Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
April-2018 Volume 15 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2018 Volume 15 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Influence of different concentrations of uric acid on oxidative stress in steatosis hepatocytes

  • Authors:
    • Shi Cheng
    • Yan Yang
    • Yong Zhou
    • Wei Xiang
    • Hua Yao
    • Ling Ma
  • View Affiliations / Copyright

    Affiliations: Department of Nutrition and Food Hygiene, School of Public Health, Xinjiang Medical University, Urumqi, Xinjiang 830011, P.R. China, Department of Child Healthcare, People's Hospital (Children's Hospital) North Hospital, Urumqi, Xinjiang 830011, P.R. China, Department of Biology, School of Basic Medicine, Xinjiang Medical University, Urumqi, Xinjiang 830011, P.R. China, Health Management Department, The First Affiliated Hospital of Xinjiang Medical University, Urumqi, Xinjiang 830054, P.R. China
  • Pages: 3659-3665
    |
    Published online on: February 12, 2018
       https://doi.org/10.3892/etm.2018.5855
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The development of nonalcoholic fatty liver disease (NAFLD) is caused by the steatosis of hepatocytes, which induces oxidative stress (OS). Thus, OS has an important role in the development of NAFLD. In the present study, the L‑02 hepatocyte cell line was used to develop a steatosis cell model. The best model was determined using an MTT assay and the triglyceride levels. Model cells were treated with high concentrations of uric acid (UA; 0, 5, 10, 20 and 30 mg/dl) for 24, 48, 72 and 96 h. Indicators of oxidation were then measured, which included total superoxide dismutase (SOD), malonaldehyde (MDA) and reduced glutathione (GSH), and the transcriptional and translational levels of SOD1 and γ‑glutamate‑cysteine ligase (γ‑GCLC) were also determined. In addition, the intracellular levels of aspartate aminotransferase and alanine aminotransferase (ALT) were detected. The activity of SOD1 decreased over time and the result was supported by the results of western blotting. The transcriptional levels of SOD1 in model cells was significantly higher than untreated cells at 48 h. With the decreased levels of SOD1 and GSH, MDA increased in a time‑dependent manner. The content of GSH decreased with time as well, which was also reflected in the results of western blotting. The transcriptional levels of γ‑GCLC in all UA‑treated groups were lower when compared with those observed in the model group. The activity of ALT tended to increase, depending on the duration of treatment. Treatment with 5 and 10 mg/dl UA had an antioxidative effect on the model cells, and 30 mg/dl UA treatment for 48 h increased OS in the cells.

Introduction

The prevalence of nonalcoholic fatty liver disease (NAFLD) has increased rapidly, making it the most common cause of chronic liver disease in the developed world (1,2). The pathogenic mechanism underlying NAFLD and its progression are not entirely understood. Accumulation of fat is an essential condition in the development of NAFLD (3), based on which hepatocyte oxidative stress starts causing injury to the liver, which accelerates the progression of NAFLD to more severe stages (4), such as non-alcoholic steatosis hepatitis, nonalcoholic fatty liver-related cirrhosis, and nonalcoholic fatty liver-related cancer (5). Oxidative stress (OS) is a condition of imbalance between the antioxidant defense mechanisms and the production of free radicals, which favors the latter, leading to potential damage (6). OS is one of the major contributors to the pathogenesis of NAFLD (7). Increased accumulation of liver TGs may cause increased OS in the hepatocytes of animals and humans (8). Many experimental models (9) and human studies (10–12) have shown a strong relationship between the severity of NAFLD and the degree of OS.

UA is a powerful scavenger of free radicals and was found to be able to scavenge 60% of free radicals in plasma (13). However, it is possible that an increase in circulating levels of UA represents an adaptive response to protect against the detrimental effects of excessive free radicals and OS. But we hardly to see the studies UA could protect cells in related diseases as an antioxidant. Although the antioxidant effect of UA suggests that it would have therapeutic effects, a high serum UA concentration is associated with obesity and NAFLD (14,15), and, some possible mechanisms had been presented. In recent study, UA could protect brain health as an antioxidant, especially the level in acute raising (16), so we guess that the same effect may occur in the liver. If the assumption is true, the researches of UA in NAFLD would make a change, the mechanism would more complex in human body.

The purpose of our study was to investigate whether UA can ameliorate OS in hepatic steatosis and the optimal concentration for this effect. Therefore, we tested the enzyme activities of glutathione (GSH), transcriptional and translation levels of γ-glutamate-cysteine ligase (γ-GCLC) and superoxide dismutase 1 (SOD1) in both untreated and model cells that were treated with different concentrations of UA. We also examined the levels of malonaldehyde (MDA), alanine aminotransferase (ALT), and aspartate aminotransferase (AST) to reflect the level of OS and cell damage.

