Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
December 2012 Volume 4 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December 2012 Volume 4 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Tesaglitazar ameliorates non-alcoholic fatty liver disease and atherosclerosis development in diabetic low-density lipoprotein receptor-deficient mice

  • Authors:
    • Bu-Chun Zhang
    • Wei-Ming Li
    • Xian-Kai Li
    • Meng-Yun Zhu
    • Wen‑Liang Che
    • Ya-Wei Xu
  • View Affiliations / Copyright

    Affiliations: Department of Cardiology, Shanghai Tenth People's Hospital, Tongji University School of Medicine, Shanghai 200072, P.R. China
  • Pages: 987-992
    |
    Published online on: September 17, 2012
       https://doi.org/10.3892/etm.2012.713
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Previous research has demonstrated that the dual PPARα/γ agonist tesaglitazar reduces atherosclerosis in a mouse model of hyperlipidemia by reducing both lipid content and inflammation in the aorta. However, much of the underlying mechanism of tesaglitazar in non-alcoholic fatty liver disease (NAFLD) remains less clear. The aim of the present study was to determine whether tesaglitazar attenuates NAFLD and atherosclerosis development in diabetic low-density lipoprotein receptor-deficient (LDLr-/-) mice. Female LDLr-/- mice (3 weeks old) were induced by a high-fat diet (HFD) combined with low-dose streptozotocin (STZ) injection to develop an animal model of type 2 diabetes (T2DM). The mice were randomly divided into two groups: diabetic group (untreated diabetic mice, n=15) and tesaglitazar therapeutic group (n=15, 20 µg/kg/day oral treatment for 6 weeks). Fifteen LDLr-/- mice were fed with an HFD as the control group. Tesaglitazar decreased serum glucose and lipid levels compared with the diabetic mice. Tesaglitazar significantly reduced atherosclerotic lesions, lipid accumulation in the liver, macrophage infiltration, and decreased total hepatic cholesterol and triglyceride content compared to the diabetic mice. In addition, tesaglitazar reduced inflammatory markers at both the serum and mRNA levels. Our data suggest that tesaglitazar may be effective in preventing NAFLD and atherosclerosis in a pre-existing diabetic condition by regulating glucose and lipid metabolism, and the inflammatory response.

Introduction

The prevalence of metabolic syndrome associated with visceral obesity is increasing worldwide, resulting in a high risk of developing complications, such as diabetes and cardiovascular diseases. These pathologies are pathophysiologically associated with atherosclerosis and non-alcoholic fatty liver disease (NAFLD), which exhibit common features such as lipid accumulation and inflammation (1,2). These features develop silently over several years, and are the most common causes of cardiovascular and chronic liver diseases.

Atherosclerosis and NAFLD progression are both accompanied by inflammation development which involves several factors, including various chemokines (monocyte chemoattractant protein 1; MCP-1), cytokines (tumor necrosis factor-α; TNF-α), interleukin-6 (IL-6) and C-reactive protein (CRP) (3–6). NAFLD and atherosclerosis are now recognized as two aspects of a shared disease, involving the local presence of activated macrophages (7). Macrophages are able to accumulate large amounts of lipids, transform into foam cells and drive atherogenesis (8,9). The same process of accumulation of lipid-loaded macrophages was observed in NAFLD, where hyperlipidemic mice demonstrated bloated foamy Kupffer cells (KCs) upon high-fat feeding (10). Consequently, drugs targeting lipid homeostasis and inflammation may have great potential to improve NAFLD and reduce atherosclerosis development.

Peroxisome proliferator-activated receptors (PPARs) are nuclear receptors that control the expression of genes involved in both carbohydrate and lipid metabolism, and could be valuable as additional drug targets (11). PPARα regulates the expression of genes encoding proteins that are involved in lipid metabolism, fatty acid oxidation and glucose homeostasis, thereby improving markers for atherosclerosis and insulin resistance. In addition, PPARα exerts anti-inflammatory effects both in the vascular wall and the liver (12). PPARγ agonists improve insulin sensitivity and induce glycaemic control in diabetic animals as well as in patients with type 2 diabetes (13). Thus, compounds that stimulate both PPARα and PPARγ (dual PPARα/γ agonists) should additively improve both lipid and glucose abnormalities in animal models and human subjects with insulin resistance (IR) and/or type 2 diabetes (T2DM). However, the effects of dual PPARα/γ agonists on NAFLD have not been thoroughly studied.

