation and the pathogenesis of osteoporosis via acting as ceRNA through sponging miR-124-3p (22). In addition, circRNA_0048211 could protect against postmenopausal osteoporosis via targeting miRNA-93-5p (23). Furthermore, an increasing number of evidence has indicated that circRNA-miRNA-mRNA networks serve a regulatory role in osteoporosis (21,23). A previous study from our laboratory demonstrated that hsa_circ_0122913 was upregulated in the peripheral blood of patients with senile osteoporotic vertebral compression fracture (24). However, the effect of hsa_circ_0122913 on the proliferation and osteogenic differentiation of BMSCs has not been previously investigated. Furthermore, a previous study also showed that icariin exerted beneficial effects on the skeletal system in vitro, including the enhancement of the osteogenic differentiation and proliferation of BMSCs (25). However, whether circRNAs are involved in the mechanisms underlying the protective effects of icariin remains elusive. Therefore, the present study aimed to explore the role of hsa_circ_0122913 in the proliferation and osteogenic differentiation of BMSCs, and whether it could be involved in the protective effects of icariin on the skeletal system. Overall, the results of the current study could provide novel insights into the pathophysiological mechanisms underlying the onset of osteoporosis and could potentially pave the way for the development of therapeutic interventions.

Materials and methods

Cell culture and treatment

The human BMSC cell line (cat. no. HUXMA-01001, passage 2 upon receipt) was obtained from Cyagen Biosciences Inc. and cultured in BMSCs growth medium (Cyagen Biosciences, Inc.) at 37˚C in an incubator with 5% CO2. Cells were then treated with 1x10-6 mol/l icariin (Shanghai Yuanye Bio-Technology, Co., Ltd.).

Reverse transcription-quantitative PCR (RT-qPCR)

Following culture and treatment with the indicated compounds, BMSCs were collected, and total RNA was then isolated using the Total RNA Rapid Extraction Kit (cat. no. GK3016; Generay Biotech Co., Ltd.). Subsequently, total RNA was reverse transcribed into cDNA using the HiScript II Q RT SuperMix (cat. no. R222-01; Vazyme Biotech Co., Ltd.) strictly according to the manufacturer's protocols. qPCR was performed using the ChamQ SYBR Color qPCR Master Mix Kit (cat. no. Q411-02; Vazyme Biotech Co., Ltd.) on the CFX Connect Real-Time PCR System (Bio-Rad Laboratories, Inc.). The thermocycling protocol included an initial denaturation step at 95.0˚C for 30 sec followed by 40 cycles consisting of 95.0˚C for 10 sec and 60.0˚C for 30 sec, with a final melt curve analysis performed from 70˚C to 95˚C using 0.5˚C increments and 5-sec holds at each temperature step. The expression levels of target genes were normalized to β-actin as the housekeeping gene, and relative gene expression was calculated using the 2-ΔΔCq method (26). The primer sequences used for PCR are listed in Table I.

Table I Sequences of primers used for reverse transcription-quantitative PCR.

Table I

Sequences of primers used for reverse transcription-quantitative PCR.

Gene name	Primer sequence (5'-3')
Actin	F: TGACGTGGACATCCGCAAAG
	R: CTGGAAGGTGGACAGCGAG
Osteopontin	F: GAAGTTTCGCAGACCTGACAT
	R: GTATGCACCATTCAACTCCTCG
Osterix	F: GTGGAACAGGAGTGGAGCTG
	R: AGGCAGATGGAGAGAGCTGG
Runt-related transcription factor 2	F: CGCCTCACAAACAACCACAG
	R: ACTGCTTGCAGCCTTAAATGAC
Defective in cullin neddylation 1 domain containing 1	F: TGCCTACTGGAACTTAGTGCT
	R: CTGCAATCATCGTACTGAAGTCT

[i] F, forward; R, reverse.

Alizarin red staining

BMSCs at a density of 6x104 cells/well were seeded into 12-well culture plates and cultured for 7 days. Subsequently, the medium was discarded and BMSCs were washed twice with PBS. Cells were then fixed with 2 ml 4% formaldehyde at room temperature for 30 min, followed by washing twice with PBS. Subsequently, BMSCs were stained with alizarin red solution (cat. no. G3280; Beijing Solarbio Science & Technology Co., Ltd.) for 5 min. Following washing with PBS for two times, images of the stained cells were captured under a fluorescent inverted microscope (cat. no. IX73; Olympus Corporation) at a magnification of x200 and a scale bar of 50 µm.