Materials and methods

Cell culture

HL-7702 cells (KeyGen Biotech Co., Ltd., Nanjing, China), hereafter referred to as L-02 cells, were maintained in high-glucose Dulbecco's minimum essential medium with 10% fetal bovine serum (Gibco; Thermo Fisher Scientific Inc., Waltham, MA, USA) and 0.5% penicillin-streptomycin solution (HyClone; GE Healthcare Life Sciences, Logan, UT, USA). L-02 cells were grown in 25-cm2 culture bottles (Corning Inc., Corning, NY, USA) at 37°C with 5% CO2.

Development of a steatosis cell model

The method for dissolving oleic acid (OA) and developing a steatosis cell model was similar to that previously published by Wang et al (17). Briefly, OA (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) and NaOH were mixed in ultrapure water, and the solution was added to the standard medium to prepare a sodium oleate medium with OA concentrations of 0.1, 0.2, 0.3, and 0.4 mM.

Cell activity measured by MTT

Cells were inoculated into 96-well plates at a density of 1×103 cells/well and treated with five different concentrations of OA using six wells per concentration. After 24 h, 20 µl of MTT (M6494; Thermo Fisher Scientific, Inc.) was added to a final concentration of 5 mg/ml into all wells without removing the oleic acid medium. After incubating for 4 h at 37°C, the media was removed and 150 µl DMSO was added into the wells with 10 min of shaking. The absorbance at 570 nm was then measured in microplate reader (Bio-Rad Laboratories, Inc., Hercules, CA, USA). We found the viability of cells treated with 0.4 mM sodium oleate were significantly lower than that of untreated cells. Hence, the 0.4 mM condition was not used in further analysis.

Triglyceride (TG) measurement

The cells were inoculated into 6-well cell culture plates at a density of 3×105 cells/well for four different OA treatment groups. The intracellular TG concentration was determined using a TG measurement kit according to the manufacturer's instructions (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).

Treatment with UA

Cells were inoculated into 6-well culture plates at a density of 3×105 cell/well. UA at concentrations of 5, 10, 20, and 30 mg/dl was added to both model and untreated cells. The cells were incubated for 24, 48, 72, and 96 h. A UA concentration of 5 mg/dl is known as the normal blood UA level; a level of 10 mg/dl and higher is considered hyperuricemia (18).

Detection of oxidative stress

The activity of total SOD and the content of GSH and MDA were used to reflect the level of oxidative stress. All parameters were measured using appropriate kits from Nanjing Jiancheng Bioengineering Institute (A001-3, A003-4, A006-2). The transcription levels of SOD1 and γ-GCLC were detected by a two-step quantitative reverse transcriptase PCR (RT-qPCR). Briefly, total mRNA was extracted from the cells using RNAiso Plus (Takara Biotechnology Co., Ltd., Dalian, China). The mRNA was reverse transcribed into cDNA using a First Strand cDNA Synthesis kit according to the manufacturer's instructions (Thermo Fisher Scientific, Inc.). β-actin was used as a control for the qPCR. The denaturation temperature for all three mRNA sequences was 95°C. The annealing temperatures were 58, 5, and 57°C corresponding to Zn/Cu SOD, γ-GCLC, and β-actin, respectively. After running 40 cycles, the melting curves were drawn by the software of IQ5. Three wells were used per condition. The primers for SOD1 were designed by Invitrogen, and the primers for γ-GCLC were designed by BGI. The sequences are shown in Table I.

Table I.

Primer sequences of SOD1 and γ-glutamate-cysteine ligase.

Table I.

Primer sequences of SOD1 and γ-glutamate-cysteine ligase.

GeneForward (5′-3′)Reverse (3′-5′)
Cu/Zn SOD AGGGCATCATCAATTTCGAGCAG CCACAAGCCAAACGACTTCCAG
γ-GCLC AGATGATAGAACACGGGAGG CACAAATACCACATAGGCAGA
β-actin GTCCACCTTCCAGCAGATGTG GCATTTGCGGTGGACGAT

[i] SOD, superoxide dismutase; γ-GCLC, γ-glutamate-cysteine ligase.

The translation of SOD1 and γ-GCLC were determined by western blotting. Total protein was extracted using RIPA solution (Thermo Fisher Scientific, Inc.). Sample buffer (4X; Solarbio Science and Technology Co., Ltd., Beijing, China) was added to 40 µg protein at a ratio of 1:3 (v:v) and was then heated at 95°C for 5 min for degeneration. SDS-polyacrylamide gel was made using a SDS-PAGE kit (Solarbio Science and Technology Co., Ltd.). Prestained protein ladder (8 µl) (26616; Thermo Fisher Scientific, Inc.) was added into one lane of the gel and 40 µg of the protein sample was added into the other lane. The electrical current was 25 mA per gel and the voltage of electrotransfer was 60 V per sandwich running for 1 h. The membrane was blocked with blocking buffer (CWBio, Beijing, China) for 1 h. The primary antibody of SOD1 (ab20926) and γ-GCLC (ab55435) (both from CWBio, Beijing, China) were diluted with TBST (CWBio) at a ratio of 1:1,000. After washing with TBST, the membrane was then incubated with the primary antibody diluent overnight at 4°C. The secondary antibody (Booster Bioengineering Institute, Wuhan, China) was diluted with TBST at a ratio of 1:8,000. The membranes were incubated with the secondary antibody diluent for 90 min under 25°C. Washed membranes were incubated with BCIP/NBT KIT (002209; Thermo Fisher Scientific, Inc.) for 10 min, taken pictures in GelDoc XR System (Bio-Rad Laboratories, Inc.). The grayscale of photos was analyzed by Quantity One software.

