Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
October-2016 Volume 12 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2016 Volume 12 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Biological significance of PinX1 telomerase inhibitor in esophageal carcinoma treatment

  • Authors:
    • Xiang‑Kui Fan
    • Rui‑Hua Yan
    • Xiang‑Qun Geng
    • Jing‑Shan Li
    • Xiang‑Ming Chen
    • Jian‑Zhe Li
  • View Affiliations / Copyright

    Affiliations: Department of Tumor Surgery, Tai'an Central Hospital, Tai'an, Shandong 271000, P.R. China, Coal Workers' Sanatorium of Taishan, Tai'an, Shandong 271000, P.R. China
  • Pages: 2196-2200
    |
    Published online on: August 1, 2016
       https://doi.org/10.3892/etm.2016.3561
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

In the present study, to investigate the expression of PinX1 gene and its functional effects in human esophageal carcinoma (Eca)-109 cell line, expression vectors of human PinX1 (pEGFP-C3-PinX1) and its small interfering RNA (PinX1‑FAM‑siRNA) were constructed and transfected into Eca‑109 cells using Lipofectamine 2000. Firstly, the mRNA expression level of PinX1 was examined using reverse transcription‑polymerase chain reaction (RT‑PCR). Once successful transfection was achieved, the effects on the mRNA level of human telomerase reverse transcriptase (hTERT), telomerase activity, cell proliferation and apoptosis were examined by semi‑quantitative RT‑PCR, stretch PCR, MTT assay and flow cytometry, respectively. Analysis of restriction and sequencing demonstrated that the recombining plasmids were successfully constructed. The results also indicated that transfection with pEGFP‑C3‑PinX1 and PinX1‑FAM‑siRNA into Eca‑109 cells significantly increased PinX1 mRNA, decreased hTERT mRNA by 29.9% (P<0.05), and significantly reduced telomerase activity (P<0.05), inhibited cell growth, and increased the cell apoptotic index from 19.27±0.76 to 49.73±2%. The transfected PinX1‑FAM‑SiRNA exhibited PinX1 mRNA expression levels that were significantly decreased by 70% (P<0.05), whereas the remaining characteristics of Eca‑109 cells, including cell growth, mRNA level of hTERT, telomerase activity and cell apoptotic index were not altered. Exogenous PinX1 has been demonstrated to be highly expressed in human Eca. PinX1 can inhibit human telomerase activity and the expression of hTERT mRNA, reduce tumor cell growth and induce apoptosis. Notably, these inhibitory functions were inhibited by silencing PinX1 in Eca with PinX1‑FAM‑siRNA. PinX1 was successfully increased and decreased in the present study, demonstrating that it may be a potential telomerase activity inhibitor. As PinX1 is an endogenous telomerase inhibitor, it may be used as a novel tumor-targeted gene therapy.

Introduction

Esophageal carcinoma (Eca) is a recurrent malignant neoplasm that is most common in China, resulting in China having the highest mortality and hospitalization rates for Eca. Eca is complicated by various causes, genes and phases; therefore, the majority of patients are diagnosed during the middle or late stages of the cancer. Furthermore, the prognosis is not promising with a 5-year survival rate of 5–20% (1). Therefore, the mechanism underlying Eca must be explored in order to provide effective treatment. Previous studies have demonstrated that antisense oligodeoxynucleotides are able to inhibit tumor cell growth by inhibiting RNA as well as human telomerase reverse transcriptase (hTERT) (2,3). In Eca, the amount of positive RNA is as high as 90.8%, whereas normal esophagus smooth muscle cells are negative (4). RNA-targeted genetic treatment is a popular novel treatment for Eca. Pin 2/TRF 1 interacting protein 1 (PinX1) has been demonstrated to be a potential endogenous telomerase inhibitor that is able to inhibit the telomerase activity of some cancer cells', resulting in apoptosis (5,6). However, this remains controversial as other studies have reported opposite findings (7,8). PinX1 may function via different mechanisms in different tumors, and the mechanisms underlying the inhibition of the telomerase or RNA are complex. In order to investigate PinX1's inhibiting mechanism in Eca and telomerase activity, expression vectors of human PinX1 (pEGFP-C3-PinX1) and its small interfering RNA (PinX1-FAM-siRNA) were constructed. The present study investigates whether PinX1 may be a potential telomerase activity inhibitor, and whether it can be used as a novel tumor-targeted gene therapy.

