Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
April-2018 Volume 15 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2018 Volume 15 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Human fibroblast growth factor-21 serves as a predictor and prognostic factor in patients with hepatitis B cirrhosis combined with adrenal insufficiency

  • Authors:
    • Jian Zhang
    • Junhong Li
    • Junwei Ma
    • Hongxin Wang
    • Yin Yi
  • View Affiliations / Copyright

    Affiliations: Emergency Department, Beijing You'an Hospital, Capital Medical University, Beijing 100069, P.R. China
    Copyright: © Zhang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 3189-3196
    |
    Published online on: February 6, 2018
       https://doi.org/10.3892/etm.2018.5840
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Hepatitis B cirrhosis is caused by liver cell necrosis, residual liver cell nodular regeneration, connective tissue hyperplasia and fiber formation, which frequently leads to adrenal insufficiency. Previous reports have demonstrated that human fibroblast growth factor (hFGF)‑21 is a multifunctional protein that exhibits potential therapeutic value for metabolic diseases. The present study investigated the diagnostic value of hFGF‑21 and analyzed the potential molecular mechanism in the progression of hepatitis B cirrhosis combined with adrenal insufficiency. Characteristics of cellular immunity and humoral immunity were analyzed in patients with hepatitis B cirrhosis combined with adrenal insufficiency (PhbA). Results demonstrated that expression levels of hFGF‑21 were downregulated in plasma and liver cells isolated from clinical specimens. Plasma concentration levels of hFGF‑21 were upregulated in prognostic PhbA. In vitro assays indicated that hFGF‑21 treatment decreased the continuous deposition of extracellular matrix and reactive oxygen species in liver cells isolated from clinical specimens. Results also demonstrated that hFGF‑21 treatment downregulated inflammatory cytokines. It was observed that hFGF‑21 treatment downregulated nuclear factor (NF)‑κB and Kruppel‑like factor 6. Notably, transforming growth factor (TGF)‑β, platelet‑derived growth factor and epidermal growth factor levels were improved by hFGF‑21 treatment. In conclusion, these results indicated that hFGF‑21 inhibits inflammation by regulation of the NF‑κB‑mediated TGF‑β signaling pathway, which may serve as a predictor and prognostic factor in PhbA.

Introduction

Liver cirrhosis is a kind of metabolic disease that is reversible and may be treated when it is identified at an early stage (1). Liver cirrhosis is divided into hepatitis B cirrhosis and hepatitis C cirrhosis according to pathogenesis in clinical research (2,3). Previous reports have indicated risks for alcoholic liver cirrhosis, and regression of fibrosis/cirrhosis by glycine propionyl-l-carnitine treatment has been also investigated in D-Galactosamine-induced chronic liver damage (4,5). The main pathogenesis of liver cirrhosis is progressive fibrosis (6). A comprehensive review has evaluated the management of patients with autoimmune hepatitis with decompensated cirrhosis (7). Furthermore, a study by Wang et al (7) suggested that chronic hepatitis B and hepatitis B virus-related cirrhosis contributes to other metabolic syndromes, which further influences renal function and increases the risk of renal damage, hypophosphatemia, and adrenal insufficiency (8–10).

Fibroblast growth factor (FGF)-21 is an atypical member of the FGF family, as well as a multifunctional protein predominantly secreted by adipose tissue, the pancreas and liver, which has been regarded as an efficient polypeptide for the treatment of metabolic disorders (11,12). Previous research has reported that metabolic hormone effects of FGF-21 on energy metabolism were essential for human vascular endothelial cells (13,14). A study by Wang et al (15) indicated that FGF-21 is positively associated with atrial fibrosis in patients with atrial fibrillation with rheumatic heart disease. FGF-21 has been reported as a novel liver safeguard (16), as well as being identified as a momentous controller and regulator of glucose and lipid metabolism, and long-term energy balance (17,18). Notably, transplantation of basic FGF-pretreated adipose tissue-derived stromal cells enhances regression of liver fibrosis in mice (19). However, the molecular mechanisms of liver fibrosis associated with FGF-21 are not well understood or clearly elaborated.

Chronic inflammation associated with hepatitis C virus infection contributes to hepatic transforming growth factor (TGF)-β signaling that promotes cirrhosis and hepatocellular carcinoma (20). Research has also indicated protective effects of allopurinol against acute liver damage and cirrhosis induced by carbon tetrachloride through modulation of nuclear factor (NF)-κB, cytokine production and oxidative stress (21). The present study analyzed the potential diagnostic value of human (h)FGF-21 and investigated the hFGF-21-mediated signaling pathway of hepatitis B cirrhosis combined with adrenal insufficiency in liver cells. The present data indicated that plasma concentration levels of hFGF-21 were downregulated in patients with hepatitis B cirrhosis combined with adrenal insufficiency (PhbA), which may be associated with the NF-κB-mediated TGF-β signaling pathway.

Patients and methods

Patients and healthy volunteers

A total of 186 PhbA (90 male and 96 female) and 68 healthy volunteers (35 male and 33 female) were recruited in the present clinical investigation following presentation to Beijing You'an Hospital, Capital Medical University (Beijing, China) between May 2014 and October 2015. The mean age was 38.5 (16.4–62.5 years) and 34.2 (22.5–46.2 years) in PhbA and healthy volunteers, respectively. A total of 10 patients [male/female, 5/5; 34.2 years old (22.5–46.2)] who had recovered from hepatitis B cirrhosis combined with adrenal insufficiency (PPhbA) were also recruited to the present study. Patients with diabetes mellitus and digestive tract diseases were excluded from the present study. Patients were diagnosed with PhbA as described previously (22). All participants were required to provide written informed consent prior to initiation of the study. The present study was approved by the Ethics Committee of Beijing You'an Hospital, Capital Medical University (Beijing, China).