Statistical analysis

All of the data were analyzed using SPSS 23.0 and tested for normality and the homogeneity of variance. If the data showed normality and had equal variance, one-way analysis of variance (ANOVA; F distribution) was used. If there were significantly differences from the mean among all the groups, Tukey's method was used to complete multiple comparisons. If the data showed normality, but did not have equal variance based on one-way ANOVA, the Brown-Forsythe method was used to correct the results. For multiple comparisons based on unequal variance data, the Games-Howell method was used. If the data did not show normality, the Kruskal-Wallis H test was used, which is one of the non-parametric methods.

Results

Development of a steatosis cell model

We tested cellular viability by an MTT assay to ensure that the OA concentrations used did not impact metabolic activity. As shown in Fig. 1A, 0.4 mM OA showed a significant decrease in cellular activity and, thus, this condition was excluded from subsequent experiments. Next, we found that the 0.3 mM treatment group showed the highest TG concentration (Fig. 1B). Thus, the condition of 0.3 mM OA was chose.

Figure 1.

Vitality and TG content in cells treated with different concentrations of OA, and the MDA content in cells treated with UA. (A) Cells were treated with 4 different concentrations of OA (0.1–0.4 mM), and the vitality of cells and the (B) TG content were assessed. (C) Steatosis cells were treated with UA at different concentrations (0, 5, 10, 20 and 30 mg/dl) for different durations (24, 48, 72 and 96 h); untreated cells were used as the control. The 0.4 mM sodium oleate treatment was removed due to its low vitality of cells. ∆∆P<0.01 vs. untreated cells; *P<0.05 and **P<0.01 vs. 24 h cells at the corresponding UA concentration; #P<0.05 and ##P<0.01 vs. control cells at the corresponding time-point. TG, triglyceride; OA, oleic acid; UA, uric acid; MDA, malondialdehyde.

Detection of oxidative stress

The purpose of our study was to detect the variations in oxidative stress in the steatosis cells after treatment with UA. As a result of the antioxidative abilities of UA, we predicted that after treatment of steatosis cells with UA, the oxidative stress should be lowered, especially with low concentrations of UA.

The MDA (Fig. 1C) content of model cells was higher than that of untreated cells at all time-points (P<0.05). All the UA-treated groups showed no significantly differences compared with the untreated groups at 24 h (P>0.05). With an increase in treatment duration, the 5 and 10 mg/dl group had lower MDA levels than the model group (P<0.05), and the MDA level of the 10 mg/dl group was closest to that of the untreated group. However, the 20 and 30 mg/dl treatments could not stop the accumulation of MDA in the model cells after 72 and 96 h, respectively.

The GSH content (Fig. 2A) of model cells was lower than that of untreated cells (P<0.05). All the treated groups show an increasing at different time-point. All four concentrations of UA elevated the GSH content in steatosis cells at 24 h (P<0.05). UA at concentrations of 20 and 30 mg/dl did not elevate the GSH concentration in steatosis cells any further after 24 h (P<0.05), and had no difference compared with model cells (P>0.05) as well as the 10 mg/dl group after 72 h (P<0.05). However, after treatment with 5 mg/dl UA, GSH content was higher than it in the model group over the course of the experiment.

Figure 2.

GSH content and the expression (transcriptional and translational) of γ-GCLC. The steatosis cells were treated with UA at different concentrations (0, 5, 10, 20 and 30 mg/dl) and for different durations (24, 48, 72 and 96 h); untreated cells were used as the control. (A) GSH content, (B) γ-GCLC mRNA expression and (C) γ-GCLC protein expression were then measured. (D) Western blotting was performed to determine protein expression. *P<0.05 and **P<0.01 vs. 24 h cells within the same UA concentration; #P<0.05 and ##P<0.01 vs. control cells at the corresponding time-point. GSH, glutathione; UA, uric acid; γ-GCLC, γ-glutamate-cysteine ligase.

In the transcription results for γ-GCLC (Fig. 2B), there were no statistically significantly differences between the model group and the untreated group (P>0.05). The 30 mg/dl treatment group showed higher transcription levels than the model group (P<0.05). Only the 10 mg/dl group after 72 h had levels lower than that of the untreated group (P<0.05). The other groups did not show statistically significantly differences compared to the untreated group at any time-point (P>0.05). The translation of γ-GCLC (Fig. 2C and D) in the model group was higher than that in the untreated group at all four time-points (P<0.05). The 5 mg/dl group had a lower translational level than the model group, and the 30 mg/dl group showed elevated translation at 96 h in the steatosis cells. The 10 mg/dl group at 24 and 72 h and the 20 mg/dl group at 24, 48, and 96 h showed decreased levels of γ-GCLC in the steatosis cells (P<0.05).