Materials and methods

Materials

Austrian newborn cow blood serum was purchased from Weijia Company (Guangzhou, China); Lipofectamine 2000 and all primers (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA); reverse transcription-polymerase chain reaction (RT-PCR) detection kit (Takara Biotechnology Co., Ltd., Dalian, China); Thiazolyl blue tetrazolium bromide for the MTT assay (Sigma-Aldrich St. Louis, MO, USA); telomerase activity detection kit (Toyobo, Co., Ltd., Osaka, Japan).

Cell culture and transfection

Human Eca-109 and human umbilical vein endothelial ECV-304 cells (both 2×104 cells/ml; both purchased from Takara Biotechnology Co., Ltd.) were cultured in RPMI 1640 and Dulbecco's modified Eagle medium (both purchased from HyClone (GE Healthcare Life Sciences, Chalfont, UK) supplemented with 10% newborn calf serum with 5% CO2 at 37.5°C and normal digestive subculture. Expression vectors and siRNA were transfected with Lipofectamine 2000, according to the manufacturer's protocol, and were observed under a fluorescence microscope after 24–48 h.

Plasmid construction and siRNA

pEGFP-C3-PinX 1 and pEGFP-C3 expression vectors were synthesized in vitro by Wuhan Sanying Biotechnology (Wuhan, China) with anti-kanamycin siRNA (PinX1-FAM-siRNA sense, 5′-GUAAAGAUGUGGAAAGUUATT-3′ and antisense, 5′-TTCAUUUCUACACCUUUCAAU-3′), which was used to test PinX1 expression and was composed by Shanghai Gene Pharma Co., Ltd., (Shanghai, China).

Grouping

Groupings were as follows: Group A, pEGFP-C3-PinX1 (transfected vectors with PinX1); group B, pEGFP-C3 (transfected empty vectors without PinX1); group C, Lipofectamine only; group D, control cells (Eca-109 cultured normally with no intervention); group E, PinX1-FAM-siRNA (PinX1-targeted with siRNA).

Semi-quantitative RT-PCR analysis

RT-PCR was used to analyze the expression of PinX1 in Eca-109 cells and the mRNA expression of hTERT. Following transfection for 48 h, total RNA was extracted using TRIzol and reverse transcribed into cDNA using avian myeloblastosis virus RT. According to the manufacturer's protocol for the Takara RT-PCR detection kit (Takara Biotechnology Co., Ltd.), PinX1 mRNA was assessed using the following conditions: 94°C pre-denaturation (2 min), 94°C denaturation (1 min), followed by 25 cycles of 55°C annealing (1 min) and 72°C extension (2 min), and final extension at 72°C for 5 min. hTERT mRNA was assessed using the following conditions: 94°C pre-denaturation (4 min) and 94°C denaturation (30 sec), followed by 30 cycles of 49°C annealing (30 sec) and 72°C extension (45 sec), and final extension at 72°C for 5 min. GAPDH was used as an internal reference for both reactions. PCR products were detected by 1% sepharose electrophoresis and were detected by a UVI Gel Imager. Quantity One software (version 4.62; Bio-Rad Laboratories, Inc., Hercules, CA, USA) was used to analyze the relative gray-scale values of PinX1/GAPDH and hTERT/GAPDH, respectively. Primers are listed in Table I.

Table I.

Primers of Pin 2/TRF 1 interacting protein 1 (PinX1), human telomerase reverse transcriptase (hTERT) and GAPDH for reverse transcription-quantitative polymerase chain reaction analysis.

Table I.

Primers of Pin 2/TRF 1 interacting protein 1 (PinX1), human telomerase reverse transcriptase (hTERT) and GAPDH for reverse transcription-quantitative polymerase chain reaction analysis.