Cell culture

Liver and renal epithelial cells were obtained from PhbA using a biopsy needle as previously described (23). Cells were cultured in minimal essential medium supplemented with 10% fetal bovine serum (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). Liver and renal epithelial cells were incubated with hFGF-21 (1.0 mg/ml, Sigma-Aldrich; Merck KGaA) for 24 h to analyze purpose protein expression with non-treated cells used as controls. The cells were cultured in a humidified atmosphere containing 5% of CO2 at 37°C.

ELISA

Serum levels of hFGF-21 (cat. no. DF2100), tumor necrosis factor (TNF)-α (cat. no. DTA00C), interleukin (IL)-1β (cat. no. DLB50), IL-6 (cat. no. D6050) and IL-8 (cat. no. D8000C) were detected in PhbA and healthy volunteers using ELISA kits (IBL International GmbH, Hamburg, Germany), according to the manufacturer's protocol. The serum levels of hFGF-21 were also analyzed between PhbA and PPhbA on day 30 following treatments. The serum concentration levels of hFGF-21, TNF-α, IL-1β, IL-6 and IL-8 were measured by an enzyme microplate reader at 450 nm.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from liver and renal epithelial cells using an RNeasy Mini kit (Qiagen Sciences, Inc., Gaithersburg, MD, USA), according to the protocol provided by the manufacturer. RNA was reversed transcribed using a PrimeScript RT Master Mix kit (Takara Bio, Inc., Otsu, Japan). All forward and reverse primers were synthesized by Invitrogen (Thermo Fisher Scientific, Inc., Waltham, MA, USA; Table I). For amplification diluted cDNA was combined with a reaction mixture containing SYBR-Green PCR Core Reagents (cat. no. 4304886; Applied Biosystems; Thermo Fisher Scientific, Inc.). Relative mRNA expression levels were calculated using the 2−ΔΔCq method (24). PCR cycling was performed under the following conditions: 94°C for 30 sec and 45 cycles of 95°C for 5 sec, 57°C for 10 sec and 72°C for 10 sec. The results were expressed as the n-fold of the control.

Table I.

Primer sequences used in the study for polymerase chain reaction.

Table I.

Primer sequences used in the study for polymerase chain reaction.

Sequences (5′-3′)

Gene nameReverseForward
FGF-21 CTGCTGGGGGTCTACCAAG CTGCGCCTACCACTGTTCC
TNF-α TCCAGACTTCCTTGAGACA GGCGATTACAGACACAACT
IL-6 CCACACAGACAGCCACTCA CATCCATCTTTTTCAGCCATCT
IL-1β GGCTGCTTCCAAACCTTTGA GAAGACACGGATTCCATGGT
IL-8 TACTCCAAACCTTTCCACCC AACTTCTCCACAACCCTCTG
β-actin CGGAGTCAACGGATTTGGTC AGCCTTCTCCATGGTCGTGA

[i] FGF, fibroblast growth factor; TNF, tumor necrosis factor; IL, interleukin.

Western blot analysis

Liver and renal epithelial cells from PhbA were incubated with hFGF-21 (2 mg/ml) for 12 h at 37°C. Cells not treated with hFGF-21 were used as the controls. Cells were homogenized in a lysate buffer containing protease-inhibitor (P3480; Sigma-Aldrich; Merck KGaA) and were centrifuged at 4,000 × g at 4°C for 10 min. Western blot analysis was subsequently performed as previously described (25). Protein concentration was measured by a BCA protein assay kit (Thermo Fisher Scientific, Inc.). Protein samples (20 µg/lane) were resolved by 15% SDS-PAGE and then transferred to polyvinylidene fluoride membranes (Merck KGaA). Monoclonal rabbit anti-human epidermal growth factor (EGF), platelet-derived growth factor (PDGF; ab32570), hFGF-21 (ab64857), TNF-α (ab6671), IL-1β (ab2105), IL-6 (ab6672) and IL-8 (ab7747), TGF-β (ab31013), NF-κB (ab32360) and Kruppel-like factor 6 (KLF6; ab135783), extracellular matrix (ECM; ab28666), reactive oxygen species (ROS; ab5512) and β-actin (ab8227) antibodies (all 1:200; Abcam, Shanghai, China) were incubated with protein samples for 1 h at room temperature. After blocking with 1% bovine serum albumin (Sigma-Aldrich; Merck KGaA), followed by incubation with horseradish peroxidase-conjugated polyclonal anti-rabbit immunoglobulin G antibodies (1:10,000; PV-6001; OriGene Technologies, Inc., Beijing, China) for 1 h at room temperature. Signals were visualized by chemiluminescence detection (Z370398; Sigma-Aldrich; Merck KGaA). Densitometric quantification of the immunoblot data was performed using Quantity-One software (version 3.24; Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Gene knockdown with small interfering RNA (siRNA)

Liver cells (1×104/well) were incubated with hFGF-21 (2 mg/ml) for 5 days at 37°C in a six-well plate. To silence NF-κB gene expression, liver cells were transfected with 100 pmol siRNA-NF-κB sense, 5-′CUUGGUCAAUCUCAAGAUAtt-3′ and antisense, 5′-UAUCUUGAGAUUGACCAAGca-3′; with siRNA-vector sense, 5′-CGGACAAACGGCUCACUUUtt-3′ and antisense, 5′-AAAGUGAGCCGUUUGUCCGgg-3′ as a control (Applied Biosystems; Thermo Fisher Scientific, Inc.) using a Cell Line Nucleofector kit L (Lonza Group, Ltd., Basel, Switzerland), according to the manufacturer's protocol (26). The cells were analyzed 48 h following transfection.