Osteogenic differentiation assay

The differentiation potential of osteocytes was verified using a differentiation assay. Briefly, BMSCs at a density of 6x104 cells/well were seeded into 12-well culture plates and differentiated in osteogenic medium containing alizarin red staining solution (Cyagen Biosciences, Inc.), according to the manufacturer's instructions.

Western blot analysis

Total proteins were extracted from BMSCs using a Cell Lysis Buffer for Western and IP (Beyotime Institute of Biotechnology) supplemented with 1 mM phenyl-methyl-sulfonyl fluoride (Beyotime Institute of Biotechnology). Subsequently, the protein concentration was determined using a bicinchoninic protein assay kit (Beyotime Institute of Biotechnology). The protein extracts were then separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, with 30 µg of protein loaded per lane, followed by transferring onto polyvinylidene fluoride membranes (MilliporeSigma). Following blocking with 5% fat-free milk at room temperature for 1 h, the membranes were incubated with primary antibodies at 4˚C overnight, followed by washing with Tris-buffer saline containing 0.05% Tween-20 (TBST) for three times for 10 min each. Subsequently, the membranes were incubated with the corresponding secondary antibodies at room temperature for 1 h and washed again with TBST. The protein bands were visualized using an enhanced chemiluminescence kit (Beyotime Institute of Biotechnology) and images were captured using an automatic chemiluminescence imaging analysis system (Bio-Rad Laboratories, Inc.). The densitometric analysis of the protein bands was performed using ImageJ software (version 1.4.3.67; National Institutes of Health). The primary antibodies used against defective in cullin neddylation 1 domain containing 1 (DCUN1D1; cat. no. ab181233; 1:5,000), osterix (OSX; cat. no. ab209484; 1:1,000), runt-related transcription factor 2 (Runx2; cat. no. ab236639; 1:1,000) and osteopontin (OPN; cat. no. ab214050; 1:1,000) were all purchased from Abcam. The anti-β-actin primary antibody (cat. no. ab008; 1:5,000) was obtained from Hangzhou MultiSciences (Lianke) Biotech Co., Ltd. The corresponding peroxidase-conjugated secondary antibodies, including goat anti-mouse IgG (cat. no. GAM007, 1:5,000) and goat anti-rabbit IgG (cat. no. GAR0072, 1:5,000), were also obtained from Hangzhou MultiSciences (Lianke) Biotech Co., Ltd.

Annexin V-APC/7-AAD assay

Cell apoptosis was assessed using an Annexin V-APC/7-AAD apoptosis kit [Hangzhou MultiSciences (Lianke) Biotech Co., Ltd.]. Briefly, cells were collected after trypsinization without EDTA at 48 and 72 h, and 7 days of cell proliferation, followed by washing twice with PBS. The cells were resuspended in binding buffer with Annexin V-APC (5 µl/tube) and 7-AAD (10 µl/tube) and incubated in the dark at 4˚C for 5 min. Finally, cells were analyzed using a BD Accuri™ C6 Plus flow cytometer (BD Biosciences) and the corresponding supporting BD Accuri C6 software.

Cell transfection

For silencing experiments, viral particles encompassing short hairpin (sh)RNAs targeting hsa_circ_0122913 and DCUN1D1, and their corresponding negative control (NC) shRNAs were purchased from Hanbio Biotechnology Co., Ltd. For transfection, BMSCs at a density of 4x104 cells/well were seeded into 12-well plates. When the cell confluence reached 50%, the culture medium was replaced with fresh medium containing viral particles at multiplicities of infection (MOI) of 50 or 100. The viral titer for all constructs was 2x108 TU/ml, with volumes of 10 µl (MOI=50) or 20 µl (MOI=100) added per well. Polybrene was included at a 1:1,000 dilution to enhance transduction efficiency. The viral particles were incubated with the cells for 6 h at 37˚C and 5% CO2. Following the incubation, the transfection medium was replaced with fresh complete culture medium and the cells were cultured for 48 h before collection for further analysis. The shRNA sequences are listed in Table II.