GeneSense (5′-3′)Anti-sense (5′-3′)Product size (bp)
PinX1 TTTTCTCGAGATGTCTATGCTGGCTGAACG TTTTGAATTCTCATTTGGAATCTTTCTTC987
hTERT CCGAGTGACCGTGGTTTCTGTG GGAAGCGGCGTTCGTTGTG670
GAPDH GGAAGATGGTGATGGGATT GGATTTGGTCGTATTGGG205
MTT assay

An MTT assay was used to detect the proliferation of Eca-109 cells, according to the manufacturer's protocol. Eca-109 cells were inoculated in a 96-well plate, transfected and subsequently assessed for their proliferation rates after 0, 24, 48 and 72 h by MTT. Proliferating cells were counted using a light microscope at an absorbance value (OD) of 490 (wavelength, 490 nm), and the growth curve was charted to determined the growth inhibitory rate (IR), as follows: IR = (OD490control group - OD490transfected group)/OD490control group х 100%.

Stretch PCR

Stretch PCR was used to assess telomerase activity. Eca-109 was inoculated in a 96-well plate, transfected and telomerase activity was detected after 48 h by stretch PCR using a TeloChaser kit (Toyobo Co., Ltd.), according to the manufacturer's protocol.

Statistical analysis

Results were analyzed by SPSS 13.0 (SPSS, Inc., Chicago, IL, USA). With the exception of cell proliferation by MTT, which was analyzed by a two-way analysis of variance (ANOVA) followed by Student-Newman-Keuls (SNP) tests, all data were analyzed by one-way ANOVA. Data were presented as the mean ± standard deviation. P<0.05 was considered to indicate a statistically significant difference.

Results

PinX1 mRNA expression levels

RT-PCR analysis demonstrated that there were extended PinX1 fragments in each group. pEGFP-C3-PinX1 significantly increased the expression of PinX1 mRNA in Eca-109 cells by as much as 160% (P<0.05). Following PinX1-FAM-siRNA transfection, the expression levels of PinX1 mRNA decreased by 70%, which effectively silenced the expression of PinX1. No significant differences in PinX1 expression were detected in the pEGFP-C3, Lipofectamine only and control groups (Table II and Fig. 1).

Figure 1.

Expression of Pin 2/TRF 1 interacting protein 1 (PinX1) mRNA was assessed by semi-quantitative reverse transcription-polymerase chain reaction in the (A) pEGFP-C3-PinX1, (B) pEGFP-C3, (C) Lipofectamine 2000 only, (D) control and (E) PinX1-FAM-siRNA groups.

Table II.

Expression of PinX1 mRNA.

Table II.

Expression of PinX1 mRNA.

GroupmRNA
Group A: pEGFP-C3-PinX1 1.599±0.102a
Group B: pEGFP-C3 (transfected empty vectors without PinX1)1.103±0.160
Group C: Lipofectamine only1.041±0.129
Group D: Control cells (Eca-109 cultured normally with no intervention)1.000±0.160
Group E: PinX1-FAM-siRNA (PinX1-targeted with siRNA) 0.303±0.048a

{ label (or @symbol) needed for fn[@id='tfn1-etm-0-0-3561'] } PinX1, Pin 2/TRF 1 interacting protein 1; EGFP, enhanced green fluorescent protein; FAM, PinX1-FAM-siRNA PinX1 gene transfection by small interfering RNA. Data are presented as the mean ± standard deviation (n=3). One-way analysis of variance demonstrated F=39.626, P<0.001. Pair-wise comparison demonstrated

a P<0.001, as compared with Group D.

pEGFP-C3-PinX1 significantly inhibits the proliferation of Eca-109 cells

Two-way ANOVA was used to analyze the proliferation rates of Eca-109 and a significant difference was detected between the groups (F=35.870; P<0.001). SNK analysis demonstrated that OD490 was significantly lower in the pEGFP-C3-PinX1 group (2.15±0.27), as compared with the control group (2.52±0.50; P=0.038), indicating that pEGFP-C3-PinX1 significantly inhibited the proliferation of Eca-109 cells. No significant differences in proliferation were detected between the pEGFP-C3, Lipofectamine and PinX1-FAM-siRNA groups, as compared with the control group cells, which indicated that these three treatments did not alter the proliferation of the Eca-109 cells. Furthermore, the inhibition of proliferation induced by pEGFP-C3-PinX1 was time-dependent between 24 and 48 h (F=437.621; P<0.001), SNK demonstrated the OD490 value increased as the transfection duration increased from 0, 24, 48, 72 to 96 h, indicating that the alteration was time-dependent. Fig. 2 demonstrates the growth curve according to the alterations in OD490 at the various time points, and the inhibition rate of proliferation was calculated. MTT assay demonstrated that pEGFP-C3-PinX1 had a significant inhibitory effect on cell growth, whereas PinX1-FAM-siRNA had no obvious effect on Eca-109.

