Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
August-2017 Volume 14 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
August-2017 Volume 14 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Hyperoside inhibits biofilm formation of Pseudomonas aeruginosa

  • Authors:
    • Yixuan Sun
    • Fengjun Sun
    • Wei Feng
    • Xuewen Qiu
    • Yao Liu
    • Bo Yang
    • Yongchuan Chen
    • Peiyuan Xia
  • View Affiliations / Copyright

    Affiliations: Department of Pharmacy, Southwest Hospital, Third Military Medical University, Chongqing 400038, P.R. China
  • Pages: 1647-1652
    |
    Published online on: June 21, 2017
       https://doi.org/10.3892/etm.2017.4641
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Pseudomonas aeruginosa (P. aeruginosa) is a common pathogen in hospital‑acquired infection and is readily able to form biofilms. Due to its high antibiotic resistance, traditional antibacterial treatments exert a limited effect on P. aeruginosa biofilm infections. It has been indicated that hyperoside inhibits P. aeruginosa PAO1 (PAO1) biofilm formation without affecting growth. Therefore, the current study examined the biofilm formation and quorum sensing (QS) system of PAO1 in the presence of hyperoside. Confocal laser scanning microscopy analysis demonstrated that hyperoside significantly inhibited biofilm formation. It was also observed that hyperoside inhibited twitching motility in addition to adhesion. Data from reverse transcription‑quantitative polymerase chain reaction indicated that hyperoside inhibited the expression of lasR, lasI, rhlR and rhlI genes. These results suggest that the QS‑inhibiting effect of hyperoside may lead to a reduction in biofilm formation. However, the precise mechanism of hyperoside on P. aeruginosa pathogenicity remains unclear and requires elucidation in additional studies.

Introduction

Pseudomonas aeruginosa (P. aeruginosa) is a common pathogen in hospital-acquired infections (1). Due to increasing multidrug resistance, P. aeruginosa infection is an increasingly common cause of mortality and morbidity (2). The mechanisms of antibiotic resistance in P. aeruginosa include the expression of multiple antibiotic modifying enzymes, antibiotic efflux pumps and acquisition of chromosomally or plasmid encoded antibiotic resistance genes. Additionally, chromosomal mutations and lower membrane permeability for the antibiotics also contribute to antibiotic resistance (3). P. aeruginosa is a biofilm-forming pathogen and is difficult to eradicate due to its high antibiotic resistance and the ability of the biofilm to evade the immune system (4–7). Quorum sensing (QS) is a system of stimuli and response correlated to population density. P. aeruginosa uses the QS system to coordinate gene expression according to the density of its local population. Thus, it can coordinate certain behaviors such as biofilm formation, virulence and antibiotic resistance. QS inhibitors (QSIs) are the most well reported alternative therapeutics that can be used to overcome the problem of increasing antibiotic resistance in P. aeruginosa. QSIs target the virulence of the organism and therefore are also termed antipathogenic drugs. The virulence of P. aeruginosa depends on its cell-to-cell communication system, or QS system that uses diffusible signaling molecules that accumulate with increasing cell density and allows P. aeruginosa to trigger coordinated responses and achieve outcomes that would otherwise remain impossible to achieve by individual bacterium (8). Previous studies have demonstrated that traditional treatments for bacteria exert some effect on biofilm infections (9,10). Therefore, the effects of constituents from marine organisms, traditional Chinese herbs and plants (11–13) on biofilm infections are being assessed.

Flavonoids are plant polyphenols present in vegetables, fruits and beverages of plant origin and are well known for their antipyretic, analgesic and anti-inflammatory physiological properties (14–18). Hyperoside is a type of modified flavonoid. It has been demonstrated that hyperoside has weak antibacterial activity against gram-positive bacteria and no antibacterial activity against gram-negative bacteria (19,20). Furthermore, it has been identified that hyperoside exhibits an inhibitory effect on P. aeruginosa PAO1 (PAO1) biofilms (21). While the incidence of infections caused by antibiotic resistant strains has increased, the discovery of novel classes of antibiotics has slowed down which made it imperative to search for alternative treatment strategies. Therefore, the current study examined the biofilm formation, adhesion and motility of PAO1 in the presence of hyperoside. And the hyperoside may become a more effective method to treat the infection of P. aeruginosa.

Materials and methods

Bacterial strains and culture conditions

P. aeruginosa PAO1 was acquired from Bioplus Biotech Co., Ltd. (Shanghai, China) and cultured in Lubria-Bertani (LB) medium (BD Diagnostics, Sparks Glencoe, MD, USA) at 37°C for 24 h in all experiments. The hyperoside was purchased from Dalian Meilun Biotechnology Co., Ltd. (Dalian, China).