Flow cytometry

The following antibodies were used: FITC-conjugated anti-CD11b (cat. no. 557686; clone M1/70; BD Biosciences, Franklin Lakes, NJ, USA), allophycocyanin-conjugated anti-Ly-6B.2 (cat. no. NBP2-13077APC; clone 7/4; Bio-Rad Laboratories, Inc.), FITC-conjugated anti-CD4 (cat. no. MCA2649; clone RM 4–5; eBioscience; Thermo Fisher Scientific, Inc.), PercP-conjugated anti-CD8a (cat. no. 555369; clone, 53–6.7; BD Biosciences), PE-conjugated anti-CD45R/B220 (cat. no. A15835; clone RA3-6B2; eBioscience; Thermo Fisher Scientific, Inc.) for 12 h at 4°C after blocking with 1% bovine serum albumin for 2 h at 37°C. All antibodies were used at a dilution of 1:100. B-lymphocytes were identified as CD11bhiLy6G-7/4hi/lo and macrophagocytes were identified as CD11chi. Cells were washed three times with 0.1% tris-buffered saline-Tween-20. Cells were analyzed using a flow cytometer (LSR II; BD Biosciences). Data was analyzed using BD FACSDiva™ software version 8.0.1 (BD Biosciences).

Statistical analysis

All data were presented as the mean ± standard deviation of triplicate independent trials in each experiment. All data were analyzed using SPSS Statistics 19.0 (IBM Corp., Armonk, NY, USA). Statistical differences between groups were assessed using analysis of variance with the post hoc Dunnett's test. P<0.05 was considered to indicate a statistically significant difference.

Results

Analysis of expression levels of hFGF-21 in PhbA

Expression levels of hFGF-21 were analyzed in serum and cellular units in PhbA. Characteristics of patients were summarized in Table II. Plasma concentration levels of hFGF-21 were significantly downregulated in PhbA compared with the those in healthy volunteers (P<0.01) (Fig. 1A). Western blotting demonstrated that hFGF-21 protein expression levels were significantly downregulated in liver cells isolated from PhbA compared to those from healthy volunteers (P<0.01) (Fig. 1B). These outcomes suggested that hFGF-21 is downregulated in PhbA. Healthy.

Figure 1.

Analysis of changes to hFGF-21 levels in PhbA. (A) Plasma concentration levels of hFGF-21 in PhbA and healthy volunteers. (B) Expression levels of hFGF-21 in liver cells isolated from clinical patients and healthy volunteers. **P<0.01. hFGF-21, human fibroblast growth factor-21; PhbA, patients with hepatitis B cirrhosis combined with adrenal insufficiency.

Table II.

Characteristics of patients and healthy volunteers.

Table II.

Characteristics of patients and healthy volunteers.

CharacteristicsPatientsHealthy volunteers
Number18668
Age, years (range)16.4–62.522.5–46.2
Sex, n
  Male7030
  Female11638
Analysis of expression levels of hFGF-21 in PhbA and PPhbA

Expression levels of hFGF-21 were detected in PPhbA. As demonstrated in Fig. 2A, plasma concentration levels of hFGF-21 were significantly increased in PPhbA compared with those in PhbA on day 30 (P<0.01). Cellular hFGF-21 mRNA and protein expression levels in liver cells isolated from PPhbA were significantly upregulated compared with those isolated from PhbA (P<0.01) (Fig. 2B). These results indicated that hFGF-21 may be a prognostic indicator in PhbA.

Figure 2.

Analysis of hFGF-21 expression levels in PPhbA and PhbA. (A) Plasma concentration levels of hFGF-21 between PPhbA and PhbA on day 30. (B) mRNA and protein expression levels of hFGF-21 in liver cells isolated from PPhbA and PhbA. **P<0.01. hFGF-21, human fibroblast growth factor-21; PPhbA, prognostic patients with hepatitis B cirrhosis combined with adrenal insufficiency; PhbA, patients with hepatitis B cirrhosis combined with adrenal insufficiency; PPhbA, patients who recovered form hepatitis B cirrhosis combined with adrenal insufficiency.

Association of hFGF-21 plasma concentration with cellular immunity and humoral immunity in PhbA

Characteristics of cellular immunity and humoral immunity were investigated in clinical PhbA prior and post treatments. Results demonstrated that the B lymphocyte level increased as the hFGF-21 plasma concentration increased during treatment (Fig. 3A). Macrophagocyte concentration levels were demonstrated to be positively associated with hFGF-21 plasma concentration during treatment (Fig. 3B). Results indicated that the percentage of cluster of differentiation (CD)4+ and CD8+ cells increased in serum as the hFGF-21 plasma concentration increased during treatment (Fig. 3C and D). These results indicated that hFGF-21 plasma concentration may be associated with cellular immunity and humoral immunity in PhbA during treatment.

