International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Overweight and obesity have become serious global problems in recent years, with a recent report estimating that 1.5 billion adults worldwide are overweight, among whom over 200 million men and almost 300 million women are obese (1). Overweight and obesity were once considered problems associated with high-income nations, but their incidence is now increasing in low and middle-income countries, a trend that is attributed to chronic alcoholism, food overconsumption and sedentary lifestyle. Overweight and obese individuals face the risk of numerous chronic diseases, including heart disease, diabetes and some types of cancer, as well as psychological and social problems.
Overweight and obesity, as well as the noncommunicable diseases associated with their development, are largely preventable. Several steps can be taken not only at the individual and societal levels but also at the molecular level to prevent and treat overweight and obesity. At the individual level, individuals are able to limit their consumption of fat and sugar, increase their consumption of fruits and vegetables, and engage in regular physical activity. At the societal level, governments and the food industry can promote healthy diets. At the molecular level, researchers identify and/or develop agents that prevent or treat obesity. A recent research focus has been the development of anti-obesity agents derived from natural products, a process that has several safety and economic advantages over the development of pharmaceuticals via years of investment in drug development. Such research has been bolstered by recent reports that traditional herbal extracts have been found effective in reducing body weight in vivo (2,3).
Among these extracts, the dried aromatic flower buds of Syzygium aromaticum (L.) Merr. & Perry (family Myrtaceae), commonly known as cloves, have been reported to be useful in treating dental pain, headache and respiratory disorders in Asian countries (4). Phytochemical studies indicate that eugenol, a member of the phenylpropanoid class of chemical compounds, and its derivatives are responsible for the unique aroma of S. aromaticum, and it has been found to have antimicrobial, insecticidal, antioxidant, antitumor, anti-inflammatory and anaesthetic properties (5–10). In spite of these findings and reports of its utility in several medicinal applications, S. aromaticum has not been investigated for its potential as an anti-obesity agent or food additive. Therefore, the present study investigated the effect of S. aromaticum ethanol extract (SAE) on a mouse model in which obesity had been induced by administering a high-fat diet (HFD).
Anti-PPARγ (sc-7273), SREBP-1 (sc-366) and CD36 (sc-13572) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Antibodies against FAS (#3180), and β-actin (#4967) were purchased from Cell Signaling (Danvers, MA, USA). Insulin (I5500), isobutylmethylxanthine (I7018), dexamethasone (D4902) and Oil Red O (O0625) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Serum and tissue triglyceride (TG), total cholesterol (TC) and high-density lipoprotein-cholesterol (HDL-C) kits were purchased from Wako Chemicals (Osaka, Japan). An insulin ELISA kit was obtained from Shibayagi Co. (Gunma, Tokyo, Japan). A leptin ELISA kit was purchased from R&D Systems (Minneapolis, MN, USA).
Dried flower buds of Syzygium aromaticum were purchased from the Omni Herb Company (Seoul, South Korea) and were extracted three times with 70% ethanol at room temperature overnight. The extracts were combined and concentrated using a rotary evaporator, and freeze-dried under a vacuum and dissolved in dimethyl sulfoxide (DMSO).
The 3T3-L1 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen, Carlsbad, CA, USA) with 1% penicillin-streptomycin and 10% bovine calf serum at 37°C in 5% CO2. The cells were seeded at a density of 4×105 cells/well into a 6-well plate. At 2 days post-confluence (day 0), the cells were exposed to an MDI solution containing 0.5 mM of 3-IBMX, 1 μM of dexamethasone and 1 μg/ml of insulin for 2 days in DMEM with 10% fetal bovine serum (FBS). Following induction, cells were switched to a solution containing DMEM medium supplemented with 1% penicillin-streptomycin, 10% FBS and 167 nm insulin for 2 days. The cells were maintained in a postdifferentiation medium (DMEM containing 1% penicillin-streptomycin and 10% FBS) and changed every 2 days. To examine the effects of SAE on the differentiation of preadipocytes into adipocytes, the cells were treated with various concentrations of SAE at 2 days post confluence (day 0).