The aim of the present study was to determine whether dual PPARα/γ agonist tesaglitazar attenuates NAFLD and atherosclerosis development in diabetic low-density lipoprotein receptor-deficient (LDLr−/−) mice. Female LDLr−/− mice were induced by a high-fat diet (HFD) combined with a low-dose STZ injection to develop an animal model of T2DM, and to induce NAFLD and atherosclerotic lesions.

Materials and methods

Generation of the diabetic model and treatment

All animal procedures were performed in compliance with ‘The Guide for the Care of Use of Laboratory Animals’ published by the National Institute of Health (NIH Publication No. 85-23, revised 1996) and approved by the Animal Care Committee of Shanghai Tenth People’s Hospital, Tongji University School of Medicine. The mice were housed five per cage and allowed access to the appropriate diet and autoclaved water.

Three-week-old female LDLr−/− mice with a C57BL/6 genetic background were created by homologous recombination (Jackson Laboratory, Bar Harbor, ME, USA) and were fed an HFD (20% fat, 20% sugar and 1.25% cholesterol). After 6 weeks, the LDLr−/− mice underwent an intraperitoneal glucose tolerance test (IPGTT). Mice exhibiting IR were injected once with low-dose streptozotocin (STZ, 75–80 mg/kg i.p.) to induce partial insulin deficiency. Two weeks after the STZ injection, most HFD/STZ-treated mice displayed hyperglycemia, IR and glucose intolerance, as previously reported (14). At age 11 weeks, animals with similar degrees of hyperglycemia and body weight were randomly divided into untreated (DM, n=15) and tesaglitazar-treated (DM+tesaglitazar, n=15) groups. The mice fed an HFD were used as a nondiabetic control group (n=15). For tesaglitazar treatment, the mice received a daily oral dose of tesaglitazar (20 μg/kg/day). These drugs were dissolved in water and administered by oral gavage. The dose of drug was calculated based on previous studies (15,16). After 6 weeks of treatment, the mice were sacrificed under isoflurane anesthesia, and tissues were removed and frozen immediately in liquid nitrogen or fixed with paraffin. Blood samples were collected from the mice for measurement of serum parameters.

Biochemical studies

Blood samples were collected from mice at the beginning of the experiment, before pharmacological triggering and at the end of the experiment. Fasting serum glucose, total cholesterol (TC), triglyceride (TG) and high-density lipoprotein-cholesterol (HDL-C) were measured using commercial kits (Sigma, St. Louis, MO, USA). Serum MCP-1, TNF-α, IL-6 and CRP were measured using commercial enzyme-linked immunosorbent assay (ELISA) kits purchased from R&D Systems, Inc. (Minneapolis, MN, USA).

Analysis of atherosclerotic lesions

After sacrifice by cervical dislocation, hearts were fixed with 4% phosphate-buffered paraformaldehyde (PAF), and 10-μm aortic sinus sections were cut followed by quantitative analysis of lipid deposition by Oil Red O staining. Aortic sinuses were also stained with rat monoclonal anti-mouse macrophage Mac3 (1:100, BD Biosciences, Heidelberg, Germany), followed by detection with biotinylated secondary antibody and streptavidin-horseradish peroxidase. Images were captured using a JVC 3-charge-coupled device video camera (Sony, Tokyo, Japan) and analyzed using the computer-assisted Quips Image analysis system (Leica Microsystems GmbH, Germany).

Histological analysis of the liver

At sacrifice, livers were perfused with phosphate buffered saline (PBS) solution via the portal vein. After removal of the liver, a section of approximately 4 mm2 was fixed in PAF and embedded in paraffin. Paraffin-embedded sections (5 μm) were stained with hematoxylin and eosin (H&E) to evaluate steatosis and inflammation. Frozen-liver sections (7 μm) were stained with rat monoclonal anti-mouse macrophage F4/80 (1:500, Serotec, Oxford, UK), followed by detection with biotinylated secondary antibody and streptavidin-horseradish peroxidase, to evaluate macrophage infiltration. Analysis of lipid deposition was performed by Oil Red O staining of 7-μm frozen-liver sections, with H&E staining for visualization of the nuclei.