Table II Sequences of shRNAs.

Table II

Sequences of shRNAs.

Name of shRNA	Strand (5'-3')
DCUN1D1	Sense: GATCCGTACGATGATTGCAGATGACTCGAGTCATCTGCAATCATCGTACTTTTTTG
	Antisense: AATTCAAAAAAGTACGATGATTGCAGATGACTCGAGTCATCTGCAATCATC GTACG
hsa_circ-0122913	Sense: GATCCGATGAAGAAGAACAAGTTGCTCGAGCAACTTGTTCTTCTTCATCTTTTTTG
	Antisense: AATTCAAAAAAGATGAAGAAGAACAAGTTGCTCGAGCAACTTGTTCTTCTTCATCG
Negative control	Sense: GATCCGTTCTCCGAACGTGTCACGTAATTCAAGAGATTACGTGACACGTTCGGAGAATTTTTTC
	Antisense: AATTGAAAAAATTCTCCGAACGTGTCACGTAATCTCTTGAATTACGTGACACGTTCGGAGAACG

[i] shRNA, short hairpin RNA; DCUN1D1, defective in cullin neddylation 1 domain containing 1.

Cell counting kit 8 (CCK-8) assay

The cultured BMSCs were reaped and seeded into 96-well plates (density, 8x103 cells/well), followed by incubation in an incubator at 37˚C with 5% CO2. Cell proliferation at 24, 48 and 72 h, as well as 7 days after treatment was assessed using a CCK-8 Assay kit [Hangzhou MultiSciences (Lianke) Biotech Co., Ltd.]. Briefly, after removing the supernatants, each well was supplemented with 10 µl CCK-8 solution and cells were incubated at 37˚C in the dark for 1 h. The absorbance in each well at wavelengths of 450 and 650 nm was measured using a microplate reader (SpectraMAX Plus; Molecular Devices, LLC.).

Dual-luciferase reporter assay

Bioinformatics analysis using the CircBank database (http://www.circbank.cn/) was carried out to predict whether hsa_circ_0122913 could encompass a biding site for microRNA (miR)-501-5p. MiR-501-5p mimic and the corresponding NC mimic were synthesized by Guangzhou RiboBio Co., Ltd. The sense sequence of the miR-501-5p mimic is: 5'-AAUCCUUUGUCCCUGGGUGAGA-3' and the antisense sequence is: 5'-UCUACCCAGGGACAAAGGAUU-3'. The sense sequence of the NC mimic is: 5'-UUUGUACUACACAAAAGUACUG-3', and the antisense sequence is: 5'-AAACAUGAUGUGUUUUCAUGAC-3'. The reporter plasmids used in the experiment were the pmirGLO-hsa-circ-0122913-WT and pmirGLO-hsa-circ-0122913-MUT plasmids, synthesized by Beijing Tsingke Biotech Co., Ltd. For the transfection experiments, 293T cells, which were obtained from Chinese National Collection of Authenticated Cell Cultures, at ~80% confluency in 24-well plates were co-transfected with 20 pmol of miRNA mimics and 500 ng of reporter plasmids using Lipofectamine 3000 transfection reagent (cat. no. L3000150; Thermo Fisher Scientific, Inc.). The interaction between miR-501-5p and hsa_circ_0122913 was verified using the Dual-Luciferase Reporter Assay System (Promega Corporation), with Firefly luciferase activity normalized to Renilla luciferase activity, according to the manufacturer's instructions.

Statistical analysis

All quantitative data were obtained from at least three biological replicates and are expressed as the mean ± standard deviation. All analyses were performed using GraphPad Prism 9.0 (GraphPad Software, Inc.; Dotmatics). For comparisons between two groups, independent unpaired t-tests were used. For multiple group comparisons, one-way ANOVA was performed, followed by Tukey's post-hoc test for pairwise comparisons. P<0.05 was considered to indicate a statistically significant difference.