Figure 3.

Association of hFGF-21 plasma concentration with cellular immunity and humoral immunity in clinical patients. Relationship between concentration levels of hFGF-21 and (A) B lymphocyte level and (B) macrophagocyte level in patients during treatment. Association of hFGF-21 plasma concentration with percentage of (C) CD4+ and (D) CD8+ cells in serum in patients during treatment. hFGF-21, human fibroblast growth factor-21; CD, cluster of differentiation.

Effects of hFGF-21 on inflammatory cytokine expression levels in liver cells isolated from clinical patients

Inflammatory cytokine levels were investigated in PhbA. As demonstrated in Fig. 4A-D, plasma concentration levels of TNF-α, IL-6, IL-1β and IL-8 were significantly upregulated in PhbA compared with those in healthy volunteers (P<0.01). Western blot analysis and RT-qPCR indicated that protein and mRNA expression levels of TNF-α, IL-6, IL-1β and IL-8 were significantly downregulated in the PPhbA groups compared with PhbA groups (P<0.01) (Fig. 4E and F). These results indicated that hFGF-21 treatment decreases inflammatory cytokine expression levels in liver cells isolated from clinical patients.

Figure 4.

Effects of hFGF-21 on inflammatory cytokine expression levels in liver cells isolated form clinical patients. Plasma concentration levels of (A) TNF-α, (B) IL-6, (C) IL-1β and (D) IL-8 in PhbA and healthy volunteers. (E) mRNA and (F) protein expression levels of inflammatory cytokines in cells treated with hFGF-21 isolated from patients and the PPhbA control group. **P<0.01. hFGF-21, human fibroblast growth factor-21; PhbA, patients with hepatitis B cirrhosis combined with adrenal insufficiency; PPhbA, patients who recovered form hepatitis B cirrhosis combined with adrenal insufficiency; TNF, tumor necrosis factor; IL, interleukin.

Effects of hFGF-21 on inflammatory cytokine expression levels in renal epithelial cells isolated from clinical patients

Inflammatory cytokines in renal epithelial cells isolated from clinical patients were analyzed following treatment with hFGF-21. As demonstrated in Fig. 5A and B, gene and protein expression levels of TNF-α, IL-6, IL-1β and IL-8 were significantly downregulated by hFGF-21 treatment in renal epithelial cells isolated from clinical patients compared to the levels in the control cells (P<0.01). These outcomes indicated that hFGF-21 suppresses inflammatory cytokine expression in renal epithelial cells isolated from clinical patients.

Figure 5.

Effects of hFGF-21 on inflammatory cytokine expression levels in renal epithelial cells isolated from clinical patients. (A) Gene expression levels of TNF-α, IL-6, IL-1β and IL-8 in renal epithelial cells isolated from clinical patients treated with hFGF-21 or not treated with hFGF-21. (B) Protein expression levels of TNF-α, IL-6, IL-1β and IL-8 in renal epithelial cells isolated from clinical patients treated with hFGF-21 or not treated with hFGF-21. **P<0.01. hFGF-21, human fibroblast growth factor-21; TNF, tumor necrosis factor; IL, interleukin.

hFGF-21 regulates inflammatory cytokines through downregulation of the NF-κB-mediated TGF-β signaling pathway

In order to analyze the potential mechanism mediated by hFGF-21, the NF-κB-mediated TGF-β signal pathway was investigated in liver cells isolated from clinical patients. Results demonstrated that hFGF-21 treatment significantly inhibited deposition of ECM and ROS expression levels in liver cells compared with the levels in control cells (P<0.01) (Fig. 6A). Western blotting indicated that expression levels of TGF-β, NF-κB and KLF6 were significantly downregulated and PDGF and EGF expression levels were significantly upregulated by hFGF-21 treatment in liver cells compared with the levels in the control cells (P<0.01) (Fig. 6B and C). Knockdown of NF-κB with siRNA-NF-κB significantly inhibited the hFGF-21-induced suppression of TGF-β and KLF6 expression and hFGF-21-promoted PDGF and EGF expression levels in liver cells compared with the levels in cells transfected with siRNA-vector (P<0.01; Fig. 6D and E). Findings also indicated that knockdown of NF-κB significantly inhibited the suppression of protein expression levels of TNF-α, IL-6, IL-1β and IL-8 in liver cells induced by hFGF-21 compared with the levels in cells transfected with siRNA-vector (P<0.01; Fig. 6F). These results indicated that hFGF-21 regulates inflammatory cytokines through downregulation of the NF-κB-mediated TGF-β signaling pathway.

Figure 6.

hFGF-21 regulates inflammatory cytokines through downregulation of the NF-κB-mediated TGF-β signaling pathway. (A) Effects of hFGF-21 on deposition of ECM and ROS expression levels in liver cells. (B) Effects of hFGF-21 on expression levels of TGF-β, NF-κB and KLF6 in liver cells. (C) Effects of hFGF-21 on expression levels of PDGF and EGF in liver cells. (D) Knockdown of NF-κB with Si-NF-κB increases TGF-β and KLF6 expression in liver cells. (E) Knockdown of NF-κB with Si-NF-κB suppresses PDGF and EGF expression in liver cells. (F) Effects of Si-NF-κB on protein expression levels of TNF-α, IL-6, IL-1β and IL-8 in liver cells. **P<0.01. hFGF-21, human fibroblast growth factor-21; NF, nuclear factor; TGF, transforming growth factor; ECM, extracellular matrix; ROS, reactive oxygen species; KLF6, Kruppel-like factor 6; PDGF, platelet-derived growth factor; EGF, epidermal growth factor; TNF, tumor necrosis factor; IL, interleukin; Si, small interfering RNA.

