Open Access

Baicalin attenuates liver hypoxia/reoxygenation injury by inducing autophagy

  • Authors:
    • Feng Liu
    • Jing Zhang
    • Jianmin Qian
    • Gang Wu
    • Zhenyu Ma
  • View Affiliations

  • Published online on: June 8, 2018     https://doi.org/10.3892/etm.2018.6284
  • Pages: 657-664
  • Copyright: © Liu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

The aim of the present study was to explore the effect of baicalin on liver hypoxia/reoxygenation (H/R) injury and the possible mechanism involved. A cellular H/R model was established and cells were treated with 50, 100 and 200 µmol/l baicalin. Following reoxygenation for 6 h, cell viability, lactate dehydrogenase (LDH), B‑cell lymphoma 2 (Bcl‑2), Bcl‑2‑associated X protein (Bax), caspase 3 and cleaved caspase 3 were assessed. Furthermore, levels of endoplasmic reticulum stress markers binding of immunoglobulin protein (BIP) and CCAAT/enhancer‑binding protein homologous protein (CHOP) and autophagy markers microtubule‑associated proteins 1A/1B light chain 3B (LC3) and beclin 1 were measured. To confirm the involvement of autophagy in baicalin‑mediated attenuation of H/R injury, the autophagy inhibitor 3‑methyladenine (3‑MA) was administered. The results revealed that baicalin administration increased cell viability and decreased LDH levels, most notably at a dosage of 100 µmol/l. Baicalin pretreatment also downregulated the expression of caspase 3, cleaved caspase 3 and Bax, while upregulating the expression of Bcl‑2. Furthermore, BIP and CHOP were decreased while LC3 and beclin‑1 were significantly increased by baicalin pretreatment. Inhibiting autophagy using 3‑MA, resulted in a significant decrease in LC3‑II, beclin‑1 and LDH, as well as increase in the expression of BIP, CHOP, caspase 3, cleaved caspase 3 and Bax. Bcl‑2 and cell viability were also decreased. In conclusion, the results of the present study indicate that baicalin exerts a protective effect on liver H/R injury and this may be achieved via the induction of autophagy.

Introduction

Liver ischemia reperfusion (IR) injury is a process initiated by hypoxia, which causes cellular damage, followed by the return of blood flow and oxygen delivery, which exacerbates cellular damage (1,2). Overproduction of reactive oxygen species (ROS) and superoxide free radicals in IR causes the destruction of the hepatic cellular membrane and increases their permeability, leading to hepatocyte death and hepatic injury (3). Liver IR occurs in a number of clinical settings, including liver transplantation, partial hepatic resection, shock and hepatic failure (46) At present, there is no effective prevention strategy for liver IR injury and there is there for an urgent need for the development of new treatments.

Baicalin is a flavonoid glycoside extracted from the root of the traditional Chinese medicinal herb Scutellaria baicalensis (7). It has been documented that baicalin possesses a number of pharmacological actions, including anti-inflammatory, anti-bacterial, anti-fibrotic, anti-oxidant and anticancer effects (711). Previous studies have reported that baicalin serves a protective effect in IR injury in various organs, including the kidneys, brain and heart (1214). It has been reported that baicalin may be able to induce autophagy, as evidenced by elevated expression of microtubule-associated proteins 1A/1B light chain 3B LC3 and beclin-1 in human bladder T24 cells (15) and human hepatocellular carcinoma SMMC-7721 cells following baicalin treatment (16).

Autophagy is an important intracellular process for degrading macromolecules, as well as recycling cytosolic proteins and organelles, to maintain cellular homeostasis (17). When cellular components are engulfed into double or multiple-membrane cytoplasmic vesicles, autophagosomes are formed, which subsequently fuse with lysosomes, forming autolysosomes and degrading the captured proteins or organelles with lysosomal enzymes (15,18). Autophagy is believed to exert a beneficial effect in IR injury; autophagy ameliorates liver damage when hepatocytes suffer from anoxia or nutrient starvation during IR insults (19). It has also been reported that rapamycin, a mechanistic target of rapamycin (mTOR) inhibitor and potent autophagy inducer, attenuates tubular injury and renal dysfunction by promoting autophagy in acute kidney injury (20), demonstrating the protective role of autophagy in IR injury.