Figure 2.

Inhibition rate of cell growth, as determined by MTT assay.

hTERT mRNA expression

RT-PCR demonstrated that pEGFP-C3-PinX1 decreased the expression levels of hTERT mRNA by 29.9%, whereas no significant difference in the expression of hTERT mRNA was detected between PinX1-FAM-siRNA, which silenced PinX1, and the control group cells (P=0.757; Fig. 3 and Table III).

Figure 3.

Expression of human telomerase reverse transcriptase (hTERT) mRNA was assessed by semi-quantitative reverse transcription-polymerase chain reaction in the (A) pEGFP-C3-PinX1, (B) pEGFP-C3, (C) Lipofectamine 2000 only, (D) control and (E) PinX1-FAM-siRNA groups.

Table III.

Expression of human telomerase reverse transcriptase mRNA.

Table III.

Expression of human telomerase reverse transcriptase mRNA.

GroupmRNA
Group A: pEGFP-C3-PinX1 0.701±0.088a
Group B: pEGFP-C3 (transfected empty vectors without PinX1)0.928±0.110
Group C: Lipofectamine only0.974±0.048
Group D: Control cells (Eca-109 cultured normally with no intervention)1.000±0.088
Group E: PinX1-FAM-siRNA (PinX1-targeted with siRNA) 1.024±0.145b

{ label (or @symbol) needed for fn[@id='tfn3-etm-0-0-3561'] } PinX1, Pin 2/TRF 1 interacting protein 1; EGFP, enhanced green fluorescent protein; FAM, PinX1-FAM-siRNA PinX1 gene transfection by small interfering RNA. Data are presented as the mean ± standard deviation (n=3). One-way analysis of variance demonstrated F=5.608, P=0.012. Pair-wise comparison demonstrated

a P=0.003

b P=0.007, as compared with Group D.

Telomerase activity

Stretch PCR demonstrated that Eca-109 exhibited strong positive telomerase activity, whereas the ECV-304 cells exhibited weak positive activity. Following transfection, pEGFP-C3-PinX1 was able to reduce the telomerase activity of Eca-109 cells, whereas PinX1-FAM-siRNA exhibited no significant influence on the telomerase activity of Eca-109 cells. Following transfection, pEGFP C3 PinX1 was able to reduce the telomerase activity of Eca 109 cells, whereas PinX1 FAM siRNA exhibited no significant influence on the telomerase activity of Eca 109 cells. The difference between these two groups was significantly different (F=59.436; P<0.001; Fig. 4).

Figure 4.

Telomerase activity, as assessed by stretch polymerase chain reaction in the (A) pEGFP-C3-PinX1, (B) pEGFP-C3, (C) Lipofectamine 2000 only, (D) control and (E) PinX1-FAM-siRNA groups. ECV-304 cells showed weak positive telomerase activity, whereas Eca-109 exhibited strong positive activity. These findings indicated that pEGFP-C3-PinX1 successfully inhibited telomerase activity, whereas the PinX1-FAM-siRNA, Lipofectamine 2000 only and pEGFP-C3 treatments did not alter telomerase activity.

Discussion

Eca is a type of malignant neoplasm of esophagus epithelial tissue, which is associated with a high risk (8th in the world) and mortality rate (6th in the world), as 410,000 individuals succumb to the disease each year. Eca is widespread in undeveloped countries and China is a particularly highly Eca-striken area with the highest incidence and mortality rates in the world, accounting for ~210,000 Chinese lives each year. The current therapeutic strategy was not particularly effective and patients were unlikely to live longer than 5 years (1). Therefore, studies in this field have focused on the mechanism underlying Eca and the discovery of molecule-targeted treatment. In the 1990s, in vitro research demonstrated that the proliferation of these cells was due to telomerase activity and one of tumor cells' chief characteristics was infinite proliferation (2). This finding signaled a new era for the study of the mechanisms underlying tumor cell molecules. Since telomerase has become a novel target for anti-tumor treatment, it is important to conduct further research into the control of telomerase and better cultivate its clinical value.