Hepatic lipid analysis

Frozen liver tissue (50 mg) was homogenized in SET buffer (1 ml; sucrose 250 mM, EDTA 2 mM and Tris 10 mM), followed by two freeze-thaw cycles, three cyles through a 27-gauge syringe needle and a final freeze-thaw cycle. TG and TC were measured as described above.

Real-time quantitative reverse transcription-polymerase chain reaction

Total RNA was isolated from mouse livers using the acid guanidinium thiocyanate/phenol/chloroform method. RNA was reverse-transcribed using Moloney murine leukemia virus reverse transcriptase and random hexamer primers (Invitrogen, Carlsbad, CA, USA). mRNA levels were quantified by real-time quantitative PCR on a MX-3000 apparatus (Agilent) using the Brilliant SYBR Green QPCR master mix (Qiagen, Shanghai, China). The following primers were constructed: TNF-α, 5′CGGAGTCCGGGCAGGT3′ (forward) and 5′GCTGGGTAGAGAATGGATGAACA3′ (reverse); MCP-1, 5′CAGCCAGATGCAGTTAACGC3′ (forward) and 5′GCCTACTCATTGGGATCATCTTG3′ (reverse); IL-6, 5′TGAGGAGACTTGCCTG3′ (forward) and 5′ACAACAACAATCTGAGGTGCC3′ (reverse). Individual gene expression was normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression. All quantifications were performed in triplicate samples for three separate experiments.

Statistical analysis

Values are presented as means ± SD unless indicated otherwise. All data analysis was performed with the use of GraphPad PRISM statistical software 5.0 (San Diego, CA, USA). The statistical significance of differences between groups was determined by one-way ANOVA followed by the Dunnett’s multiple comparison test, or Student’s t-test when comparisons were made between 2 groups. P<0.05 was considered to indicate a statistically significant result.

Results

Effect of tesaglitazar on metabolic parameter change

As shown in Table I, at the beginning of the experiment, there was no significant differences in serum TC, TG and glucose levels, and body weight among the three groups of mice. Prior to pharmacological triggering, all diabetic mice had higher serum TC and TG and glucose levels than levels in the control group (P<0.001). The mean body weight was significantly higher for diabetic mice than HFD-fed mice at the age of 17 weeks (P<0.01). After 6 weeks of oral tesaglitazar treatment, serum TC, TG and glucose levels decreased in the diabetic mice (P<0.001). In addition, tesaglitazar treatment led to a significant increase in serum HDL levels in the diabetic mice (P<0.001). However, tesaglitazar treatment caused an increase in body weight (P<0.01).

Table I

Average weights, cholesterol, triglyceride and glucose levels (n=15, mean ± SD).

Table I

Average weights, cholesterol, triglyceride and glucose levels (n=15, mean ± SD).

GroupBody weight (g)Glu (mg/dl)TC (mg/dl)TG (mg/dl)HDL (mg/dl)
Baseline (at age 3 weeks)
  Control22.3±1.4118.7±17487.4±82175.6±34
  Diabetic22.1±1.1114.1±15483.1±90173.2±27
Before intervention (at age 11 weeks)
  Control30.5±1.6124.1±151025.6±74395.6±10
  Diabetic30.9±1.2273.7±84b1351.3±126b816.0±88b
  Tesaglitazar30.7±1.4272.5±791354.7±123814.2±85
After intervention (at age 17 weeks)
  Control39.6±1.2130.5±171323.0±65624.0±30117.2±8
  Diabetic41.2±1.7a300.5±80b2114.3±118b1113.2±58b92.3±6b
  Tesaglitazar43.5±2.1c152.6±23d1478.7±123d715.6±33d105.7±3d

{ label (or @symbol) needed for fn[@id='tfn1-etm-04-06-0987'] } Glu, glucose; TC, total cholesterol; TG, triglyceride; HDL, high-density lipoprotein.

a P<0.01 and

b P<0.001, diabetic group vs. control group;

c P<0.01 and

d P<0.001, diabetic group vs. tesaglitazar group.

Effect of tesaglitazar on serum inflammatory markers

All diabetic mice had higher serum MCP-1, TNF-α, IL-6 and CRP levels than the control group (all P<0.001). As shown in Table II, after 6 weeks of oral tesaglitazar treatment, serum inflammatory marker levels were significantly reduced in diabetic mice (P<0.001, P<0.01, P<0.05).

Table II

Serum inflammatory markers as measured by enzyme-linked immunosorbent assay in mice of the three groups after 6-week intervention (n=15, mean ± SD).