For quantification, cells were fixed with 10% neutral formalin for 1 h at room temperature, washed with phosphate-buffered saline (PBS) and then stained for 1 h with 0.5% Oil Red O in 60% isopropanol. After washing with distilled water, the stained cells were observed under a microscope. The stained lipid droplets were then extracted with isopropanol for quantification by measuring its absorbance at 490 nm.
Male C57BL/6J mice aged 4 weeks were obtained from Orient Bio Inc. (Seoul, South Korea) and acclimatized to laboratory conditions consisting of a 12:12-h light-dark cycle, 24°C and 55% humidity for 1 week. At 5 weeks old the mice were then randomly divided into three groups; a group fed the American Institute of Nutrition AIN-76A diet (normal group), a group fed a HFD (HFD group) and a group fed a HFD supplemented with 0.5% (w/w) SAE (HFD + SAE group) for 9 weeks. The experimental diets were prepared by supplementing the basic AIN-76 diet with 20% fat and 0.5% cholesterol (w/w). Body weight and average daily food intake were measured weekly. The care and use of the animals followed our institutional and national guidelines and all experimental procedures were approved by the Korea Food Research Institute Animal Care and Use Committee (KFRI-IACUC, #2010-0011).
At nine weeks after consuming the experimental diets, the mice were subjected to fasting for 12 h and then sacrificed. Blood samples were collected from the abdominal aorta, centrifuged at 1,000 × g for 15 min and stored at −80°C. The measurement of serum TG, TC and HDL-C levels was performed with the appropriate kit. The measurement of serum insulin and leptin concentrations was performed according to the manufacturer’s instructions of the mouse insulin and leptin ELISA kits. Epididymal, perirenal and liver tissues were excised, weighed and stored at −80°C until use. Liver and epididymal fat pads were either fixed in 4% formalin solution and processed for histological examination or snap frozen in liquid nitrogen and stored at −80°C until protein and RNA extraction.
To determine total lipid, TG and TC levels in the liver, the livers of each group were homogenized in 5 ml NaCl. After 20 ml of Folch solution (chloroform:methanol = 2:1) was subsequently added to each homogenate, the resulting solution was incubated at 4°C for 12 h. The samples were centrifuged for 10 min at 1,000 × g before the organic layer was removed and dried using a Speed Vac. The resulting pellet was dissolved in ethyl alcohol containing 25% Triton X-100 and then assayed for TG, TC and HDL-C levels using indicated commercial kits.
The liver and epididymal fat pads were fixed in 4% neutral-buffered formalin, embedded in paraffin, sliced at a thickness of 5 μm and stained with hematoxylin and eosin (H&E) stain. The pathological changes were assessed and photographed under an Olympus BX-51 microscope (Olympus, Tokyo, Japan).
The isolated liver, adipose tissue and cell extracts were prepared in PRO-PREP protein extraction solution (Intron Biotechnology, Gyeonggi, South Korea) using an MP 40 system (MD Biosciences, St. Paul, MN, USA). The extracts were centrifuged at 15,000 rpm for 20 min at 4°C. The supernatants were boiled with a sodium dodecyl sulfate (SDS)-loading buffer, loaded onto Tris-glycine gels, transferred to polyvinylidene fluoride (PVDF) membranes and visualized with a chemiluminescence reagent (Amersham Bioscience, Piscataway, NJ, USA).