The activity of SOD1 (Fig. 3A) in the model cells was not lower than that of the untreated cells, especially at 24 h (P<0.05), and there were no statistically significantly differences between the two groups from 48 to 96 h. The 5 mg/dl UA group had elevated SOD activity compared to the untreated group (P<0.05), and the 30 mg/dl UA group showed reduced SOD activity compared to the untreated group at 96 h (P<0.05). The transcription level of SOD1 (Fig. 3B) in model cells was higher than that of the untreated group at 48 h. With the exception of the 20 mg/dl group, all the other groups had reduced transcription levels in steatosis cells at 48 h (P<0.05). The 5 and 10 mg/dl groups did not show any differences. However, the transcription level of the 5 mg/dl group was still higher than that of the untreated group at 48 and 72 h (P<0.05). All of the UA-treated groups showed no significantly difference at 96 h (P>0.05). The 10 and 30 mg/dl groups did not show any differences with the untreated group over the course of the experiment (P>0.05). The translation of SOD1 (Fig. 3C and D) in the model cells was higher than that of untreated cells until 96 h (P<0.05). All the UA-treated groups showed higher translation levels than the untreated group at 24 h. The 10 mg/dl group had a lower level compared to the model group from 48 to 96 h, although not significantly different. The 30 mg/dl group had a tendency declined over time, especially at 96 h (P<0.05). However, the other groups showed no consistent trends.

Figure 3.

Activity and expression (transcriptional and translational) of SOD. The steatosis cells were treated with UA at different concentration (0, 5, 10, 20 and 30 mg/dl) and for different times (24, 48, 72 and 96 h); untreated cells were used as the control. (A) SOD1 activity and (B) SOD1 mRNA expression were determined. (C) SOD1 protein expression was measured via (D) western blotting. *P<0.05 and **P<0.01 vs. 24 h cells within the same UA concentration; #P<0.05 and ##P<0.01 vs. control cells at the corresponding time-point. SOD, superoxide dismutase; UA, uric acid.

Intracellular AST and ALT

From the Fig. 4A, there was not a difference in the untreated group and the model group until 96 h (P>0.05). The 10 mg/dl group had no differences compared to the untreated group, and the 20 mg/dl group showed no differences compared with model group from 24 to 72 h. The 5 mg/dl group and 20 mg/dl group showed lower AST levels at 48 h compared with their level at 24 h (P<0.05), and then increased at 72 h (P<0.05), declined at 96 h (P<0.05). In ALT (Fig. 4B), except for the 10 mg/dl group, all the groups had a tendency of increasing over time. There was no difference among the first two time-points compared to the untreated group; however, at the last time-point, a slight increase was observed (P<0.05). Compared to the treated group, the activity of all other groups was higher. The 10 mg/dl group decreased to the level of the untreated group at 96 h (P>0.05). The 30 mg/dl group showed the highest level among all groups from 48 to 72 h (P<0.05). We found that the ALT in 10 mg/dl group at 96 h stopped increasing and it was significantly lower than the model cells.

Figure 4.

Activity of AST and ALT. The steatosis cells were treated with UA at different concentrations (0, 5, 10, 20, 30 mg/dl) and for different times (24, 48, 72 and 96 h); untreated cells were used as the control. (A) ALT and (B) AST activity were determined. *P<0.05 and **P<0.01 vs. 24 h cells within the same UA concentration; #P<0.05 and ##P<0.01 vs. control cells at the corresponding time-point. ALT, alanine aminotransferase; AST, aspartate aminotransferase; UA, uric acid.

Discussion

In the recent two years of the studies correlated to the NAFLD and uric acid, the authors paid primary attention to the relationship between developing of NAFLD and the concentration of SUA (serum uric acid). For example, Zheng et al (19) collected 95924 people from the First Affiliated Hospital of Chongqing Medical University during 2011 to 2014, they found a positive relationship between the concentration of uric acid and the developing of NAFLD, justified the age, BMI and waistline. Fu et al (20) carried out a cross-section study which 5628 people included. They discovered the increased morbidity of metabolic syndrome and NAFLD accompanied with the increased SUA. In addition, Zhou et al (21) found the higher of the SUA level the lower the probability to attenuate the progression. There was not some mechanism studies, and as an antioxidant, uric acid was rarely researched. There were two aspects about the mechanism that uric acid could induce oxidative stress under the existing information studies.

The first is that xanthine oxidase could catalyzed xanthine to uric acid accompanied with generating of ROS, with the substrate of the XO increased, the uric acid and the ROS increased either. With the duration of the stimulation of excess ROS, the OS would generate (22). The second is uric acid could access in cell to generate ROS through NOX (NADPH oxidase) (23), but this viewpoint mainly got from the studies on adipocytes, we did not clear whether this would happen in the hepatocytes.