Discussion

Hepatitis B-induced liver cirrhosis poses a great threat to health and frequently leads to adrenal insufficiency that further affects the endocrine system and disturbs liver metabolism (27,28). Pathophysiologic and clinical evidences have suggested that inflammation is associated with hepatitis B-induced liver cirrhosis and inflammatory cytokines, including TNF and IL-1, which may be potential target agents in decompensated cirrhosis (29). Research has also indicated that FGF is altered and molecular signaling pathways are regulated by attenuating the expression of TGF-β (30). The present study detected hFGF-21 serum concentration and expression levels in PhbA. Outcomes indicated that hFGF-21 suppressed inflammatory cytokine levels in liver cells isolated from clinical specimens through regulation of the NF-κB-mediated TGF-β signaling pathway. These findings suggested that hFGF-21 may serve as a predictor and prognostic factor in PhbA.

Beneficial effects of inhibition of oxidative stress and inflammation have been reported in hepatitis C virus-positive patients with liver cirrhosis and findings indicate that inflammation inhibition influences microinflammation and the metabolism of iron in hepatitis C virus-positive patients with liver cirrhosis, which subsequently appeared to reduce the production of oxidative stress, possibly leading to a decrease in the occurrence of hepatocellular carcinoma (31). A study by Prystupa et al (32) indicated that proinflammatory cytokines (IL-1β and IL-6) and hepatocyte growth factor were upregulated in patients with alcoholic liver cirrhosis. Additionally, the levels of ghrelin, leptin, TNF-α and IL-8 in liver cirrhosis were increased following hepatitis B and hepatitis D virus infection (33,34). The present findings suggested that hFGF-21 treatment inhibits mRNA and protein expression levels of TNF-α, IL-6, IL-1β and IL-8 in liver cells. Inhibitory effects of hFGF-21 were demonstrated in the present study, indicating that hFGF-21 regulates inflammatory cytokines by downregulation of the NF-κB-mediated TGF-β signaling pathway.

Target-specific systemic delivery of siRNA for TGF-β has been proposed for the treatment of liver cirrhosis and has demonstrated feasible therapeutic effects on liver cirrhosis by reduction of nodule formation, collagen content and hepatic stellate cell numbers (35). A study by Chávez et al (36) suggested that Sulfasalazine prevents the increase in TGF-β, cyclooxygenase-2 and NF-κB translocation and fibrosis in carbon tetrachloride-induced liver cirrhosis in rats. A study by Aldaba-Muruato et al (21) indicated that modulation of NF-κB, cytokine production and oxidative stress may protect the liver against allopurinol-induced acute liver damage and cirrhosis induced by carbon tetrachloride. Therefore, we assumed that the regulation of inflammatory cytokines by hFGF-21 may be associated with the NF-κB signaling pathway. The present results supported this hypothesis and the findings suggested that hFGF-21 treatment suppresses ECM and ROS expression levels and downregulates TGF-β, NF-κB and KLF6 expression levels in liver cells.

Previous research has demonstrated that FGF-21 resulted in insulin resistance by inhibiting the activation of NF-κB (37). FGF-21 also served an endocrine hormone role in blocking somatic growth, leading to growth hormone resistance (38). Furthermore, FGF-21 has been reported to be associated with lipid metabolism and the incidence of cardiovascular disease (39), as well as various human diseases and metabolic syndromes, including geriatric obesity, type 2 diabetes mellitus and congenital hypothyroidism (40–42). In the present study, changes of hFGF-21 plasma concentration levels in PhbA were analyzed. Outcomes suggested that hFGF-21 is downregulated in clinical patients suffering with hepatitis B cirrhosis combined with adrenal insufficiency. Therefore, hFGF-21 may serve as a predictor and prognostic factor for hepatitis B cirrhosis combined with adrenal insufficiency.

In conclusion, the present study indicated that hFGF-21 improved inflammatory cytokine expression levels in renal epithelial cells and liver cells isolated from clinical patients. The results demonstrated the potential molecular mechanism mediated by hFGF-21 in liver cells in the progression of hepatitis B cirrhosis combined with adrenal insufficiency. The present study suggested that hFGF-21 administration downregulates inflammatory cytokine levels through the NF-κB-mediated TGF-β signaling pathway. Changes in hFGF-21 plasma concentration prior and post treatment were observed for PhbA, suggesting that hFGF-21 possesses the potential to act as an alternative predictor and prognostic indicator for the evaluation of prognosis of hepatitis B cirrhosis combined with adrenal insufficiency.