Dose effect of hyperoside on biofilm formation

PAO1 was activated in LB medium overnight at 37°C prior to 1:1,000 (v/v) dilution in a tissue culture microtiter plate. The final concentrations of hyperoside in the tissue culture microtiter plate were 8, 16, 32, 64, 128 and 256 µg/ml. Following 24 h incubation at 37°C, the medium was removed and wells were washed three times with ddH2O. The microtiter plate was dried prior to the addition of 1% crystal violet (Sigma-Aldrich; Merck Millipore, Darmstadt, Germany) for 15 min at room temperature. Following staining, the dye was removed and the wells were washed three times with tap water. The microtiter plate was dried prior to the addition of 30% glacial acetic acid to solubilize the dye bound to the biofilm. The absorbance was measured by xMark Microplate Spectrophotometer (Bio-Rad, Laboratories, Inc., Hercules, CA, USA) at 590 nm. The optimal concentration for biofilm inhibition was used in the later experiments.

Growth assays

Cells were grown in LB medium in the presence or absence of 16 µg/ml hyperoside. Bacterial culture turbidity was measured by xMark Microplate Spectrophotometer (Bio-Rad, Laboratories, Inc) at 600 nm at intervals of 0 h up to 24 h.

Microscopy analysis

Confocal laser scanning microscopy (CLSM) was performed to analyze the effect of hyperoside on the PAO1 biofilm at 24 h. Prior to the CLSM experiments, cell cultures were divided into control and hyperoside (16 µg/ml)-treated groups. Biofilms on the culture dish were fixed with 2.5% glutaraldehyde at room temperature for 3 h. Following washing with phosphate-buffered saline (PBS), 5 µg/ml propidium iodide (Sigma-Aldrich) was added and the biofilms were incubated for 15 min at 4°C. The plate was then washed, 50 µg/ml fluorescein isothiocyanate-concanavalin A (Sigma-Aldrich) was added and the plate was incubated for 30 min at 4°C. The stained biofilm was then observed using CLSM.

Adhesion assays

Adhesion assays were performed as previously described with minor modifications (22). Following PAO1 activation, the control and hyperoside groups were cultured in a 96-well microtiter plate and incubated for 4 h at 37°C. Following incubation, the attached cells were stained with filtered 1% crystal violet (Sigma-Aldrich) at room temperature for 15 min. The dye was dissolved in 30% glacial acetic acid (Sigma-Aldrich), and the absorbance was measured by xMark Microplate Spectrophotometer at 590 nm.

Motility assays

Twitching motilities were assayed on agar plates (freshly prepared LB agar plates with 1% Bacto agar were used for the twitching assay) in the presence or absence of 16 µg/ml hyperoside (23). An overnight culture was stabbed with a toothpick to transfer PAO1 through the agar layer (point-incubation) to the bottom of the Petri dish and plates were then incubated at 37°C for 48 h. The agar was removed and attached cells were stained with 1% crystal violet (Sigma-Aldrich) at room temperature for 15 min. The plates were washed gently with PBS to remove unattached cells prior to staining. The diameter of the stained zone was measured by graduated scale to assess the twitching motility.

Reverse transcription-quantitative PCR (RT-qPCR)

RT-qPCR was used to detect the transcription levels of lasI, lasR, rhlI and rhlR genes in P. aeruginosa with or without 16 µg/ml hyperoside. The primers used to amplify these genes are listed in Table I. Total RNA was isolated from PAO1 using a FastRNA Pro Blue Kit (MP Biomedicals, Santa Ana, CA, USA). Cells were grown overnight at 37°C in the presence or absence of hyperoside and harvested by centrifugation at 16,100 × g for 10 min, and the deposit was resuspended in TRIzol (Tiangen Biotech Co., Ltd., Beijing, China). Preparation of total RNA was performed according to the manufacturer's protocol. The RNA sample was treated with 50 units of DNase I (Roche Applied Science, Penzberg, Germany) for 2 h at 37°C to remove contaminating DNA. DNaseIwas eliminated by phenol-chloroform extraction and ethanol precipitation. The pellet was resuspended in diethyl pyrocarbonate (DEPC)-treated H2O. Reverse transcription was performed using the First Strand cDNA Synthesis kit (Toyobo Co., Ltd., Osaka, Japan) and qPCR using SYBR® Green Real-time PCR Master mix (Toyobo Co., Ltd.) according to the manufacturer's protocol. The reaction procedure involved two-step PCR programme: 94°C for 5 min, (94°C for 30 sec, 57°C for 30 sec and 72°C for 30 sec) X40 cycles. The 16S rRNA gene was selected as the internal control to normalize the data. Relative expression of gene (RQ) was calculated by 2−∆∆cq and percent reduction was calculated as (1-RQ) X 100 (24). Experiments were repeated independently three times.