The features of intracellular OS are the decline of antioxidants and the increase of oxidative products. Living organisms are protected against oxidative damage by enzymatic or non-enzymatic antioxidant molecules such as SOD and GSH (24). GSH is a reductant in oxidation reactions resulting in the formation of GSSG by the catalytic acitivty of GSH-px (25). The catalysis by GCL (glutamate cysteine ligase) is the rate-limiting step in GSH biosynthesis (26). Superoxide is dismutated to hydrogen peroxide, a far less reactive product, by the action of a family of metalloenzymes known as SOD (27).

In this study, the content of GSH in the model group at each time-point was significantly lower than that in the untreated group, as indicated by enzyme activity. This may be because of the oxidative stress induced by steatosis. As mentioned above, UA is a bifunctional substance. From this result, we found that the 10 mg/dl treatment has the ability to lower OS to a level similar to that of the untreated group. However, the higher concentration groups did not show enhancement in the levels of GSH in model cells. The transcription levels of γ-GCLC in all the groups tended to be lower compared to the model cells. However, 5 and 10 mg/dl groups showed low levels of transcription at all time-points. The translation of γ-GCLC in the 5 mg/dl group declined before 96 h and then was stabilized at 96 h. The 10 mg/dl group and 20 mg/dl group did not have a stabilizing effect. The GSH-related indexes suggest that 30 mg/dl UA can aggravate the OS, and 5 and 10 mg/dl may have a protective role.

SOD is the main free-radical scavenger that can significantly reduce free radical damage to the body. It is an active substance generated by living organisms, which can eliminate harmful materials such as free radicals produced during normal oxygen metabolism (28). It can react with oxygen free radicals to generate hydrogen peroxide (29); the latter is converted into water by the organism and excreted. Thus, SOD1 activity represents the free radical scavenging ability of the body. Lipid peroxidation and bodily damage are also concomitantly increased. Under normal conditions, SOD1 release would also gradually increase to maintain the balance between oxidation and antioxidation (30). Before the experiment, we predicted that under the oxidative stress of the model group, the activity and the transcription, as well as the translation of SOD1 would be lower than that of the untreated group, and that of one or more UA-treated groups would be higher than the model group; however, in this study, we did not observe this phenomenon. The activity and translation of SOD in the model group was higher than the untreated group. This is contrary to the results of Jiang et al (31). The reason for this might be that the accumulation of fat in the model cells could not induce stress enough to reduce SOD. With the increased demand for antioxidants, the translation of SOD increased to adapt to the increased oxidizability. However, with the increase of SOD level, no matter the translation or activity, we observed that 10 and 30 mg/dl UA treatment relaxed the demands for SOD1 at 24 and 48 h, but only 10 mg/dl stop the SOD1 from continuously increasing or decreasing. From the result of RT-qPCR, all of the treated groups had high transcription levels of SOD1 relative to that of untreated cells at 48 h, and all the UA-treated groups had lowered transcription levels of SOD1. Interestingly, the demand for SOD1 in the model cells seemed to gradually decline, and there was no statistical difference after 72 h between the untreated cells and the model cells. The same phenomenon was found in the results for the transcription of γ-GCLC. We guessed that the fat accumulated in cells was metabolized gradually over time, and the model cells recovered from the oxidative stress. In other words, the oxidative stress was relaxed gradually in the model cells, and compared to SOD1, GSH might the more sensitive indicator of OS in this experiment because of the low GSH levels from the beginning to the end.

MDA is a toxic end product of lipid peroxidation, and its content can directly reflect the rate and extent of lipid peroxidation and indirectly reflect the capacity for eliminating free radicals (32). In our study, the MDA content increased depending on the time, and the 5 and 10 mg/dl treatment groups showed decreased MDA content at each of the time-points compared with model cells. This reflects a relaxed intracellular OS.

Serum aminotransferase, especially ALT, has become the standard biomarker for detection of liver injury (33). But it is rare to study the relationship between the cell damage by OS and intracellular aminotransferase. In our study, we found the ALT activity increased in a time-dependent manner. It seems that 10 mg/dl UA at 96 h has a beneficial effect. However, for AST, we could not found a tendency dependent on time, This result conflicts with that of Wang et al (17), and it needs to be further researched. ALT is the enzyme that catalyzes the conversions of α-ketoglutarate to glutamate and pyruvic acid to alanine and is a rate-controlling enzyme for gluconeogenesis in the liver (34). AST is the enzyme that catalyzes the conversion of oxaloacetate to aspartate (35). Oxaloacetate and α-ketoglutarate are important intermediates in the tricarboxylic acid cycle (TCA). The α-ketoglutarate/glutamate pair and oxaloacetate/aspartate pair have strategically important roles in amino acid metabolism. However, the correlation, as well as the mechanism, between the two transaminases and degree of cell damage intracelluler is not clear. As NAFLD is a disorder of energy metabolism, AST and ALT may play roles and are thus merit further study.

From the above, we found that the concentration under 10 mg/dl (included) could serve as an antioxidant in the steatosis hepatocytes. This is not consistent with other studies mentioned above, ROS could generate as a by-product in the uric acid generation in preceding introduction, but our intervention via UA had no correlation with UA generating in organism, so do the ROS. So, we could say these two behaviors were two different processes, it's not strange we got different result compare to the in vivo studies. The antioxidative activity could occur in the brain, being a protector for several disease such as multiple sclerosis and neurodegenerative disease, as well as cardiac and renal toxicity in another study (16). We think this beneficial may also be speculated on the liver.