Results

Hsa_circ_0122913 suppresses the proliferation and osteogenic differentiation of BMSCs in vitro

To investigate the effect of hsa_circ_0122913 on the proliferation and osteogenic differentiation of BMSCs, hsa_circ_0122913 was silenced in BMSCs using the corresponding shRNAs. Therefore, the RT-qPCR results showed that sh-circ_0122913-1 significantly decreased the expression levels of hsa_circ_0122913 in BMSCs. Therefore, hsa_circ_0122913-sh1 was used in the subsequent experiments (Fig. 1A). Additionally, CCK-8 assays (Fig. 1B) and flow cytometric analysis (Figs. 1C and S1) demonstrated that hsa_circ_0122913 silencing improved the viability and reduced the apoptosis of BMSCs at 72 h and 7 days compared with the NC group. However, no difference was observed at 48 h. Furthermore, the role of hsa_circ_0122913 in the osteogenic differentiation of BMSCs was assessed using alizarin red S staining, RT-qPCR and western blot analysis. Alizarin staining demonstrated that hsa_circ_0122913 knockdown could significantly enhance the osteogenic differentiation ability of BMSCs on day 7 compared with the control group (Fig. 1D). In addition, the RT-qPCR and western blot results revealed that hsa_circ_0122913 silencing could increase the expression levels of several significant osteoblast differentiation-related markers, including those of OSX, RUNX2 and OPN, at both the mRNA and protein levels (Fig. 1E and F).

Figure 1 Hsa_circ_0122913 suppresses the proliferation and osteogenic differentiation of BMSCs in vitro. (A) The expression of knocked down hsa_circ_0122913 in BMSCs determined by RT-qPCR. (B) The cell viability of hsa_circ_0122913 knocking-down in BMSCs after 48 h, 72 h and 7 d determined by Cell Counting Kit-8 assay. (C) The apoptotic rate of hsa_circ_0122913 knocking-down in BMSCs group after 48, 72 h and 7 d determined by flow cytometric analysis. (D) The osteogenic differentiation ability after 7 days of osteogenic induction detected by alizarin staining. (E) The mRNA expression of OSX, RUNX2 and OPN in BMSCs after knockdown of hsa_circ_0122913 detected by RT-qPCR. (F) The protein expression of OSX, RUNX2 and OPN in BMSCs after knockdown of hsa_circ_0122913 detected by western blot analysis. *P<0.05, **P<0.01 and ***P<0.001 vs. NC. BMSCs, bone marrow mesenchymal stem cells; RT-qPCR, reverse transcription-quantitative PCR; OSX, osterix; RUNX2, runt-related transcription factor 2; OPN, osteopontin; NC, negative control.

Hsa_circ_0122913 acts a ceRNA for miR-501-5p

The aforementioned results suggested that hsa_circ_0122913 could play a key role in the occurrence and development of osteoporosis. Therefore, it was hypothesized that hsa_circ_0122913 could regulate the expression levels of miRNAs via a ceRNA network. Bioinformatics analysis predicted that hsa_circ_0122913 encompassed a binding site for miR-501-5p (Fig. 2A). Subsequently, a dual-luciferase reporter assay was carried out to verify whether hsa_circ_0122913 could sponge miR-501-5p. Therefore, wild-type (WT) and binding motif-mutant (MUT) luciferase reporter plasmids were constructed, namely hsa_circ_0122913-WT/MUT. Then, BMSCs were co-transfected with miR-501-5p mimic and hsa_circ_0122913-WT/MUT plasmids. The results indicated that compared with the vector control group, the luciferase activity was reduced upon co-transfection of the miR-501-5p mimic. However, transfection of the miR-501-5p mimic had no effect on the luciferase activity of hsa_circ_0122913-MUT, thus indicating that hsa_circ_0122913 could sponge miR-501-5p (Fig. 2B).

Figure 2 Hsa_circ_0122913 is a competing endogenous RNA for miR-501-5p. (A) The binding sites between hsa_circ_0122913 and miR-501-5p analyzed by circBANK database. (B) The target relationship of hsa_circ_0122913 and miR-501-5p indicated by dual-luciferase reporter assay. **P<0.01 vs. NC. miR, microRNA; NC, negative control; NS, not significant; WT, wild-type; MUT, mutant.