References

1 

Acharya UR, Raghavendra U, Fujita H, Hagiwara Y, Koh JE, Jen Hong T, Sudarshan VK, Vijayananthan A, Yeong CH, Gudigar A and Ng KH: Automated characterization of fatty liver disease and cirrhosis using curvelet transform and entropy features extracted from ultrasound images. Comput Biol Med. 79:250–258. 2016. View Article : Google Scholar : PubMed/NCBI

2 

Dezső K, Rókusz A, Bugyik E, Szücs A, Szuák A, Dorogi B, Kiss M, Nemeskéri Á, Nagy P and Paku S: Human liver regeneration in advanced cirrhosis is organized by the portal tree. J Hepatol. 66:778–786. 2017. View Article : Google Scholar : PubMed/NCBI

3 

Aguirre Valadez JM, Rivera-Espinosa L, Méndez-Guerrero O, Chávez-Pacheco JL, García Juárez I and Torre A: Intestinal permeability in a patient with liver cirrhosis. Ther Clin Risk Manag. 12:1729–1748. 2016. View Article : Google Scholar : PubMed/NCBI

4 

Ganai AA, Ganaie IA, Verma N and Farooqi H: Regression of fibrosis/cirrhosis by Glycine propionyl-l-carnitine treatment in d-Galactosamine induced chronic liver damage. Chem Biol Interact. 260:117–128. 2016. View Article : Google Scholar : PubMed/NCBI

5 

Askgaard G, Leon DA, Kjaer MS, Deleuran T, Gerds TA and Tolstrup JS: Risk for alcoholic liver cirrhosis after an initial hospital contact with alcohol problems: A nationwide prospective cohort study. Hepatology. 65:929–937. 2017. View Article : Google Scholar : PubMed/NCBI

6 

Chiriac S, Stanciu C and Trifan A: Corticosteroid treatment in the setting of decompensated liver cirrhosis with relative adrenal insufficiency: A case report and a brief review of the literature. Rev Med Chir Soc Med Nat Iasi. 120:288–292. 2016.PubMed/NCBI

7 

Wang Z, Sheng L, Yang Y, Yang F, Xiao X, Hua J, Guo C, Wei Y, Tang R, Miao Q, et al: The management of autoimmune hepatitis patients with decompensated cirrhosis: Real-world experience and a comprehensive review. Clin Rev Allergy Immunol. 52:424–435. 2017. View Article : Google Scholar : PubMed/NCBI

8 

Han Y, Zeng A, Liao H, Liu Y, Chen Y and Ding H: The efficacy and safety comparison between tenofovir and entecavir in treatment of chronic hepatitis B and HBV related cirrhosis: A systematic review and meta-analysis. Int Immunopharmacol. 42:168–175. 2017. View Article : Google Scholar : PubMed/NCBI

9 

Fialla AD, Israelsen M, Hamberg O, Krag A and Gluud LL: Nutritional therapy in cirrhosis or alcoholic hepatitis: A systematic review and meta-analysis. Liver Int. 35:2072–2078. 2015. View Article : Google Scholar : PubMed/NCBI

10 

Manne V, Akhtar E and Saab S: Cirrhosis regression in patients with viral hepatitis B and C: A systematic review. J Clin Gastroenterol. 48:e76–e84. 2014. View Article : Google Scholar : PubMed/NCBI

11 

Eto K: FGF-21, a newcomer in the field of hypertension research. J Hum Hypertens. 27:343–344. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Reinehr T, Woelfle J, Wunsch R and Roth CL: Fibroblast growth factor 21 (FGF-21) and its relation to obesity, metabolic syndrome, and nonalcoholic fatty liver in children: A longitudinal analysis. J Clin Endocrinol Metab. 97:2143–2150. 2012. View Article : Google Scholar : PubMed/NCBI

13 

Dushay J, Chui PC, Gopalakrishnan GS, Varela-Rey M, Crawley M, Fisher FM, Badman MK, Martinez-Chantar ML and Maratos-Flier E: Increased fibroblast growth factor 21 in obesity and nonalcoholic fatty liver disease. Gastroenterology. 139:456–463. 2010. View Article : Google Scholar : PubMed/NCBI

14 

Hotta Y, Nakamura H, Konishi M, Murata Y, Takagi H, Matsumura S, Inoue K, Fushiki T and Itoh N: Fibroblast growth factor 21 regulates lipolysis in white adipose tissue but is not required for ketogenesis and triglyceride clearance in liver. Endocrinology. 150:4625–4633. 2009. View Article : Google Scholar : PubMed/NCBI

15 

Wang R, Yi X, Li X and Jiang X: Fibroblast growth factor-21 is positively associated with atrial fibrosis in atrial fibrillation patients with rheumatic heart disease. Int J Clin Exp Pathol. 8:14901–14908. 2015.PubMed/NCBI

16 

Cariello M and Moschetta A: Fibroblast growth factor 21: A new liver safeguard. Hepatology. 60:792–794. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Suomalainen A, Elo JM, Pietiläinen KH, Hakonen AH, Sevastianova K, Korpela M, Isohanni P, Marjavaara SK, Tyni T, Kiuru-Enari S, et al: FGF-21 as a biomarker for muscle-manifesting mitochondrial respiratory chain deficiencies: A diagnostic study. Lancet Neurol. 10:806–818. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Lin Z, Wu Z, Yin X, Liu Y, Yan X, Lin S, Xiao J, Wang X, Feng W and Li X: Serum levels of FGF-21 are increased in coronary heart disease patients and are independently associated with adverse lipid profile. PLoS One. 5:e155342010. View Article : Google Scholar : PubMed/NCBI

19 

Kamada Y, Yoshida Y, Saji Y, Fukushima J, Tamura S, Kiso S and Hayashi N: Transplantation of basic fibroblast growth factor-pretreated adipose tissue-derived stromal cells enhances regression of liver fibrosis in mice. Am J Physiol Gastrointest Liver Physiol. 296:G157–G167. 2009. View Article : Google Scholar : PubMed/NCBI