Table I.

Primer sequences used for reverse transcription-quantitative polymerase chain reaction.

Table I.

Primer sequences used for reverse transcription-quantitative polymerase chain reaction.

GenePrimer directionSequence (5′-3′)
lasRForward CTGTGGATGCTCAAGGACTAC
Reverse ACCGAACTTCCGCCGAAT
lasIForward CGTGCTCAAGTGTTCAAGGA
Reverse GCGTCTGGATGTCGTTCTG
rhlRForward CCGATGCTGATGTCCAACC
Reverse GCTACATCGTCGCCATGAG
rhlIForward GCTACATCGTCGCCATGAG
Reverse TCTCGCCCTTGACCTTCTG
16SForward ATCTTCGGACCTCACGCTATC
Reverse CCAACTTGCTGAACCACCTAC
Statistical analysis

The results are expressed as the mean ± standard deviation and the results from at least three independent experiments were statistically analyzed by one-way analysis of variance, using SPSS 17.0 software (SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to represent a statistically significant difference.

Results

Effect of hyperoside on P. aeruginosa biofilm formation

Hyperoside is a flavonol glycoside with variety of biological activities, including antioxidant, anticancer, antihyperglycemic and anti-inflammatory functions (25–27). However, prior to the current study, hyperoside has demonstrated little antibacterial activity (20,28). The dose-effect experiment of the present study demonstrated that 256 µg/ml hyperoside exhibited no inhibitory effects, and 16 µg/ml hyperoside had the strongest inhibitory effect on P. aeruginosa biofilm formation. All doses of hyperoside between 16–64 µg/ml demonstrated biofilm inhibition to an extent (Fig. 1). As hyperoside concentration decreased, (from 64 to 16 µg/ml) the inhibition rate of biofilm formation increased. However, the biofilm inhibition activity was not concentration dependent. A similar mode of action has been observed for another traditional medicine component, catechins (29). Although hyperoside does not exhibit antibacterial activity at experimental concentrations, higher hyperoside concentrations may have other pharmacological activities that weaken the effect of biofilm formation.

Figure 1.

Effect of hyperoside on biofilm formation at different concentrations. Results are presented as the mean ± standard deviation obtained from three independent experiments. *P<0.05, **P<0.01 vs. the control group. OD590, optical density at 590 nm.

Effect of hyperoside on growth

A growth curve using 16 µg/ml hyperoside is presented (Fig. 2) and the negligible difference in coincident bacterial growth suggests that the biofilm inhibition effect was completely unrelated to antibacterial activity.

Figure 2.

Growth curve of P. aeruginosa in the presence or absence of 16 µg/ml hyperoside over 24 h. OD600, optical density at 600 nm.

CLSM observation

The inhibitory effect of 16 µg/ml hyperoside was confirmed by CLSM micrographs of the P. aeruginosa biofilm. Figure 3 shows that the biofilm of the hyperoside group was sparse (Fig. 3B) compared with the control group (Fig. 3A) and the amount of bacteria and polysaccharide was clearly decreased.

Figure 3.

Confocal laser scanning microscopy showing the effect of hyperoside on P. aeruginosa biofilm formation. Concanavalin A (green) and PI (red) staining were used to generate the images. (A) CLSM image of untreated PAO1 biofilm. (B) CLSM image of PAO1 biofilm treated with 16 µg/ml hyperoside. CLSM, confocal laser scanning microscopy; PAO1, Pseudomonas aeruginosa PAO1.

Effect of hyperoside on adhesion

Hyperoside had a significant inhibitory effect on PAO1 cell adhesion, a process involved in initial biofilm formation (P<0.05; Fig. 4). The inhibition of initial adherence by hyperoside suggests that it may decrease and delay new biofilm formation.

Figure 4.

Adhesion ability of P. aeruginosa in the presence or absence of 16 µg/ml hyperoside. Results are presented as the mean ± standard deviation as obtained from three independent experiments. *P<0.05 vs. the control group. OD590, optical density at 590 nm.