Table II

Serum inflammatory markers as measured by enzyme-linked immunosorbent assay in mice of the three groups after 6-week intervention (n=15, mean ± SD).

GroupsMCP-1 (pg/ml)TNF-α (ng/ml)IL-6 (pg/ml)CRP (μg/ml)
Control87.2±12.32.1±0.6129.6±14.52.1±0.3
Diabetic122.4±23.1b3.4±0.2b205.2±23.7b3.4±0.2b
Tesaglitazar102.7±19.6c2.7±0.4e174.3±26.1d2.0±0.4e

{ label (or @symbol) needed for fn[@id='tfn6-etm-04-06-0987'] } MCP-1, monocyte chemoattractant protein 1; TNF-α, tumor necrosis factor-α; IL-6, interleukin 6; CRP, C-reactive protein.

a P<0.01 and

b P<0.001, diabetic group vs. control group;

c P<0.05,

d P<0.01 and

e P<0.001, diabetic group vs. tesaglitazar group.

Effect of tesaglitazar on atherosclerotic lesions

Oil-red O staining of atherosclerotic plaques was red and widely observed in the diabetic mice. Compared with the size of plaque in the control mice, plaques were increased in the diabetic mice (P<0.01) but significantly diminished in the tesaglitazar-treated diabetic mice (P<0.01; Fig. 1a). Macrophage expression in the atherosclerotic plaques was identified by immunohistochemical staining of Mac3. The Mac3-positive area was larger in the diabetic mice group compared with the tesaglitazar-treated diabetic mice (P<0.01) and control mice groups (P<0.001; Fig. 1b).

Figure 1

Effect of tesaglitazar on atherosclerotic lesion size and macrophage content in diabetic low-density lipoprotein receptor-deficient mice of the control, diabetic and tesaglitazar treatment diabetic groups. (a) Atherosclerotic lesion area was quantified after Oil Red O staining. (b) The macrophage content of atherosclerotic plaques. Original magnification, x40. Data represent the means ± SE (n=9). ###P<0.001, ##P<0.01, diabetic group vs. control group; **P<0.01, diabetic group vs. tesaglitazar group.

Effect of tesaglitazar on NAFLD

To investigate the inhibitory effect of tesaglitazar on NAFLD, we analyzed the histology of liver tissue using H&E staining, Oil-red O staining and F4/80 immunohistochemistry. As shown in Fig. 2a and b, marked microvesicular steatosis accompanied by a partial mild inflammation was observed in diabetic mice. However, the degree of hepatic fat accumulation was substantially alleviated by tesaglitazar treatment and the number of infiltrating macrophages (F4/80-positive cells) was significantly reduced in the tesaglitazar-treated diabetic mice group (P<0.01). In addition, tesaglitazar treatment reduced total hepatic cholesterol and triglyceride content (both P<0.01; Fig. 2c).

Figure 2

Effect of tesaglitazar on non-alcoholic fatty liver disease in diabetic low-density lipoprotein receptor-deficient mice of the control, diabetic and tesaglitazar treatment groups. (a) Hepatic steatosis and degree of inflammation were visualized by hematoxylin and eosin (H&E), Oil-red O staining and F4/80 immunohistochemistry. Original magnification, x200. (b) The number of F4/80-positive cells was quantified. (c) Hepatic lipid profile. TC, total cholesterol; TG, triglyceride. Data represent the means ± SE (n=6). ###P<0.001, ##P<0.01, diabetic group vs. control group; **P<0.01, diabetic group vs. tesaglitazar group.

Effect of tesaglitazar on inflammatory genes in the liver

In comparison with control mice, TNF-α, MCP-1 and IL-6 mRNA expression was significantly increased in the liver of diabetic mice (P<0.01, P<0.001, P<0.001), but this was reduced following 6-week treatment with tesaglitazar (P<0.01, P<0.05; Fig. 3).

Figure 3

Tesaglitazar regulates the expression of inflammation-related genes in the liver, as demonstrated by quantitative real-time PCR analysis. (a) TNF-α, tumor necrosis factor-α. (b) MCP-1, monocyte chemoattractant protein 1. (c) IL-6, interleukin-6. Data represent the means ± SE (n=6). ###P<0.001, ##P<0.01 diabetic group vs. control group; **P<0.01, *P<0.05 diabetic group vs. tesaglitazar group.