We found that treatment with 5 and 10 mg/dl UA caused a relaxing effect on OS in our steatosis cell model. Additionally, 30 mg/dl UA may aggravate OS. We suggest that UA may have a protective role in OS.

The steatosis cell model created with 0.3 mM OA treatment for 24 h is not sufficient to induce a decrease in intracelluar SOD1; thus, a better model should be the focus of future study.

Acknowledgements

This study was supported by First Affiliated Hospital of Xinjiang Medical University and School of Public Health of Xinjiang Medical University and we thank them for their technical assistance. Research partially supported by the Natural Science Foundation of the Xinjiang Uygur Autonomous Region, China (no. 2015211C011 to L. Ma), which appropriated 70 thousand RMB for funds to carry this research out.

Glossary

Abbreviations

Abbreviations:

NAFLD

nonalcoholic fatty liver disease

U

uric acid

OS

oxidative stress

TG

triglyceride

MDA

malonaldehyde

SOD1

superoxide dismutase 1

γ-GCLC

γ-glutamate-cysteine ligase

GSH

glutathione

ALT

alanine aminotransferase

AST

aspartate aminotransferase

ROS

reactive oxygen species

MTT

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide;

References

1 

Gori M, Simonelli MC, Giannitelli SM, Businaro L, Trombetta M and Rainer A: Investigating nonalcoholic fatty liver disease in a liver-on-a-chip microfluidic device. PLoS One. 11:e01597292016. View Article : Google Scholar : PubMed/NCBI

2 

Cheung O and Sanyal AJ: Recent advances in nonalcoholic fatty liver disease. Curr Opin Gastroenterol. 26:202–208. 2010. View Article : Google Scholar : PubMed/NCBI

3 

Gan L, Xiang W, Xie B and Yu L: Molecular mechanisms of fatty liver in obesity. Front Med. 9:275–287. 2015. View Article : Google Scholar : PubMed/NCBI

4 

Karadeniz G, Acikgoz S, Tekin IO, Tascýlar O, Gun BD and Cömert M: Oxidized low-density-lipoprotein accumulation is associated with liver fibrosis in experimental cholestasis. Clinics (Sao Paulo). 63:531–540. 2008. View Article : Google Scholar : PubMed/NCBI

5 

Gentric G, Maillet V, Paradis V, Couton D, L'Hermitte A, Panasyuk G, Fromenty B, Celton-Morizur S and Desdouets C: Oxidative stress promotes pathologic polyploidization in nonalcoholic fatty liver disease. J Clin Invest. 125:981–992. 2015. View Article : Google Scholar : PubMed/NCBI

6 

Fiskum G, Rosenthal RE, Vereczki V, Martin E, Hoffman GE, Chinopoulos C and Kowaltowski A: Protection against ischemic brain injury by inhibition of mitochondrial oxidative stress. J Bioenerg Biomembr. 36:347–352. 2004. View Article : Google Scholar : PubMed/NCBI

7 

Satapati S, Kucejova B, Duarte JA, Fletcher JA, Reynolds L, Sunny NE, He T, Nair LA, Livingston KA, Fu X, et al: Mitochondrial metabolism mediates oxidative stress and inflammation in fatty liver. J Clin Invest. 125:4447–4462. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Browning JD and Horton JD: Molecular mediators of hepatic steatosis and liver injury. J Clin Invest. 114:147–152. 2004. View Article : Google Scholar : PubMed/NCBI

9 

Xiao J, Ho CT, Liong EC, Nanji AA, Leung TM, Lau TY, Fung ML and Tipoe GL: Epigallocatechin gallate attenuates fibrosis, oxidative stress, and inflammation in non-alcoholic fatty liver disease rat model through TGF/SMAD, PI3 K/Akt/FoxO1, and NF-kappa B pathways. Eur J Nutr. 53:187–199. 2014. View Article : Google Scholar : PubMed/NCBI

10 

Sanyal AJ, Campbell-Sargent C, Mirshahi F, Rizzo WB, Contos MJ, Sterling RK, Luketic VA, Shiffman ML and Clore JN: Nonalcoholic steatohepatitis: Association of insulin resistance and mitochondrial abnormalities. Gastroenterology. 120:1183–1192. 2001. View Article : Google Scholar : PubMed/NCBI

11 

Chalasani N, Deeg MA and Crabb DW: Systemic levels of lipid peroxidation and its metabolic and dietary correlates in patients with nonalcoholic steatohepatitis. Am J Gastroenterol. 99:1497–1502. 2004. View Article : Google Scholar : PubMed/NCBI

12 

Yesilova Z, Yaman H, Oktenli C, Ozcan A, Uygun A, Cakir E, Sanisoglu SY, Erdil A, Ates Y, Aslan M, et al: Systemic markers of lipid peroxidation and antioxidants in patients with nonalcoholic Fatty liver disease. Am J Gastroenterol. 100:850–855. 2005. View Article : Google Scholar : PubMed/NCBI