Total RNA was isolated from the liver using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. After cDNA was prepared from isolated RNA using a Maxime RT premix (oligo dT primer), the obtained cDNA was used as a template for real-time PCR with the Light Cycler 480 system (Roche, Basel, Switzerland). The specific primers were as follows: Fas sense AGAGATCCCGAGACGCTTCT, antisense GCCTGGTAGGCATTCTGTAGT; Srebp sense GCAGCC ACCATCTAGCCTG, antisense CAGCAGTGAGTCTGCCTT GAT; Pparg sense TCGCTGATGCACTGCCTATG, antisense GAGAGGTCCACAGAGCTGATT; Ppara sense AACATC GAGTGTCGAATATGTGG, antisense AGCCGAATAGTT CGCCGAAAG; and β-actin sense AATACCCCAGCCATG TGTGT, antisense ATGGGCACTGTGTGTGACC. The level of mRNA was expressed as the ratio of signal intensity for each gene relative to β-actin.
Results are expressed as the mean ± SE, and the differences among the three groups were calculated using an analysis of multiple ranges and a one-way variance test using GraphPad Prism4 software (San Diego, CA, USA).
The effect of SAE treatment on lipid metabolism in vitro was examined by investigating its effect on the adipocyte differentiation on 3T3-L1 cells, a well-established preadipocyte cell line used for studying the conversion of preadipocytes into adipocytes. After differentiation with or without SAE, the resulting mass of accumulated intracellular lipid was stained with Oil Red O dye and quantified. As shown in Fig. 1, a dose-dependent reduction in lipid accumulation was observed in the cells treated with SAE, suggesting that SAE inhibits adipocyte transcription factors during adipocyte differentiation.
On the basis of an in vitro study that revealed the inhibition of adipocyte differentiation by SAE treatment, it was hypothesized that SAE may exert anti-obesity effects in vivo. To test this hypothesis, the body weights of the three groups of mice were compared after 9 weeks of feeding. Although no significant difference was observed between the HFD and HFD + SAE groups with respect to daily food intake, the overall body weight, as well as the liver, epididymal and retrorenal fat-pad weights, of the HFD + SAE group were found to have increased to a significantly lesser extent than that of the HFD group (P<0.05; Table I and Fig. 2), suggesting that SAE supplementation had effectively reduced fat accumulation in HFD-fed obese mice.
After 9 weeks of treatment, the TG and TC levels of the HFD + SAE group were found to be significantly lower, 33.4 and 8.8% lower, respectively, than those of the HFD group (Fig. 3A), suggesting that SAE exerts a hypolipidemic effect in HFD-fed mice.
The levels of not only serum glucose and insulin but also of leptin, an adipocyte-derived hormone, of the HFD group were found to be significantly higher than those of the normal group (Fig. 3B) and the HFD + SAE group, suggesting that the increased levels due to HFD feeding had been significantly decreased by SAE supplementation. These findings indicate that lower serum glucose and insulin levels may be due to lower insulin resistance.
SAE supplementation was found to have reduced the size of the epididymal fat pad in HFD-fed mice (Fig. 4A). Investigation of the manner in which SAE supplementation reduces the epididymal fat pad weight revealed that it suppresses the expression of several proteins related to adipogenesis genes, including SREBP-1, PPARγ and FAS (Fig. 4B), indicating that it exerts an anti-obesity effect by inhibiting adipogenesis.
Comparison of the effect of SAE supplementation on the extent of lipid accumulation in the livers of the HFD + SAE and HFD groups via H&E staining indicated reduced white coloring and fewer lipid droplets and uncolored circles in the livers of the HFD + SAE group compared with the HFD group (Fig. 5A). The total lipid, TC and TG levels in the HFD + SAE group were found to have decreased by 45.2, 37.5 and 39.5%, respectively (Fig. 5B). These results suggest that SAE supplementation had attenuated the increase in hepatic TG and TC levels due to HFD feeding.