Discussion

Ubiquitously expressed, dual PPARα/γ agonists have been implicated in lipid metabolism and energy homeostasis. Previous studies have established that tesaglitazar treatment reduces atherosclerosis in a mouse model of hyperlipidemia by reducing both lipid content and inflammation in the aorta (15,16), yet the details regarding the underlying mechanism of tesaglitazar in NAFLD remain less clear.

To address this issue, we examined the effect of tesaglitazar on HFD-induced hepatic steatosis in diabetic LDLr−/− mice. According to our data, lipid accumulation was significantly reduced by treatment with tesaglitazar when compared with that of the diabetic mice. These data indicate the potential of tesaglitazar as a therapeutic agent for HFD-induced fatty liver.

In the present study, the effects of tesaglitazar on serum lipid concentrations were similar to those in previous studies (15,16), namely TC and TG reduction, and HDL-C increase. Tesaglitazar improved serum glucose disorders observed in this animal model.

NAFLD and atherosclerosis are characterized by lipid accumulation and chronic inflammation (17,18). Numerous studies have reported NAFLD as an important cardiovascular risk factor (19,20), Kleemann et al demonstrated that after 10 weeks of a high cholesterol diet (1% cholesterol), the lesion area in female APOE*3-Leiden (E3L) mice was correlated with plasma levels of serum amyloid A protein (SAA), suggesting that the hepatic inflammatory response is involved in the formation of early atherosclerotic lesions (21). Due to the prominent role of the liver in the uptake of lipids, the hepatic inflammatory response in hyperlipidemic models precedes plaque formation. Increasing evidence suggests a shared metabolic and inflammatory factors associated with macrophage activation in atherosclerosis and NAFLD (22,23) and thereby supports the proposal that NAFLD and atherosclerosis are actually two aspects of the same disease.

As inflammation plays a pivotal role in both atherosclerosis and NAFLD, an important pharmacological objective in both disorders is to target inflammatory activation directly. The role of PPARs as anti-inflammatory mediators has been well-established. In the present study, we demonstrated that dual PPARα/γ agonist tesaglitazar inhibited macrophage infiltration both in the aortic root and in the liver. Our data also demonstrated that treatment with tesaglitazar decreased serum concentrations of MCP-1, TNF-α, IL-6 and CRP. Tesaglitazar also reduced the mRNA levels of TNF-α, MCP-1 and IL-6 in the liver of diabetic mice. These inflammatory markers were previously shown to be involved in the inflammatory cascade, for example, IL-6 is a multifunctional cytokine that plays a critical role in the acute-phase inflammatory response and its expression is known to be stimulated upon TNF-α-mediated activation of NF-κB and promotes the expression of intercellular adhesion molecule 1 (ICAM-1) and CRP synthesis. IL-6 has also been shown to stimulate macrophages to secrete MCP-1 (24).

Due to the complexity of the mechanisms that cause tissue lipid accumulation, we were unable to identify a single major factor or mechanism responsible for the observed inhibitory effect of tesaglitazar on hepatic lipid accumulation in our experiment. There are numerous possible mechanisms that may explain the observed effect of tesaglitazar in the present study and such mechanisms include food intake, energy expenditure, or fat accumulation and expression of fatty acid oxidation enzymes in other tissues. We could not test all the hypotheses and that was the major limitation of the present study. However, our findings suggest that dual PPARα/γ agonist tesaglitazar inhibits the development of NAFLD and atherosclerosis in a diabetic mouse model by regulating glucose and lipid metabolism, and the inflammatory response. Additional studies are required to clarify the mechanisms by which tesaglitazar induces these effects in vitro.

Acknowledgements

This research was supported by the National Natural Science Foundation of China (Grant No. 81200198).