PinX1 is one of various conservative nucleoprotein discovered in human and yeast cells which may affect telomerase. Human PinX1 is located in chromosome 8p23, where the loss of heterozygosity often occurs in various types of cancer. Banik et al (9) analyzed the relationship among PinX1, hTERT and hTR and indicated that PinX1 was directly associated with hTERT and hTR. Furthermore, it was demonstrated that the co-work of PinX1 and hTR relied on hTERT, since PinX1 inhibition of telomerase activity was dependent upon the combination of hTERT and hTR. Chen et al (10) discovered that the mechanism of PinX1 was complex; indicating that its fragments worked respectively with Pin2/TRF1 and hTERT, LPTS/PinX1 (254–289) combined with Pin2/RF1, and in vitro LPTS/PinX1 (290–328) exhibited strong inhibition of telomerase activity and was able to shorten the telomerase to induce apoptosis. PinX1 is composed of 328 amino acids (aa), with a hTERT bonding site at both the N- (aa, 1–142) and C-terminals (aa 254–328), whereas the highly expressive PinX1 C fragment was able to greatly decrease telomerase activity, shorten and inhibit the growth of positive telomerase cancer cells, although it could not affect the length of negative telomerase cells (11,12). Therefore, PinX1 is considered to be an effective anti-cancer gene or cancer inhibitor. In some types of cancer, such as stomach and liver cancer, studies have also demonstrated that PinX1 is able to inhibit the telomerase activity of cancer cells and induce their apoptosis (4,5). However, Sun et al (13) discovered that during the differentiation of emergent acute promyelocytic leukemia, the expression of PinX1mRNA was accordant with the telomerase activity, therefore it was concluded that the expression of PinX1 was just a reaction following the expression of hTERT, aimed at maintaining stable telomerase activity. Another hypothesis proposed that in prostatic carcinoma (14), gastrointestinal carcinoma (15) and medulloblastoma (16), the expression of PinX1 had no association with telomerase activity and was not the key inhibiting factor on telomerase activity, rather just one phenomenon of the gene's varied states. Progress has been made in the elucidation of the dynamics of PinX1 function. Yuan et al (17) discovered that PinX1 settles in the nucleus and telomerase and would attach around chromosomes and the outside plate of the kinetochore during mitosis, during which period siRNA could be used to inhibit PinX1 and the chromosome would lose the ability to split correctly. This finding indicated that PinX1 has an important role in mitosis. Furthermore, Li et al (18) have demonstrated that, during the mitotic period, nucleolin aided the transport of PinX1 around the chromosome and enhanced the composition of the middle plate. All these studies suggested that PinX1 functions differently in various types of cancer and thus has different regulations and mechanisms. Until now, there was no unanimous hypothesis about the function of PinX1, and its underlying mechanism requires further investigation.

During the present study, an expression vector (pEGFP-C3-PinX1) and an altered RNA (PinX1-FAM-siRNA) targeted at PinX1 were successfully constructed. Following transfection of Eca-109 cells, RT-PCR was used to detect PinX1 mRNA expression levels. It was demonstrated that pEGFP-C3-PinX1 increased PinX1 mRNA expression by 160%, whereas PinX1-FAM-siRNA decreased PinX1 mRNA expression by 70%, which indicated that the present model of upregulation and silencing of PinX1 expression was successful, facilitating the further study of the function of PinX1 in Eca cells. The results showed that, following pEGFP-C3-PinX1 transfection of the Eca cells, both hTERT mRNA and telomerase activity were significantly inhibited (compared with the untransfected), resulting in the inhibition of the proliferation of Eca-109 cells. Following PinX1-FAM-siRNA silencing of PinX1, the telomerase activity and proliferation of the Eca-109 cells exhibited no alteration, this may be because the inhibiting function of PinX1 was hindered. It is possible that the endogenous PinX1 of Eca cells was very low or completely lacking, therefore even siRNA silencing was unable to have a marked influence on telomerase activity. Similarly, it is possible that the duration that PinX1-FAM-siRNA was able to affect PinX1 was too short (48 h), therefore it was impossible to observe the biological alteration in Eca cells.