20 

Matsuzaki K, Murata M, Yoshida K, Sekimoto G, Uemura Y, Sakaida N, Kaibori M, Kamiyama Y, Nishizawa M, Fujisawa J, et al: Chronic inflammation associated with hepatitis C virus infection perturbs hepatic transforming growth factor beta signaling, promoting cirrhosis and hepatocellular carcinoma. Hepatology. 46:48–57. 2007. View Article : Google Scholar : PubMed/NCBI

21 

Aldaba-Muruato LR, Moreno MG, Shibayama M, Tsutsumi V and Muriel P: Protective effects of allopurinol against acute liver damage and cirrhosis induced by carbon tetrachloride: Modulation of NF-κB, cytokine production and oxidative stress. Biochim Biophys Acta. 1820:65–75. 2012. View Article : Google Scholar : PubMed/NCBI

22 

de Lédinghen V, Douvin C, Kettaneh A, Ziol M, Roulot D, Marcellin P, Dhumeaux D and Beaugrand M: Diagnosis of hepatic fibrosis and cirrhosis by transient elastography in HIV/hepatitis C virus-coinfected patients. J Acquir Immune Defic Syndr. 41:175–179. 2006. View Article : Google Scholar : PubMed/NCBI

23 

Iguchi T, Hiraki T, Matsui Y, Fujiwara H, Sakurai J, Masaoka Y, Gobara H and Kanazawa S: CT fluoroscopy-guided renal tumour cutting needle biopsy: Retrospective evaluation of diagnostic yield, safety, and risk factors for diagnostic failure. Eur Radiol. 28:283–290. 2018. View Article : Google Scholar : PubMed/NCBI

24 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

25 

Almeida Mde A, Pizzini CV, Damasceno LS, Muniz Mde M, Almeida-Paes R, Peralta RH, Peralta JM, Oliveira Rde V, Vizzoni AG, de Andrade CL and Zancopé-Oliveira RM: Validation of western blot for Histoplasma capsulatum antibody detection assay. BMC Infect Dis. 16:872016. View Article : Google Scholar : PubMed/NCBI

26 

Mattheolabakis G, Ling D, Ahmad G and Amiji M: Enhanced anti-tumor efficacy of lipid-modified platinum derivatives in combination with survivin silencing siRNA in resistant non-small cell lung cancer. Pharm Res. 33:2943–2953. 2016. View Article : Google Scholar : PubMed/NCBI

27 

Jiao S, Chen H, Wang Y, Zhu J, Tan J and Gao J: Splenectomy versus partial splenic embolization for massive splenomegaly secondary to hepatitis B-related liver cirrhosis: A case-control study. Gastroenterol Res Pract. 2016:34716262016. View Article : Google Scholar : PubMed/NCBI

28 

Maan R, van Tilborg M, Deterding K, Ramji A, van der Meer AJ, Wong F, Fung S, Sherman M, Manns MP, Cornberg M, et al: Safety and effectiveness of direct-acting antiviral agents for treatment of patients with chronic hepatitis C virus infection and cirrhosis. Clin Gastroenterol Hepatol. 14:1821–1830.e6. 2016. View Article : Google Scholar : PubMed/NCBI

29 

Artigas A, Wernerman J, Arroyo V, Vincent JL and Levy M: Role of albumin in diseases associated with severe systemic inflammation: Pathophysiologic and clinical evidence in sepsis and in decompensated cirrhosis. J Crit Care. 33:62–70. 2016. View Article : Google Scholar : PubMed/NCBI

30 

Chen X, Shi C, Meng X, Zhang K, Li X, Wang C, Xiang Z, Hu K and Han X: Inhibition of Wnt/β-catenin signaling suppresses bleomycin-induced pulmonary fibrosis by attenuating the expression of TGF-β1 and FGF-2. Exp Mol Pathol. 101:22–30. 2016. View Article : Google Scholar : PubMed/NCBI

31 

Ohno T, Tanaka Y, Sugauchi F, Orito E, Hasegawa I, Nukaya H, Kato A, Matunaga S, Endo M, Tanaka Y, et al: Suppressive effect of oral administration of branched-chain amino acid granules on oxidative stress and inflammation in HCV-positive patients with liver cirrhosis. Hepatol Res. 38:683–688. 2008. View Article : Google Scholar : PubMed/NCBI

32 

Prystupa A, Kiciński P, Sak J, Boguszewska-Czubara A, Toruń-Jurkowska A and Załuska W: Proinflammatory cytokines (IL-1α, IL-6) and hepatocyte growth factor in patients with alcoholic liver cirrhosis. Gastroenterol Res Pract. 2015:5326152015. View Article : Google Scholar : PubMed/NCBI

33 

Ganji SH, Kashyap ML and Kamanna VS: Niacin inhibits fat accumulation, oxidative stress, and inflammatory cytokine IL-8 in cultured hepatocytes: Impact on non-alcoholic fatty liver disease. Metabolism. 64:982–990. 2015. View Article : Google Scholar : PubMed/NCBI

34 

Cesaratto L, Codarin E, Vascotto C, Leonardi A, Kelley MR, Tiribelli C and Tell G: Specific inhibition of the redox activity of ape1/ref-1 by e3330 blocks tnf-α-induced activation of IL-8 production in liver cancer cell lines. PLoS One. 8:e709092013. View Article : Google Scholar : PubMed/NCBI