References

1 

Menghini R, Casagrande V, Menini S, et al: TIMP3 overexpression in macrophages protects from insulin resistance, adipose inflammation, and nonalcoholic fatty liver disease in mice. Diabetes. 61:454–462. 2012. View Article : Google Scholar : PubMed/NCBI

2 

Scorletti E, Calder PC, Byrne CD, et al: Non-alcoholic fatty liver disease and cardiovascular risk: metabolic aspects and novel treatments. Endocrine. 40:332–343. 2011. View Article : Google Scholar : PubMed/NCBI

3 

Baeck C, Wehr A, Karlmark KR, et al: Pharmacological inhibition of the chemokine CCL2 (MCP-1) diminishes liver macrophage infiltration and steatohepatitis in chronic hepatic injury. Gut. 61:416–426. 2012. View Article : Google Scholar

4 

Serino M, Menghini R, Fiorentino L, et al: Mice heterozygous for tumor necrosis factor-alpha converting enzyme are protected from obesity-induced insulin resistance and diabetes. Diabetes. 56:2541–2546. 2007. View Article : Google Scholar : PubMed/NCBI

5 

Wunderlich FT, Ströhle P, Könner AC, et al: Interleukin-6 signaling in liver-parenchymal cells suppresses hepatic inflammation and improves systemic insulin action. Cell Metab. 12:237–249. 2010. View Article : Google Scholar

6 

Hanley AJ, Williams K, Festa A, et al: Liver markers and development of the metabolic syndrome: the insulin resistance atherosclerosis study. Diabetes. 54:3140–3147. 2005. View Article : Google Scholar : PubMed/NCBI

7 

Bieghs V, Rensen PC, Hofker MH and Shiri-Sverdlov R: NASH and atherosclerosis are two aspects of a shared disease: central role for macrophages. Atherosclerosis. 220:287–293. 2012. View Article : Google Scholar : PubMed/NCBI

8 

Gui T, Shimokado A, Sun Y, et al: Diverse roles of macrophages in atherosclerosis: from inflammatory biology to biomarker discovery. Mediators Inflamm. 2012:6930832012.PubMed/NCBI

9 

Truman JP, Al Gadban MM, Smith KJ, et al: Differential regulation of acid sphingomyelinase in macrophages stimulated with oxidized low-density lipoprotein (LDL) and oxidized LDL immune complexes: role in phagocytosis and cytokine release. Immunology. 136:30–45. 2012. View Article : Google Scholar : PubMed/NCBI

10 

Wouters K, van Gorp PJ, Bieghs V, et al: Dietary cholesterol, rather than liver steatosis, leads to hepatic inflammation in hyperlipidemic mouse models of nonalcoholic steatohepatitis. Hepatology. 48:474–486. 2008. View Article : Google Scholar

11 

Evans JL, Lin JJ and Goldfine ID: Novel approach to treat insulin resistance, type 2 diabetes, and the metabolic syndrome: simultaneous activation of PPARalpha, PPARgamma, and PPARdelta. Curr Diabetes Rev. 1:299–307. 2005. View Article : Google Scholar

12 

Zandbergen F and Plutzky J: PPARalpha in atherosclerosis and inflammation. Biochim Biophys Acta. 1771:972–982. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Ciudin A, Hernandez C and Simó R: Update on cardiovascular safety of PPARgamma agonists and relevance to medicinal chemistry and clinical pharmacology. Curr Top Med Chem. 12:585–604. 2012. View Article : Google Scholar : PubMed/NCBI

14 

Mu J, Woods J, Zhou YP, et al: Chronic inhibition of dipeptidyl peptidase-4 with a sitagliptin analog preserves pancreatic beta-cell mass and function in a rodent model of type 2 diabetes. Diabetes. 55:1695–1704. 2006. View Article : Google Scholar : PubMed/NCBI

15 

Zadelaar AS, Boesten LS, Jukema JW, et al: Dual PPARalpha/gamma agonist tesaglitazar reduces atherosclerosis in insulin-resistant and hypercholesterolemic ApoE*3Leiden mice. Arterioscler Thromb Vasc Biol. 26:2560–2566. 2006.PubMed/NCBI

16 

Chira EC, McMillen TS, Wang S, et al: Tesaglitazar, a dual peroxisome proliferator-activated receptor alpha/gamma agonist, reduces atherosclerosis in female low density lipoprotein receptor deficient mice. Atherosclerosis. 195:100–109. 2007. View Article : Google Scholar

17 

Ma KL, Ruan XZ, Powis SH, et al: Inflammatory stress exacerbates lipid accumulation in hepatic cells and fatty livers of apolipoprotein E knockout mice. Hepatology. 48:770–781. 2008. View Article : Google Scholar : PubMed/NCBI

18 

Woollard KJ and Geissmann F: Monocytes in atherosclerosis: subsets and functions. Nat Rev Cardiol. 7:77–86. 2010. View Article : Google Scholar : PubMed/NCBI