In conclusion, the results of the present study demonstrated that the addition of exogenous PinX1 into carcinoma cells inhibited targeted telomerase activity, which indicated that PinX1 was a potential telomerase activity inhibitor. This finding may launch a novel field for treating malignant neoplasms, such as Eca, by gene-targeting.

References

1 

Parkin DM, Muir CS, Whelan SL, Gao YT, Ferlay J and Powell J: Cancer incidence in five continents. VI. International Agency for Research on Cancer; 1992

2 

Folini M, Brambil C, Villa R, Gandellini P, Vignati S, Paduano F, Daidone MG and Zaffaroni N: Antisense oligonucleotide-mediated inhibition of hTERT, but not hTERC, induces rapid cell growth decline and apoptosis in the absence of telomere shortening in human prostate cancer cells. Eur J Cancer. 41:624–634. 2005. View Article : Google Scholar : PubMed/NCBI

3 

Kraemer K, Fuessel S, Schmidt U, Kotzsch M, Schwenzer B, Wirth MP and Meye A: Antisense- mediated hTERT inhibit ion specifically reduces the growth of human bladder cancer cells. Clin Cancer Res. 9:3794–3800. 2003.PubMed/NCBI

4 

Yu HP, Xu SQ, Lu WH, Li YY, Li F, Wang XL and Su YH: Telomerase activity and expression of telomerase genes in squamous dysplasia and squamous cell carcinoma of the esophagus. J Surg Oncol. 86:99–104. 2004. View Article : Google Scholar : PubMed/NCBI

5 

Liao C, Zhao MJ, Zhao J, Jia D, Song H and Li ZP: Over-express ion of LPTS-L in hepatocellular carcinoma cell line SMMC-7721 induces crisis. World J Gastroenterol. 8:1050–1052. 2002. View Article : Google Scholar : PubMed/NCBI

6 

Liao C, Zhao M, Song H, Uchida K, Yokoyama KK and Li T: Identification of the gene for a novel liver related putative tumor suppressor at a high frequency loss of heterozygosity region of chromosome 8p23 in human hepatocellular carcinoma. Hepatology. 32:721–727. 2000. View Article : Google Scholar : PubMed/NCBI

7 

Sun J, Huang H, Zhu Y, Lan J, Li J, Lai X and Yu J: The expression of telomeric proteins and their probable regulation of telomerase during the differentiation of all-trans-retinoic acid-responsive and -resistant acute promyelocytic leukemia cells. Int J Hematol. 82:215–223. 2005. View Article : Google Scholar : PubMed/NCBI

8 

Akiyama Y, Maesawa C, Wada K, Fujisawa K, Itabashi T, Noda Y, Honda T, Sato N, Ishida K, Takagane A, et al: Human PinXl, a potent telomerase inhibitor, is not involved in human gastrointestinal tract carcinoma. Oncol Rep. 11:871–874. 2004.PubMed/NCBI

9 

Banik SS and Counter CM: Characterization of interactions between PinX1 and human telomerase subunits hTERT and hTR. J Biol Chem. 279:51745–51748. 2004. View Article : Google Scholar : PubMed/NCBI

10 

Chen G, Da L, Xu Y, Xu M, Song L, Li T and Zhao M: C-terminal amino acids 290-328 of LPTS/PinX1 confer telomerase inhibition. Biochem Biophys Res Commun. 398:683–689. 2010. View Article : Google Scholar : PubMed/NCBI

11 

Guglielmi B and Werner M: The yeast homolog of human PinX1 is involved in rRNA and small nucleolar RNA maturation, not in telomere elongation inhibition. J Biol Chem. 227:35712–35719. 2002. View Article : Google Scholar

12 

Lin J and Blackburn EH: Nucleolar protein PinX1 regulates telomerase by sequestering its protein catalytic subunit in an inactive complex lacking telomerase RNA. Genes Dev. 18:387–396. 2004. View Article : Google Scholar : PubMed/NCBI