13 

Ames BN, Cathcart R, Schwiers E and Hochstein P: Uric acid provides an antioxidant defense in humans against oxidant- and radical-caused aging and cancer: A hypothesis. Proc Natl Acad Sci USA. 78:pp. 6858–6862. 1981; View Article : Google Scholar : PubMed/NCBI

14 

Bonora E, Targher G, Zenere MB, Saggiani F, Cacciatori V, Tosi F, Travia D, Zenti MG, Branzi P, Santi L and Muggeo M: Relationship of uric acid concentration to cardiovascular risk factors in young men. Role of obesity and central fat distribution. The verona young men atherosclerosis risk factors study. Int J Obes Relat Metab Disord. 20:975–980. 1996.PubMed/NCBI

15 

Yoo TW, Sung KC, Shin HS, Kim BJ, Kim BS, Kang JH, Lee MH, Park JR, Kim H, Rhee EJ, et al: Relationship between serum uric acid concentration and insulin resistance and metabolic syndrome. Circ J. 69:928–933. 2005. View Article : Google Scholar : PubMed/NCBI

16 

Lombardi R, Pisano G and Fargion S: Role of serum uric acid and ferritin in the development and progression of NAFLD. Int J Mol Sci. 17:5482016. View Article : Google Scholar : PubMed/NCBI

17 

Wang JW, Wan XY, Zhu HT, Lu C, Yu WL, Yu CH, Shen Z and Li YM: Lipotoxic effect of p21 on free fatty acid-induced steatosis in L02 cells. PLoS One. 9:e961242014. View Article : Google Scholar : PubMed/NCBI

18 

Lanaspa MA, Sanchez-Lozada LG, Choi YJ, Cicerchi C, Kanbay M, Roncal-Jimenez CA, Ishimoto T, Li N, Marek G, Duranay M, et al: Uric acid induces hepatic steatosis by generation of mitochondrial oxidative stress: Potential role in fructose-dependent and -independent fatty liver. J Biol Chem. 287:40732–40744. 2012. View Article : Google Scholar : PubMed/NCBI

19 

Zheng X, Gong L, Luo R, Chen H, Peng B, Ren W and Wang Y: Serum uric acid and non-alcoholic fatty liver disease in non-obesity Chinese adults. Lipids Health Dis. 16:2022017. View Article : Google Scholar : PubMed/NCBI

20 

Fu YQ, Yang H, Zheng JS, Zeng XY, Zeng W, Fan ZF, Chen M, Wang L and Li D: Positive association between metabolic syndrome and serum uric acid in Wuhan. Asia Pac J Clin Nutr. 26:343–350. 2017.PubMed/NCBI

21 

Zhou Z, Song K, Qiu J, Wang Y, Liu C, Zhou H, Xu Y, Guo Z, Zhang B and Dong C: Associations between serum Uric acid and the remission of non-alcoholic fatty liver disease in chinese males. PLoS One. 11:e01660722016. View Article : Google Scholar : PubMed/NCBI

22 

Kushiyama A, Nakatsu Y, Matsunaga Y, Yamamotoya T, Mori K, Ueda K, Inoue Y, Sakoda H, Fujishiro M, Ono H and Asano T: Role of Uric acid metabolism-related inflammation in the pathogenesis of metabolic syndrome components such as atherosclerosis and nonalcoholic steatohepatitis. Mediators Inflamm. 2016:86031642016. View Article : Google Scholar : PubMed/NCBI

23 

Sautin YY, Nakagawa T, Zharikov S and Johnson RJ: Adverse effects of the classic antioxidant uric acid in adipocytes: NADPH oxidase-mediated oxidative/nitrosative stress. Am J Physiol Cell Physiol. 293:C584–C596. 2007. View Article : Google Scholar : PubMed/NCBI

24 

Valavanidis A, Vlachogianni T, Fiotakis K and Loridas S: Pulmonary oxidative stress, inflammation and cancer: Respirable particulate matter, fibrous dusts and ozone as major causes of lung carcinogenesis through reactive oxygen species mechanisms. Int J Environ Res Public Health. 10:3886–3907. 2013. View Article : Google Scholar : PubMed/NCBI

25 

Annuk M, Zilmer M, Lind L, Linde T and Fellström B: Oxidative stress and endothelial function in chronic renal failure. J Am Soc Nephrol. 12:2747–2752. 2001.PubMed/NCBI

26 

Chen Y, Shertzer HG, Schneider SN, Nebert DW and Dalton TP: Glutamate cysteine ligase catalysis: Dependence on ATP and modifier subunit for regulation of tissue glutathione levels. J Biol Chem. 280:33766–33772. 2005. View Article : Google Scholar : PubMed/NCBI

27 

Vaziri ND, Dicus M, Ho ND, Boroujerdi-Rad L and Sindhu RK: Oxidative stress and dysregulation of superoxide dismutase and NADPH oxidase in renal insufficiency. Kidney Int. 63:179–185. 2003. View Article : Google Scholar : PubMed/NCBI