To further explore the effect of SAE on lipogenesis, the expression of proteins and mRNA involved in lipogenesis, including that of SREBP-1 and its primary lipogenic target enzymes (e.g. FAS), as well that of PPARγ and CD36, was analyzed. The results indicated that HFD feeding of the experimental groups had resulted in significant increases in the hepatic levels of transcriptional factors integral to lipogenesis, including PPARγ, SREBP-1, FAS and CD36 (Fig. 5C). Comparison of these factors in the HFD and HFD + SAE groups indicated that SAE supplementation had reduced their levels in the HFD + SAE group, providing further evidence of the anti-lipogenic effects of SAE. Consistent with the inhibition of PPARγ by SAE supplementation, the supplementation appeared to have also downregulated the mRNA levels of Pparg (Fig. 5D), as well as to have significantly activated Ppara, a regulator of fatty acid β-oxidation. Collectively, these findings indicate that SAE supplementation inhibits the development of HFD-induced fatty liver through regulation of lipogenic genes.
Numerous herbs and spices have been found to reduce blood glucose levels and body weight. Among these herbs, S. aromaticum (family Myrtaceae) is used not only as a culinary supplement in several global cuisines but also as a traditional medicinal aid in the treatment of dental pain, headache and respiratory disorders in several Asian countries. Several studies have reported that S. aromaticum exerts a variety of pharmacological actions, including antioxidant, hypoglycemic and anti-inflammatory activities (7,10,11). However, to the best of our knowledge, no study has examined its action on preventing obesity. Thus, this study and its primary finding that the addition of SAE to the diet reduces body weight in HFD-fed mice, thereby indicating its potential as a natural anti-obesity supplement, are significant contributions to the research and literature in this area.
Adipocyte differentiation of 3T3-L1 preadipocytes has been found to depend on genes involved in the adipogenic pathway during the differentiation process (12). In cultured adipocyte models, SAE has been found to inhibit adipocyte differentiation in 3T3-L1 cells in a dose-dependent manner. Although analysis of the results of the in vitro assay performed in this study did not indicate that SAE supplementation had affected the expression of adipogenesis-related genes, analysis of the western blot results of the in vivo assay revealed that it had strongly suppressed an increase in WAT mass in HFD-fed mice via reduction of PPARγ and SREBP-1 expression. Analysis of these results indicates that SAE supplementation reduces WAT mass via a reduction in adipogenesis, leading to lipid loss, and thus strongly suggests that SAE supplementation prevents HFD-induced lipid accumulation in epididymal adipose tissue through regulation of adipogenesis.
HFD feeding elevates serum leptin and insulin levels, which are associated with energy expenditure, glucose metabolism and fatty acid oxidation (13). SAE supplementation was found to have significantly reduced serum leptin and insulin levels in HFD-fed mice, indicating that SAE improves these HFD-induced metabolic abnormalities. SAE supplementation was also found to have decreased HFD-induced increases in liver weight and hepatic lipid, and TC and TG levels, a finding supported by the results of H&E staining, which indicated that SAE supplementation had reduced hepatic lipid accumulation. Investigation of hepatic expression of the genes regulating lipid metabolism revealed that SAE supplementation had significantly prevented reduction of Ppara and had suppressed the expression of both the lipogenic transcription factor Pparg and lipogenic regulatory proteins, including CD36, SREBP-1, and PPARγ, thereby regulating the expression of genes promoting fatty acid oxidation. These findings suggest that SAE supplementation improves hepatic metabolic parameters via regulation of lipogenesis-related genes in the liver.
While these findings provide evidence that SAE supplementation significantly inhibits obesity in HFD-fed mice, further investigation of the active compounds responsible for anti-obesity effects is required. Kuroda et al recently reported that eugenol derivatives, including dehydrodieugenol and dehydrodieugenol B exert potent hypoglycemic effects via PPARγ activation in diabetic models (11). Contrary to the results of the in vitro assay in this study, Kuroda et al found that these constituents stimulate 3T3-L1 preadipocyte differentiation through PPARγ activation, indicating that unknown compounds in SAE besides dehydrodieugenol and dehydrodieugenol B may inhibit PPARγ activation and exert anti-obesity effects through regulation of adipogenic-related genes.