Effect of hyperoside on motility

Twitching motility is mediated by type 4 pili (30) and this was inhibited by hyperoside (Fig. 5). Accordingly, twitching motility may be decreased by inhibiting the activity of type 4 pili. The movement of pili is the first stage of biofilm formation. As an essential step for irreversible adhesion, it can affect the morphology and structure of the biofilm. Therefore, hyperoside may inhibit the biofilm formation of P. aeruginosa through inhibiting its type 4 pili.

Figure 5.

Twitching motility of P. aeruginosa standard strain PAO1. (A) Absence of hyperoside and (B) presence of 16 µg/ml hyperoside. (C) Graph indicating the diameter of the stained zone. Results are presented as the mean ± standard deviation obtained from three independent experiments. ***P<0.001 vs. the control group. PAO1, Pseudomonas aeruginosa PAO1.

Effect of hyperoside on gene expression

P. aeruginosa has two well-studied quorum sensing (QS) systems, las and rhl. The las system is comprised of the transcriptional activator LasR and the autoinducer (AI) synthase LasI. The rhl system is comprised of the transcriptional regulatory protein RhlR and the RhlI AI synthase (31). The las and rhl systems are important for P. aeruginosa biofilm development (32,33). Hyperoside inhibits a multitude of factors involved in biofilm formation; therefore, it may inhibit the QS systems. RT-qPCR was used to detect lasR, lasI, rhlR and rhlI gene expression. The results from RT-qPCR indicated that hyperoside inhibited the expression of the lasR, lasI, rhlR and rhlI genes as the downregulation of transcription in these genes was significant (P<0.05; Fig. 6). Similar effects have been observed regarding other flavonol glycosides in previous studies (34).

Figure 6.

Comparison the transcription levels of lasI, lasR, rhlI and rhlR genes related to QS system in P. aeruginosa with or without 16 µg/ml hyperoside. Expression levels were determined by reverse transcription-quantitative polymerase chain reaction. Data are presented as the mean ± standard deviation. The experiment was repeated three times. *P<0.05 vs. control group.

Discussion

Bacteria living in biofilms cause 80% of bacterial infections (35). Due to the high antibiotic resistance of biofilms, novel drugs are required to treat biofilm infections. Previous studies have shown that the formation of biofilm can be inhibited with sub-minimum inhibitory concentrations of certain antibiotics, such as imipenem and erythromycin (36,37). However, the long-term use of antibiotics will give rise to drug-resistant bacteria. An increasing number of studies have found that natural products, including baicalin, allicin and garlicin, exhibit an inhibitory effect on biofilms (38,39). The use of them for biofilm inhibition has been successful and has the potential to identify novel medicines. Currently, there is no natural drug permitted for use in the clinical treatment of biofilm infection. In this study, we demonstrated that hyperoside treatment of PAO1 attenuated biofilm formation, which is related to the QS system. Twitching motility is a type IV pili-driven movement by which bacteria can adhere and spread biofilm over a surface (40,41). Type IV pili is also controlled by QS in P. aeruginosa (42). In the current study, it was found that hyperoside-treated PAO1 exhibited reduced adherence, as well as twitching motility, suggesting that hyperoside impairs the QS system to inhibit PAO1 adherence, motility and biofilm formation. Additionally, quantitative analysis of gene expression showed that hyperoside inhibited the expression of lasR, lasI, rhlR and rhlI genes involved in the QS system, which indicates that hyperoside affected P. aeruginosa biofilm formation by repressing the activity of las and rhl systems.

In view of its structure and function, biofilm is difficult to be removed completely by a single drug treatment. Therefore, drug combinations are often used to overcome biofilm formation, especially antibiotic-antibiotic combinations (43–45). Despite a favorable anti-biofilm effect, the combination of antibiotics can result in the generation of drug resistant bacteria, and enhance the toxicity to humans. Several studies have showed that phytochemicals can potentiate the activity of eradicating biofilm of antibiotics in combination (46–49). The combinations of antibiotic sulfamethoxazole with protocatechuic acid/ellagic acid/gallic acid and tetracycline with gallic acid, cefoperazone with allicin showed synergistic mode of interaction and were highly effective in inhibition P. aeruginosa biofilm under in vitro conditions (50). Vitexin has been found to potentiate the anti-biofilm activity of azithromycin and gentamicin on P. aeruginosa (51). As a type of nature product, whether hyperoside also has synergistic effects with antibiotics that inhibit P. aeruginosa biofilm formation requires further study. Although hyperoside exhibits antibacterial properties against P. aeruginosa in vitro, its anti-bacterial effects against P. aeruginosa in vivo are largely unknown. Defined clinical trials should be conducted to confirm its efficacy. Furthermore, little is known regarding the mechanism of hyperoside, and thus warrants further investigation. Overall, the effect and mechanisms of hyperoside require further assessment, including analysis using in vivo techniques.