35 

Park K, Hong SW, Hur W, Lee MY, Yang JA, Kim SW, Yoon SK and Hahn SK: Target specific systemic delivery of TGF-β siRNA/(PEI-SS)-g-HA complex for the treatment of liver cirrhosis. Biomaterials. 32:4951–4958. 2011. View Article : Google Scholar : PubMed/NCBI

36 

Chávez E, Castro-Sánchez L, Shibayama M, Tsutsumi V, Moreno MG and Muriel P: Sulfasalazine prevents the increase in TGF-β, COX-2, nuclear NFκB translocation and fibrosis in CCl4-induced liver cirrhosis in the rat. Hum Exp Toxicol. 31:913–920. 2012. View Article : Google Scholar : PubMed/NCBI

37 

Salehi MH, Kamalidehghan B, Houshmand M, Aryani O, Sadeghizadeh M and Mossalaeie MM: Association of fibroblast growth factor (FGF-21) as a biomarker with primary mitochondrial disorders, but not with secondary mitochondrial disorders (Friedreich Ataxia). Mol Biol Rep. 40:6495–6499. 2013. View Article : Google Scholar : PubMed/NCBI

38 

Gahete MD, Córdoba-Chacón J, Luque RM and Kineman RD: The rise in growth hormone during starvation does not serve to maintain glucose levels or lean mass but is required for appropriate adipose tissue response in female mice. Endocrinology. 154:263–269. 2013. View Article : Google Scholar : PubMed/NCBI

39 

Yu D, Sun CY, Sun GP, Ren GP, Ye XL, Zhu SL, Wang WF, Xu PF, Li SJ, Wu Q, et al: The synergistic effect of FGF-21 and insulin on regulating glucose metabolism and its mechanism. Yao Xue Xue Bao. 49:977–984. 2014.(In Chinese). PubMed/NCBI

40 

Ren G, Yin J, Wang W, Li L and Li D: Fibroblast growth factor (FGF)-21 signals through both FGF receptor-1 and 2. Sci China Life Sci. 53:1000–1008. 2010. View Article : Google Scholar : PubMed/NCBI

41 

Kharitonenkov A, Dunbar JD, Bina HA, Bright S, Moyers JS, Zhang C, Ding L, Micanovic R, Mehrbod SF, Knierman MD, et al: FGF-21/FGF-21 receptor interaction and activation is determined by betaKlotho. J Cell Physiol. 215:1–7. 2008. View Article : Google Scholar : PubMed/NCBI

42 

Kharitonenkov A, Shiyanova TL, Koester A, Ford AM, Micanovic R, Galbreath EJ, Sandusky GE, Hammond LJ, Moyers JS, Owens RA, et al: FGF-21 as a novel metabolic regulator. J Clin Invest. 115:1627–1635. 2005. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhang J, Li J, Ma J, Wang H and Yi Y: Human fibroblast growth factor-21 serves as a predictor and prognostic factor in patients with hepatitis B cirrhosis combined with adrenal insufficiency. Exp Ther Med 15: 3189-3196, 2018.
APA
Zhang, J., Li, J., Ma, J., Wang, H., & Yi, Y. (2018). Human fibroblast growth factor-21 serves as a predictor and prognostic factor in patients with hepatitis B cirrhosis combined with adrenal insufficiency. Experimental and Therapeutic Medicine, 15, 3189-3196. https://doi.org/10.3892/etm.2018.5840
MLA
Zhang, J., Li, J., Ma, J., Wang, H., Yi, Y."Human fibroblast growth factor-21 serves as a predictor and prognostic factor in patients with hepatitis B cirrhosis combined with adrenal insufficiency". Experimental and Therapeutic Medicine 15.4 (2018): 3189-3196.
Chicago
Zhang, J., Li, J., Ma, J., Wang, H., Yi, Y."Human fibroblast growth factor-21 serves as a predictor and prognostic factor in patients with hepatitis B cirrhosis combined with adrenal insufficiency". Experimental and Therapeutic Medicine 15, no. 4 (2018): 3189-3196. https://doi.org/10.3892/etm.2018.5840
Copy and paste a formatted citation
x
Spandidos Publications style
Zhang J, Li J, Ma J, Wang H and Yi Y: Human fibroblast growth factor-21 serves as a predictor and prognostic factor in patients with hepatitis B cirrhosis combined with adrenal insufficiency. Exp Ther Med 15: 3189-3196, 2018.
APA
Zhang, J., Li, J., Ma, J., Wang, H., & Yi, Y. (2018). Human fibroblast growth factor-21 serves as a predictor and prognostic factor in patients with hepatitis B cirrhosis combined with adrenal insufficiency. Experimental and Therapeutic Medicine, 15, 3189-3196. https://doi.org/10.3892/etm.2018.5840
MLA
Zhang, J., Li, J., Ma, J., Wang, H., Yi, Y."Human fibroblast growth factor-21 serves as a predictor and prognostic factor in patients with hepatitis B cirrhosis combined with adrenal insufficiency". Experimental and Therapeutic Medicine 15.4 (2018): 3189-3196.
Chicago
Zhang, J., Li, J., Ma, J., Wang, H., Yi, Y."Human fibroblast growth factor-21 serves as a predictor and prognostic factor in patients with hepatitis B cirrhosis combined with adrenal insufficiency". Experimental and Therapeutic Medicine 15, no. 4 (2018): 3189-3196. https://doi.org/10.3892/etm.2018.5840
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team