13 

Sun J, Huang H, Zhu Y, Lan J, Li J, Lai X and Yu J: The expression of telomeric proteins and their probable regulation of telomerase during the differentiation of all-trans-retinoic acid-responsive and resistant acute promyelocytic leukemia cells. Int J Hematol. 82:215–223. 2005. View Article : Google Scholar : PubMed/NCBI

14 

Akiyama Y, Maesawa C, Wada K, Fujisawa K, Itabashi T, Noda Y, Honda T, Sato N, Ishida K, Takagane A, et al: Human PinXl, a potent telomerase inhibitor, is not involved in human gastrointestinal tract carcinoma. Oncol Rep. 11:871–874. 2004.PubMed/NCBI

15 

Hawkins GA, Chang BL, Zheng SL, Isaacs SD, Wiley KE, Bleecker ER, Walsh PC, Meyers DA, Xu J and Isaacs WB: Mutational analysis of PINX1 in hereditary prostate cancer. Prostate. 60:298–302. 2004. View Article : Google Scholar : PubMed/NCBI

16 

Chang Q, Pang JC, Li J, Hu L, Kong X and Ng HK: Molecular analysis of PinX1 in medulloblastom. Int J Cancer. 109:309–314. 2004. View Article : Google Scholar : PubMed/NCBI

17 

Yuan K, Li N, Jiang K, Zhu T, Huo Y, Wang C, Lu J, Shaw A, Thomas K, Zhang J, et al: PinX1 is a novel microtubule-binding protein essential for accurate chromosome segregation. J Biol Chem. 284:23072–23082. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Li N, Yuan K, Yan F, Huo Y, Zhu T, Liu X, Guo Z and Yao X: PinX1 is recruited to the mitotic chromosome periphery by nucleolin and facilitates chromosome congression. Biochem Biophys Res Commun. 384:76–81. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Fan XK, Yan RH, Geng XQ, Li JS, Chen XM and Li JZ: Biological significance of PinX1 telomerase inhibitor in esophageal carcinoma treatment. Exp Ther Med 12: 2196-2200, 2016.
APA
Fan, X., Yan, R., Geng, X., Li, J., Chen, X., & Li, J. (2016). Biological significance of PinX1 telomerase inhibitor in esophageal carcinoma treatment. Experimental and Therapeutic Medicine, 12, 2196-2200. https://doi.org/10.3892/etm.2016.3561
MLA
Fan, X., Yan, R., Geng, X., Li, J., Chen, X., Li, J."Biological significance of PinX1 telomerase inhibitor in esophageal carcinoma treatment". Experimental and Therapeutic Medicine 12.4 (2016): 2196-2200.
Chicago
Fan, X., Yan, R., Geng, X., Li, J., Chen, X., Li, J."Biological significance of PinX1 telomerase inhibitor in esophageal carcinoma treatment". Experimental and Therapeutic Medicine 12, no. 4 (2016): 2196-2200. https://doi.org/10.3892/etm.2016.3561
Copy and paste a formatted citation
x
Spandidos Publications style
Fan XK, Yan RH, Geng XQ, Li JS, Chen XM and Li JZ: Biological significance of PinX1 telomerase inhibitor in esophageal carcinoma treatment. Exp Ther Med 12: 2196-2200, 2016.
APA
Fan, X., Yan, R., Geng, X., Li, J., Chen, X., & Li, J. (2016). Biological significance of PinX1 telomerase inhibitor in esophageal carcinoma treatment. Experimental and Therapeutic Medicine, 12, 2196-2200. https://doi.org/10.3892/etm.2016.3561
MLA
Fan, X., Yan, R., Geng, X., Li, J., Chen, X., Li, J."Biological significance of PinX1 telomerase inhibitor in esophageal carcinoma treatment". Experimental and Therapeutic Medicine 12.4 (2016): 2196-2200.
Chicago
Fan, X., Yan, R., Geng, X., Li, J., Chen, X., Li, J."Biological significance of PinX1 telomerase inhibitor in esophageal carcinoma treatment". Experimental and Therapeutic Medicine 12, no. 4 (2016): 2196-2200. https://doi.org/10.3892/etm.2016.3561
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team