Icariin treatment and DCUN1D1 knockdown can promote the proliferation and osteogenic differentiation of BMSCs in vitro

Bioinformatics analysis using the CircBank database predicted that DCUN1D1 could be a host gene of hsa_circ_0122913. Therefore, shRNAs were used to knockdown DCUN1D1 in BMSCs and the RT-qPCR results showed that DCUN1D1 expression was most significantly decreased in BMSCs transfected with DCUN1D1-sh1 (Fig. 3A). Therefore, this construct was used for DCUN1D1 knockdown in subsequent experiments. The CCK-8 assay results demonstrated that both hsa_circ_0122913 and DCUN1D1 knockdown increased cell viability compared with NC controls, with non-significant effects at 24 h, but statistically significant enhancement at 48 h and 7 days. Similarly, icariin treatment showed a progressive improvement in viability compared with mock controls, with marked increases observed at 48 h and 7 days (Fig. 3B). Furthermore, the alizarin red staining results showed that hsa_circ_0122913 and DCUN1D1 silencing promoted the osteogenic differentiation of BMSCs to a similar extent as icariin treatment (Fig. 3C).

Figure 3 Icariin treatment and DCUN1D1 knockdown could also promote the proliferation and osteogenic differentiation of BMSCs in vitro. (A) The expression of DCUN1D1 knocked down in BMSCs determined by reverse transcription-quantitative PCR. (B) The cell viability of hsa_circ_0122913 and DCUN1D1 knocked down in BMSCs and icariin treatment at 24 h, 48 h and 7 days determined by Cell Counting Kit-8 assay. (C) The osteogenic differentiation ability after three weeks of osteogenic induction detected by alizarin staining. *P<0.05, **P<0.01 and ****P<0.0001 vs. NC; #P<0.05 and ####P<0.0001 vs. mock. DCUN1D1, defective in cullin neddylation 1 domain containing 1; BMSCs, bone marrow mesenchymal stem cells; NC, negative control; sh-, short hairpin.

Hsa_circ_0122913/DCUN1D1 axis is involved in the effects of icariin treatment on BMSCs

The aforementioned results suggested that the effects of icariin on the proliferation and differentiation ability of BMSCs were similar to those observed in circ_0122913- or DCUN1D1-depleted BMSCs. However, no association between icariin and the hsa_circ_0122913/DCUN1D1 pathway was obtained. Therefore, RT-qPCR and western blot analyses were performed to verify that icariin could suppress the mRNA expression levels of hsa_circ_0122913 (Fig. 4A) and those of DCUN1D1 at both the mRNA and protein levels (Fig. 4B and C). Furthermore, hsa_circ_0122913 knockdown significantly decreased the mRNA and protein expression levels of DCUN1D1 in BMSCs (Fig. 4B and C). However, DCUN1D1 silencing had no effect on the expression levels of hsa_circ_0122913 (Fig. 4A).

Figure 4 Hsa_circ_0122913/DCUN1D1 axis might participate in the effect of icariin treatment on bone marrow mesenchymal stem cells. (A) The mRNA level of hsa_circ_0122913 after knockdown of hsa_circ_0122913 and DCUN1D1 and treated with icariin. (B) The mRNA level of DCUN1D1 after knockdown of hsa_circ_0122913 and DCUN1D1 and treated with icariin. (C) The protein level of DCUN1D1 after knockdown of hsa_circ_0122913 and DCUN1D1 and treated with icariin. ***P<0.001 and ****P<0.0001 vs. NC; ##P<0.01, ###P<0.001 and ####P<0.0001 vs. mock. DCUN1D1, defective in cullin neddylation 1 domain containing 1; NC, negative control; sh-, short hairpin.

Discussion

CircRNAs are a relatively new class of non-coding RNAs that play significant roles in several biological processes. Therefore, circRNAs are considered as potential therapeutic biomarkers in various diseases (27,28), such as cancer (29), Crohn's disease (30), cardiovascular diseases (31) and renal diseases (32). The present study mainly focused on the effects of hsa_circ_0122913 on the proliferation and osteogenic differentiation capacities of BMSCs, since this circRNA was found to be upregulated in patients with senile osteoporotic vertebral compression fracture (24). The results showed that hsa_circ_0122913 could reduce the viability and osteogenic differentiation ability of BMSCs in vitro. Consistent with previous studies, the aforementioned finding suggested that hsa_circ_0122913 was closely associated with the occurrence and development of osteoporosis.