Acknowledgements

The current study was supported by the Application Development Project of Chongqing (grant no. cstc2014yykfA110021).

References

1 

Gristina AG, Oga M, Webb LX and Hobgood CD: Adherent bacterial colonization in the pathogenesis of osteomyelitis. Science. 228:990–993. 1985. View Article : Google Scholar : PubMed/NCBI

2 

Goossens H: Susceptibility of multi-drug-resistant Pseudomonas aeruginosa in intensive care units: Results from the European MYSTIC study group. Clin Microbiol Infect. 9:980–983. 2003. View Article : Google Scholar : PubMed/NCBI

3 

Chatterjee M, Anju CP, Biswas L, Kumar V Anil, Mohan C Gopi and Biswas R: Antibiotic resistance in Pseudomonas aeruginosa and alternative therapeutic options. Int J Med Microbiol. 306:48–58. 2016. View Article : Google Scholar : PubMed/NCBI

4 

Musken M, Di Fiore S, Romling U and Häussler S: A 96-well-plate-based optical method for the quantitative and qualitative evaluation of Pseudomonas aeruginosa biofilm formation and its application to susceptibility testing. Nat Protoc. 5:1460–1469. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Høiby N, Johansen H Krogh, Moser C, Song Z, Ciofu O and Kharazmi A: Pseudomonas aeruginosa and the in vitro and in vivo biofilm mode of growth. Microbes Infect. 3:23–35. 2001. View Article : Google Scholar : PubMed/NCBI

6 

Ceri H, Olson ME, Stremick C, Read RR, Morck D and Buret A: The Calgary Biofilm Device: New technology for rapid determination of antibiotic susceptibilities of bacterial biofilms. J Clin Microbiol. 37:1771–1776. 1999.PubMed/NCBI

7 

Anwar H and Costerton JW: Enhanced activity of combination of tobramycin and piperacillin for eradication of sessile biofilm cells of Pseudomonas aeruginosa. Antimicrob Agents Chemother. 34:1666–1671. 1990. View Article : Google Scholar : PubMed/NCBI

8 

Van Delden C and Iglewski BH: Cell-to-cell signaling and Pseudomonas aeruginosa infections. Emerg Infect Dis. 4:551–560. 1998. View Article : Google Scholar : PubMed/NCBI

9 

Wang Y, Wang T, Hu J, Ren C, Lei H, Hou Y and Brantner AH: Anti-biofilm activity of TanReQing, a Traditional Chinese Medicine used for the treatment of acute pneumonia. J Ethnopharmacol. 134:165–170. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Palombo EA: Traditional medicinal plant extracts and natural products with activity against oral bacteria: Potential application in the prevention and treatment of oral diseases. Evid Based Complement Alternat Med. 2011:6803542011. View Article : Google Scholar : PubMed/NCBI

11 

Sayem SM, Manzo E, Ciavatta L, Tramice A, Cordone A, Zanfardino A, De Felice M and Varcamonti M: Anti-biofilm activity of an exopolysaccharide from a sponge-associated strain of Bacillus licheniformis. Microb Cell Fact. 10:742011. View Article : Google Scholar : PubMed/NCBI

12 

Chen X, Shang F, Meng Y, Li L, Cui Y, Zhang M, Qi K and Xue T: Ethanol extract of Sanguisorba officinalis L. inhibits biofilm formation of methicillin-resistant Staphylococcusaureus in an ica-dependent manner. J Dairy Sci. 98:8486–8491. 2015. View Article : Google Scholar : PubMed/NCBI

13 

Ren S, Wu M, Guo J, Zhang W, Liu X, Sun L, Holyst R, Hou S, Fang Y and Feng X: Sterilization of polydimethylsiloxane surface with Chinese herb extract: A new antibiotic mechanism of chlorogenic acid. Sci Rep. 5:104642015. View Article : Google Scholar : PubMed/NCBI

14 

Chen ZW, Ma CG and Xu SY: Mechanism of analgesic action of hyperin. Yao Xue Xue Bao. 24:326–330. 1989.(In Chinese). PubMed/NCBI

15 

Xin Q and Chen S: Advances in the study of the protection of hyperin against ischemic injuries of tissues and organs. Zhong Yao Cai. 26:213–215. 2003.(In Chinese). PubMed/NCBI