Collectively, the results of this study provide solid evidence that SAE supplementation exerts an anti-obesity effect on HFD-induced obese mice via regulation of genes related to lipid metabolism in the liver and WAT in a manner that results in the reduction of lipid accumulation. These results strongly support the potential of SAE as an anti-obesity supplement in the regulation of body weight.
This study was supported by the National Platform Technology Project of the Ministry of Knowledge Economy in Korea and the Korea Food Research Institute.
|
World Health Organization: Fact sheet No. 311: obesity and overweight. http://www.who.int/mediacentre/factsheets/fs311/en/index.htmluri. May 2012. | |
|
Hasani-Ranjbar S, Nayebi N, Larijani B and Abdollahi M: A systematic review of the efficacy and safety of herbal medicines used in the treatment of obesity. World J Gastroenterol. 15:3073–3085. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Yin J, Zhang H and Ye J: Traditional Chinese medicine in treatment of metabolic syndrome. Endocr Metab Immune Disord Drug Targets. 8:99–111. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Gurib-Fakim A: Medicinal plants: traditions of yesterday and drugs of tomorrow. Mol Aspects Med. 27:1–93. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Chaieb K, Hajlaoui H, Zmantar T, Kahla-Nakbi AB, Rouabhia M, Mahdouani K and Bakhrouf A: The chemical composition and biological activity of clove essential oil, Eugenia caryophyllata (Syzigium aromaticum L. Myrtaceae): a short review. Phytother Res. 21:501–506. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Das S: Anticancer potential of flavouring agents and their active principles – garlic, saffron, clove. Int J Cancer Prev. 1:89–97. 2004. | |
|
Abdel-Wahhab MA and Aly SE: Antioxidant property of Nigella sativa (black cumin) and Syzygium aromaticum (clove) in rats during aflatoxicosis. J Appl Toxicol. 25:218–223. 2005. | |
|
Fu Y, Zu Y, Chen L, Shi X, Wang Z, Sun S and Efferth T: Antimicrobial activity of clove and rosemary essential oils alone and in combination. Phytother Res. 21:989–994. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Park MJ, Gwak KS, Yang I, Choi WS, Jo HJ, Chang JW, Jeung EB and Choi IG: Antifungal activities of the essential oils in Syzygium aromaticum (L.) Merr. Et Perry and Leptospermum petersonii Bailey and their constituents against various dermatophytes. J Microbiol. 45:460–465. 2007.PubMed/NCBI | |
|
Tanko Y, Mohammed A, Okasha MA, Umar AH and Magaji RA: Anti-nociceptive and anti-inflammatory activities of ethanol extract of Syzygium aromaticum flower bud in Wistar rats and mice. Afr J Tradit Complement Altern Med. 5:209–212. 2008.PubMed/NCBI | |
|
Kuroda M, Mimaki Y, Ohtomo T, Yamada J, Nishiyama T, Mae T, Kishida H and Kawada T: Hypoglycemic effects of clove (Syzygium aromaticum flower buds) on genetically diabetic KK-Ay mice and identification of the active ingredients. J Nat Med. 66:394–399. 2012. | |
|
Madsen L, Petersen RK, Sørensen MB, Jørgensen C, Hallenborg P, Pridal L, Fleckner J, Amri EZ, Krieg P, Furstenberger G, et al: Adipocyte differentiation of 3T3-L1 preadipocytes is dependent on lipoxygenase activity during the initial stages of the differentiation process. Biochem J. 375:539–549. 2003. View Article : Google Scholar : PubMed/NCBI | |
|
Dube MG, Beretta E, Dhillon H, Ueno N, Kalra PS and Kalra SP: Central leptin gene therapy blocks high-fat diet-induced weight gain, hyperleptinemia, and hyperinsulinemia: increase in serum ghrelin levels. Diabetes. 51:1729–1736. 2002. View Article : Google Scholar : PubMed/NCBI |