CeRNA networks, where competitive non-coding RNAs and miRNAs regulate target gene expression, are considered as a typical mechanism of action of non-coding RNAs (28). A previous study predicted the top five miRNAs that could regulate hsa_circ_0122913, including miR-501-5p (24). Other studies demonstrated that miR-501-5p could play a significant regulatory role in several types of cancer, such as neck squamous cell carcinoma (33) and hepatocellular carcinoma (34). However, its role in osteogenic differentiation has not been previously investigated. In the present study, the results indicated that hsa_circ_0122913 could act as a sponge for miR-501-5p. However, how this ceRNA network acts in BMSCs remains poorly understood and requires further investigation.

The regulation of circRNA expression and its interplay with host genes is complex and depending on context. Indeed, emerging evidence suggests that circRNAs can regulate the expression of host genes (35). For instance, knockdown experiments targeting circRNAs such as circAMOTL1(36) and circ-ENO1(37) have demonstrated lower expression levels of their respective host genes, paralleling our observation that the knockdown of hsa_circ_0122913 coincided with a downregulation of the host gene DCUN1D1. However, it is crucial to recognize that circRNA expression can be influenced by various factors, including cell type and tissue specificity. In some cases, circRNA expression may not directly correlate with the expression levels of the linear host gene, as supported by previous research (38,39). This is consistent with our results, where the expression level of hsa_circ_0122913 was not significantly affected by DCUN1D1 knockdown.

Furthermore, DCUN1D1 knockdown and icariin treatment were found to enhance the viability and osteogenic differentiation potential of BMSCs. Additionally, the RT-qPCR and western blot analysis results showed that icariin treatment could regulate the expression of hsa_circ_0122913 and DCUN1D1, thus indicating that the hsa_circ_0122913/DCUN1D1 axis could be involved in the effect of icariin treatment on BMSCs. Previous studies demonstrated that DCUN1D1 could serve a key role in tumor progression (40,41), and was involved in several biological functions, including activation of matrix metalloproteinase 2(42), regulation of CD8+ T-cell infiltration and depigmentation (43). Notably, Shao et al (44) found that DCUN1D1 may be one of the genes regulated by upregulated miRNAs in osteoporosis. Combining the aforementioned previous findings with those of the current study, it was hypothesized that the hsa_circ_0122913/DCUN1D1 signaling pathway could play a significant role in the occurrence and development of osteoporosis.

Although the results of the present study could be helpful in the investigation of the molecular mechanisms associated with osteoporosis, the present study has some limitations. Firstly, while the experimental design used in previous studies was referenced (45,46), where scrambled shRNA was used as a negative control, it is acknowledged that the inclusion of both blank and positive controls will be essential in future, as well as more in-depth studies to strengthen the experimental design and enhance the reliability of the results. Secondly, more studies are needed on ceRNA networks to fully explain how hsa_circ_0122913 could regulate the proliferation and differentiation of BMSCs. Lastly, although the results demonstrated that icariin could regulate the expression of hsa_circ_0122913 and DCUN1D1, more studies are needed to uncover the association between the underlying molecular mechanisms of icariin and those of the hsa_circ_0122913/DCUN1D1 axis.

In conclusion, the results of the current study showed that hsa_circ_0122913 could suppress the proliferation and osteogenic differentiation of BMSCs via sponging miR-501-5p. Furthermore, hsa_circ_0122913 and DCUN1D1 could be involved in icariin-regulated biological events in BMSCs. Overall, the aforementioned results could provide novel insights into the development of new therapies for osteoporosis.

Supplementary Material

Flow cytometric analysis of apoptosis in the hsa_circ_0122913-knockdown BMSC group at 48, 72 h and 7 days. BMSC, bone marrow mesenchymal stem cell.

Acknowledgements

Not applicable.

Funding

Funding: The present study was supported by major scientific and technological plan projects for social development in Xiaoshan (grant nos. 2019212 and 2020304) and Zhejiang Traditional Chinese medicine science and technology project (grant no. 2024ZL801).

Availability of data and materials

The data generated in the present study may be requested from the corresponding author.

Authors' contributions

HH designed the study. YW, ML and CL performed the experiments and analyzed the results. YW and ML confirm the authenticity of all the raw data. YW and HH wrote the manuscript. All authors read and approved the final version of the manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References