28 

Broxton CN and Culotta VC: SOD enzymes and microbial pathogens: Surviving the oxidative storm of infection. PLoS Pathog. 12:e10052952016. View Article : Google Scholar : PubMed/NCBI

29 

Kondo Y, Masutomi H, Noda Y, Ozawa Y, Takahashi K, Handa S, Maruyama N, Shimizu T and Ishigami A: Senescence marker protein-30/superoxide dismutase 1 double knockout mice exhibit increased oxidative stress and hepatic steatosis. FEBS Open Bio. 522–532. 2014. View Article : Google Scholar : PubMed/NCBI

30 

Li XD, Sun GF, Zhu WB and Wang YH: Effects of high intensity exhaustive exercise on SOD, MDA, and NO levels in rats with knee osteoarthritis. Genet Mol Res. 14:12367–12376. 2015. View Article : Google Scholar : PubMed/NCBI

31 

Jiang J, Yu S, Jiang Z, Liang C, Yu W, Li J, Du X, Wang H, Gao X and Wang X: N-acetyl-serotonin protects HepG2 cells from oxidative stress injury induced by hydrogen peroxide. Oxid Med Cell Longev. 2014:3105042014. View Article : Google Scholar : PubMed/NCBI

32 

Zhou F, Sun W and Zhao M: Controlled formation of emulsion gels stabilized by salted myofibrillar protein under malondialdehyde (MDA)-induced oxidative stress. J Agric Food Chem. 63:3766–3777. 2015. View Article : Google Scholar : PubMed/NCBI

33 

Thulin P, Rafter I, Stockling K, Tomkiewicz C, Norjavaara E, Aggerbeck M, Hellmold H, Ehrenborg E, Andersson U, Cotgreave I and Glinghammar B: PPARalpha regulates the hepatotoxic biomarker alanine aminotransferase (ALT1) gene expression in human hepatocytes. Toxicol Appl Pharmacol. 231:1–9. 2008. View Article : Google Scholar : PubMed/NCBI

34 

Liu L, Zhong S, Yang R, Hu H, Yu D, Zhu D, Hua Z, Shuldiner AR, Goldstein R, Reagan WJ and Gong DW: Expression, purification, and initial characterization of human alanine aminotransferase (ALT) isoenzyme 1 and 2 in High-five insect cells. Protein Expr Purif. 60:225–231. 2008. View Article : Google Scholar : PubMed/NCBI

35 

Xu Q, Higgins T and Cembrowski GS: Limiting the testing of AST: A diagnostically nonspecific enzyme. Am J Clin Pathol. 144:423–426. 2015. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Cheng S, Yang Y, Zhou Y, Xiang W, Yao H and Ma L: Influence of different concentrations of uric acid on oxidative stress in steatosis hepatocytes. Exp Ther Med 15: 3659-3665, 2018.
APA
Cheng, S., Yang, Y., Zhou, Y., Xiang, W., Yao, H., & Ma, L. (2018). Influence of different concentrations of uric acid on oxidative stress in steatosis hepatocytes. Experimental and Therapeutic Medicine, 15, 3659-3665. https://doi.org/10.3892/etm.2018.5855
MLA
Cheng, S., Yang, Y., Zhou, Y., Xiang, W., Yao, H., Ma, L."Influence of different concentrations of uric acid on oxidative stress in steatosis hepatocytes". Experimental and Therapeutic Medicine 15.4 (2018): 3659-3665.
Chicago
Cheng, S., Yang, Y., Zhou, Y., Xiang, W., Yao, H., Ma, L."Influence of different concentrations of uric acid on oxidative stress in steatosis hepatocytes". Experimental and Therapeutic Medicine 15, no. 4 (2018): 3659-3665. https://doi.org/10.3892/etm.2018.5855
Copy and paste a formatted citation
x
Spandidos Publications style
Cheng S, Yang Y, Zhou Y, Xiang W, Yao H and Ma L: Influence of different concentrations of uric acid on oxidative stress in steatosis hepatocytes. Exp Ther Med 15: 3659-3665, 2018.
APA
Cheng, S., Yang, Y., Zhou, Y., Xiang, W., Yao, H., & Ma, L. (2018). Influence of different concentrations of uric acid on oxidative stress in steatosis hepatocytes. Experimental and Therapeutic Medicine, 15, 3659-3665. https://doi.org/10.3892/etm.2018.5855
MLA
Cheng, S., Yang, Y., Zhou, Y., Xiang, W., Yao, H., Ma, L."Influence of different concentrations of uric acid on oxidative stress in steatosis hepatocytes". Experimental and Therapeutic Medicine 15.4 (2018): 3659-3665.
Chicago
Cheng, S., Yang, Y., Zhou, Y., Xiang, W., Yao, H., Ma, L."Influence of different concentrations of uric acid on oxidative stress in steatosis hepatocytes". Experimental and Therapeutic Medicine 15, no. 4 (2018): 3659-3665. https://doi.org/10.3892/etm.2018.5855
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team