16 

Wang WQ, Ma CG and Xu SY: Protective effect of hyperin against myocardial ischemia and reperfusion injury. Zhongguo Yao Li Xue Bao. 17:341–344. 1996.PubMed/NCBI

17 

Verma N, Amresh G, Sahu PK, Mishra N, Rao ChV and Singh AP: Pharmacological evaluation of hyperin for antihyperglycemic activity and effect on lipid profile in diabetic rats. Indian J Exp Biol. 51:65–72. 2013.PubMed/NCBI

18 

Lee S, Park HS, Notsu Y, Ban HS, Kim YP, Ishihara K, Hirasawa N, Jung SH, Lee YS, Lim SS, et al: Effects of hyperin, isoquercitrin and quercetin on lipopolysaccharide-induced nitrite production in rat peritoneal macrophages. Phytother Res. 22:1552–1556. 2008. View Article : Google Scholar : PubMed/NCBI

19 

Marčetić MD, Milenković MT, Lakušić DV and Lakušić BS: Chemical Composition and antimicrobial activity of the essential oil and methanol extract of Hypericum aegypticum subsp. webbii (Spach) N. Robson. Chem Biodivers. 13:427–436. 2016. View Article : Google Scholar : PubMed/NCBI

20 

Lee S, Shin DS, Oh KB and Shin KH: Antibacterial compounds from the leaves of Acanthopanax senticosus. Arch Pharm Res. 26:40–42. 2003. View Article : Google Scholar : PubMed/NCBI

21 

Wang SS, Wang DM, Pu WJ and Li DW: Phytochemical profiles, antioxidant and antimicrobial activities of three Potentilla species. BMC Complement Altern Med. 13:3212013. View Article : Google Scholar : PubMed/NCBI

22 

Neidig A, Yeung AT, Rosay T, Tettmann B, Strempel N, Rueger M, Lesouhaitier O and Overhage J: TypA is involved in virulence, antimicrobial resistance and biofilm formation in Pseudomonas aeruginosa. BMC Microbiol. 13:772013. View Article : Google Scholar : PubMed/NCBI

23 

Bala A, Kumar R and Harjai K: Inhibition of quorum sensing in Pseudomonas aeruginosa by azithromycin and its effectiveness in urinary tract infections. J Med Microbiol. 60:300–306. 2011. View Article : Google Scholar : PubMed/NCBI

24 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and 2(−Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

25 

Xing HY, Liu Y, Chen JH, Sun FJ, Shi HQ and Xia PY: Hyperoside attenuates hydrogen peroxide-induced L02 cell damage via MAPK-dependent Keap-Nrf-ARE signaling pathway. Biochem Biophys Commun. 410:759–765. 2011. View Article : Google Scholar

26 

Li W, Liu M, Xu YF, Feng Y, Che JP, Wang GC and Zheng JH: Combination of quercetin and hyperoside has anticancer effects on renal cancer cells through inhibition of oncogenic microRNA-27a. Oncol Rep. 31:117–124. 2014.PubMed/NCBI

27 

Ku SK, Kwak S, Kwon OJ and Bae JS: Hyperoside inhibits high-glucose-induced vascular inflammation in vitro and in vivo. Inflammation. 37:1389–1400. 2014. View Article : Google Scholar : PubMed/NCBI

28 

Abedini A, Roumy V, Mahieux S, Biabiany M, Standaert-Vitse A, Rivière C, Sahpaz S, Bailleul F, Neut C and Hennebelle T: Rosmarinic acid and its methyl ester as antimicrobial components of the hydromethanolic extract of Hyptis atrorubens poit. (Lamiaceae). Evid Based Complement Alternat Med. 2013:6045362013. View Article : Google Scholar : PubMed/NCBI

29 

Matsunaga T, Nakahara A, Minnatul KM, Noiri Y, Ebisu S, Kato A and Azakami H: The inhibitory effects of catechins on biofilm formation by the periodontopathogenic bacterium, Eikenella corrodens. Biosci Biotechnol Biochem. 74:2445–2450. 2010. View Article : Google Scholar : PubMed/NCBI

30 

Giltner CL, van Schaik EJ, Audette GF, Kao D, Hodges RS, Hassett DJ and Irvin RT: The Pseudomonas aeruginosa type IV pilin receptor binding domain functions as an adhesin for both biotic and abiotic surfaces. Mol Microbiol. 59:1083–1096. 2006. View Article : Google Scholar : PubMed/NCBI