19 

Targher G, Marra F and Marchesini G: Increased risk of cardiovascular disease in non-alcoholic fatty liver disease: causal effect or epiphenomenon? Diabetologia. 51:1947–1953. 2008. View Article : Google Scholar : PubMed/NCBI

20 

Bhatia LS, Curzen NP, Calder PC and Byrne CD: Non-alcoholic fatty liver disease: a new and important cardiovascular risk factor? Eur Heart J. 33:1190–1200. 2012. View Article : Google Scholar : PubMed/NCBI

21 

Kleemann R, Verschuren L, van Erk MJ, et al: Atherosclerosis and liver inflammation induced by increased dietary cholesterol intake: a combined transcriptomics and metabolomics analysis. Genome Biol. 8:R2002007. View Article : Google Scholar

22 

Maina V, Sutti S, Locatelli I, et al: Bias in macrophage activation pattern influences non-alcoholic steatohepatitis (NASH) in mice. Clin Sci (Lond). 122:545–553. 2012. View Article : Google Scholar : PubMed/NCBI

23 

Lingrel JB, Pilcher-Roberts R, Basford JE, et al: Myeloid-specific Krüppel-like factor 2 inactivation increases macrophage and neutrophil adhesion and promotes atherosclerosis. Circ Res. 110:1294–1302. 2012.

24 

Amar J, Fauvel J, Drouet L, et al: Interleukin 6 is associated with subclinical atherosclerosis: a link with soluble intercellular adhesion molecule 1. J Hypertens. 24:1083–1088. 2006. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhang B, Li W, Li X, Zhu M, Che WL and Xu Y: Tesaglitazar ameliorates non-alcoholic fatty liver disease and atherosclerosis development in diabetic low-density lipoprotein receptor-deficient mice. Exp Ther Med 4: 987-992, 2012.
APA
Zhang, B., Li, W., Li, X., Zhu, M., Che, W., & Xu, Y. (2012). Tesaglitazar ameliorates non-alcoholic fatty liver disease and atherosclerosis development in diabetic low-density lipoprotein receptor-deficient mice. Experimental and Therapeutic Medicine, 4, 987-992. https://doi.org/10.3892/etm.2012.713
MLA
Zhang, B., Li, W., Li, X., Zhu, M., Che, W., Xu, Y."Tesaglitazar ameliorates non-alcoholic fatty liver disease and atherosclerosis development in diabetic low-density lipoprotein receptor-deficient mice". Experimental and Therapeutic Medicine 4.6 (2012): 987-992.
Chicago
Zhang, B., Li, W., Li, X., Zhu, M., Che, W., Xu, Y."Tesaglitazar ameliorates non-alcoholic fatty liver disease and atherosclerosis development in diabetic low-density lipoprotein receptor-deficient mice". Experimental and Therapeutic Medicine 4, no. 6 (2012): 987-992. https://doi.org/10.3892/etm.2012.713
Copy and paste a formatted citation
x
Spandidos Publications style
Zhang B, Li W, Li X, Zhu M, Che WL and Xu Y: Tesaglitazar ameliorates non-alcoholic fatty liver disease and atherosclerosis development in diabetic low-density lipoprotein receptor-deficient mice. Exp Ther Med 4: 987-992, 2012.
APA
Zhang, B., Li, W., Li, X., Zhu, M., Che, W., & Xu, Y. (2012). Tesaglitazar ameliorates non-alcoholic fatty liver disease and atherosclerosis development in diabetic low-density lipoprotein receptor-deficient mice. Experimental and Therapeutic Medicine, 4, 987-992. https://doi.org/10.3892/etm.2012.713
MLA
Zhang, B., Li, W., Li, X., Zhu, M., Che, W., Xu, Y."Tesaglitazar ameliorates non-alcoholic fatty liver disease and atherosclerosis development in diabetic low-density lipoprotein receptor-deficient mice". Experimental and Therapeutic Medicine 4.6 (2012): 987-992.
Chicago
Zhang, B., Li, W., Li, X., Zhu, M., Che, W., Xu, Y."Tesaglitazar ameliorates non-alcoholic fatty liver disease and atherosclerosis development in diabetic low-density lipoprotein receptor-deficient mice". Experimental and Therapeutic Medicine 4, no. 6 (2012): 987-992. https://doi.org/10.3892/etm.2012.713
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team