31 

Davies DG, Parsek MR, Pearson JP, Iglewski BH, Costerton JW and Greenberg EP: The involvement of cell-to-cell signals in the development of a bacterial biofilm. Science. 280:295–298. 1998. View Article : Google Scholar : PubMed/NCBI

32 

Morici LA, Carterson AJ, Wagner VE, Frisk A, Schurr JR, Hönerzu Bentrup K, Hassett DJ, Iglewski BH, Sauer K and Schurr MJ: Pseudomonas aeruginosa AlgR represses the Rhl quorum-sensing system in a biofilm-specific manner. J Bacteriol. 189:7752–7764. 2007. View Article : Google Scholar : PubMed/NCBI

33 

De Kievit TR, Gillis R, Marx S, Brown C and Iglewski BH: Quorum-sensing genes in Pseudomonas aeruginosa biofilms: Their role and expression patterns. Appl Environ Microbiol. 67:1865–1873. 2001. View Article : Google Scholar : PubMed/NCBI

34 

Zeng Z, Qian L, Cao L, Tan H, Huang Y, Xue X, Shen Y and Zhou S: Virtual screening for novel quorum sensing inhibitors to eradicate biofilm formation of Pseudomonas aeruginosa. Appl Microbiol Biotechnol. 79:119–126. 2008. View Article : Google Scholar : PubMed/NCBI

35 

Vo GD, Brindle E and Heys J: An experimentally validated immersed boundary model of fluid-biofilm interaction. Water Sci Technol. 61:3033–3040. 2010. View Article : Google Scholar : PubMed/NCBI

36 

Cirioni O, Silvestri C, Ghiselli R, Kamysz W, Minardi D, Castelli P, Orlando F, Kamysz E, Provinciali M, Muzzonigro G, et al: In vitro and in vivo effects of sub-MICs of pexiganan and imipenem of Pseudomonas aeruginosa adhesion and biofilm development. Infez Med. 21:287–295. 2013.PubMed/NCBI

37 

Zhao YL, Zhou YH, Chen JQ, Huang QY, Han Q, Liu B, Cheng GD and Li YH: Quantitative proteomic analysis of sub-MIC erythromycin inhibiting biofilm formation of S, suis in vitro. J Proteomics. 116:1–14. 2015. View Article : Google Scholar : PubMed/NCBI

38 

Wang C, Cheng H, Zhang X, Xu S, Guan Y, Yu L and Yun Y: In vitro activity of baicalin against non-albicans Candida biofilms. Zhongguo Zhong Yao Za Zhi. 35:639–641. 2010.(In Chinese). PubMed/NCBI

39 

Saleem M, Nazir M, Ali MS, Hussain H, Lee YS, Riaz N and Jabbar A: Antimicrobial natural products: An update on future antibiotic drug candidates. Nat Prod Rep. 27:238–254. 2010. View Article : Google Scholar : PubMed/NCBI

40 

Tolker-Nielsen T, Brinch UC, Ragas PC, Andersen JB, Jacobsen CS and Molin S: Development and dynamics of Pseudomonas aeruginosa sp. biofilms. J Bacteriol. 182:6482–6489. 2000. View Article : Google Scholar : PubMed/NCBI

41 

Sauer K, Camper AK, Ehrlich GD, Costerton JW and Davies DG: Pseudomonas aeruginosa displays multiple phenotypes during development as a biofilm. J Bacteriol. 184:1140–1154. 2002. View Article : Google Scholar : PubMed/NCBI

42 

Köhler T, Curty LK, Barja F, van Delden C and Pechére JC: Swarming of Pseudomonas aeruginosa is dependent on cell-to-cell signaling and requires flagella and pili. J Bacteriol. 182:5990–5996. 2000. View Article : Google Scholar : PubMed/NCBI

43 

Olson KM, Starks CM, Williams RB, O'Neil-Johnson M, Huang Z, Ellis M, Reilly JE and Eldridge GR: Novel pentadecenyl tetrazole enhances susceptibility of methincillin-resistant Staphylococcus aureus biofilm to gentamicin. Antimicrob Agents Chemother. 55:3691–3695. 2011. View Article : Google Scholar : PubMed/NCBI

44 

Pettit RK, Weber CA, Lawrence SB, Pettit GR, Kean MJ and Cage GD: In vivo activity of anprocide alone and in vitro activity in combination with conventional antibiotics against Staphylococcus aureus and Staphylococcus epidermidis biofilms. J Med Microbiol. 58:1203–1206. 2010. View Article : Google Scholar

45 

McConeghy KW and LaPlante KL: In vitro activity of tigecycline in combination with gentamicin against biofilm-forming Staphylococcus aureus. Diagn Microbiol Infect Dis. 68:1–6. 2010. View Article : Google Scholar : PubMed/NCBI

46 

Chen YQ, Zuo XJ, Zhu LN, Song ZJ, Shi HZ, Zuo P and Guo XH: In vitro effects of honeysuckle aqueous extracts alone and in combination with ceftazidime on Pseudomonas aeruginosa biofilms. Chin J Microbiol Immunol. 24:738–742. 2004.

47 

Kong JL, Liu XL, Chen YQ, et al: In vitro effect of Scutellaria aqueous extracts combination with levofloxacin on Pseudomonas aeruginosa biofilm. Tianjin Med J. 36:331–333. 2008.

48 

Huang XM, Huang LC, Fang ZH, et al: Synergism of Sophora flavescens ait and ciprofloxacin on Pseudomonas aeruginosa biofilms. J Shaoguan Univ. 27:60–63. 2006.

49 

Zhou Q, Deng CH, Zhang W, et al: In vitro effects of aqueous extract of Sophora in combination with ceftazidime on elimination of Pseudomonas aeruginosa biofilms. J New Chin Med. 40:98–99. 2008.

50 

Jayaraman P, Sakharkar MK, Lim CS, Tang TH and Sakharkar KR: Activity and interactions of antibiotic and phytochemical combinations against Pseudomonas aeruginosa in vitro. Int J Biol Sci. 6:556–568. 2010. View Article : Google Scholar : PubMed/NCBI

51 

Das MC, Sandhu P, Gupta P, Rudrapaul P, De UC, Tribedi P, Akhter Y and Bhattacharjee S: Attenuation of Pseudomonas aeruginosa biofilm formation by Vitexin: A combinatorial study with azithromycin and gentamicin. Sci Rep. 6:233372016. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Sun Y, Sun F, Feng W, Qiu X, Liu Y, Yang B, Chen Y and Xia P: Hyperoside inhibits biofilm formation of Pseudomonas aeruginosa. Exp Ther Med 14: 1647-1652, 2017.
APA
Sun, Y., Sun, F., Feng, W., Qiu, X., Liu, Y., Yang, B. ... Xia, P. (2017). Hyperoside inhibits biofilm formation of Pseudomonas aeruginosa. Experimental and Therapeutic Medicine, 14, 1647-1652. https://doi.org/10.3892/etm.2017.4641
MLA
Sun, Y., Sun, F., Feng, W., Qiu, X., Liu, Y., Yang, B., Chen, Y., Xia, P."Hyperoside inhibits biofilm formation of Pseudomonas aeruginosa". Experimental and Therapeutic Medicine 14.2 (2017): 1647-1652.
Chicago
Sun, Y., Sun, F., Feng, W., Qiu, X., Liu, Y., Yang, B., Chen, Y., Xia, P."Hyperoside inhibits biofilm formation of Pseudomonas aeruginosa". Experimental and Therapeutic Medicine 14, no. 2 (2017): 1647-1652. https://doi.org/10.3892/etm.2017.4641
Copy and paste a formatted citation
x
Spandidos Publications style
Sun Y, Sun F, Feng W, Qiu X, Liu Y, Yang B, Chen Y and Xia P: Hyperoside inhibits biofilm formation of Pseudomonas aeruginosa. Exp Ther Med 14: 1647-1652, 2017.
APA
Sun, Y., Sun, F., Feng, W., Qiu, X., Liu, Y., Yang, B. ... Xia, P. (2017). Hyperoside inhibits biofilm formation of Pseudomonas aeruginosa. Experimental and Therapeutic Medicine, 14, 1647-1652. https://doi.org/10.3892/etm.2017.4641
MLA
Sun, Y., Sun, F., Feng, W., Qiu, X., Liu, Y., Yang, B., Chen, Y., Xia, P."Hyperoside inhibits biofilm formation of Pseudomonas aeruginosa". Experimental and Therapeutic Medicine 14.2 (2017): 1647-1652.
Chicago
Sun, Y., Sun, F., Feng, W., Qiu, X., Liu, Y., Yang, B., Chen, Y., Xia, P."Hyperoside inhibits biofilm formation of Pseudomonas aeruginosa". Experimental and Therapeutic Medicine 14, no. 2 (2017): 1647-1652. https://doi.org/10.3892/etm.2017.4641
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team