The aim of the present study was to investigate the effect of baicalin on liver IR injury and its relationship with autophagy. The results of the present study indicate that baicalin may be an effective clinical treatment for liver IR injury.

Materials and methods

Cell culture and establishment of hypoxia/reoxygenation model

Normal human liver LO2 cells were purchased from the Chinese Academy of Science (Shanghai, China) and maintained in Dulbecco's modified Eagle's medium/F-12 nutrient mixture (DMEM-F12; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin-streptomycin in 21% O2 at 37°C. Hypoxia/reoxygenation (H/R) was performed as previously described (21). Briefly, cells were seeded in 6-well plates at a density of 105 cells/well. At 80% confluence, the 6-well plates were incubated under hypoxic conditions (94% N2, 5% CO2 and 1% O2 at 37°C) for 24 h in a hypoxia chamber. Cells were then removed from the hypoxia chamber and incubated for 6 h in an atmosphere containing 5% CO2 at 37°C. A total of 6 groups (n=3 each) were established: Control group, H/R group, 50 µmol/l baicalin group, 100 µmol/l baicalin group, 200 µmol/l baicalin group and 3-methyladenine (3-MA; 5 mmol/l) group. In the control group, LO2 cells were cultured under normal culture conditions only. In the baicalin and 3-MA groups, baicalin (cat. no. 572667) or 3-MA (cat. no. M9281) (both Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) was added 1 h prior to H/R.

Cell viability analysis

Cells were seeded in a 96-well plate at a density of 2,000 cells/well. Following 24 h hypoxia and 6 h reoxygenation, cell survival was assessed using a Cell Counting kit-8 (CCK-8) kit (Beyotime Institute of Biotechnology, Haimen, China). Briefly, 10 µl of CCK-8 reagent was added to each well and incubated for 2 h at 37°C. Cell density was determined by measuring the absorbance at 450 nm using a microplate reader (MDC Vacuum Products, LLC, Hayward, CA, USA).

Lactate dehydrogenase (LDH) activity assay

The supernatant from the 96-well plates were collected by centrifugation at 500 × g for 5 min at 25°C. LDH activity in the supernatant (20 µl) was measured using a LDH assay kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) in accordance with the manufacturer's protocol.

Annexin V and phosphatidylinositol (PI) binding staining

Cells were washed twice with PBS and resuspended in 500 µl staining buffer (Beyotime Institute of Biotechnology) at a concentration of 105 cells/ml with 5 µl Annexin V-fluorescein isothiocyanate (FITC; Beyotime Institute of Biotechnology) and 5 µl PI. Cells were gently mixed and incubated for 15 min at 37°C in the dark. A total of 400 µl cell suspension was transferred into flow tubes and analyzed using a BD FACS Aria II flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA). The flow cytometry data were analyzed using FlowJo 6.0 software (FlowJo LLC, Ashland, OR, USA).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extract from LO2 cells using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. A total of 3–5 µg of RNA was transcribed into cDNA using a RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Inc.). Reverse transcription was performed at 42°C for 60 min, followed by 70°C for 5 min. Primers used for RT-qPCR are listed in Table I. qPCR was conducted using the SYBR Green premix kit from Takara Bio, Inc. (Otsu, Japan). Thermocycling conditions were as follows: Initial denaturation at 95°C for 30 sec followed by 50 cycles of 95°C for 5 sec, 60°C for 30 sec and 72°C for 60 sec. Expression levels were normalized to β-actin in the same samples using the 2−ΔΔCq method (7).

Table I.

Gene specific primers used for reverse transcription-quantitative polymerase chain reaction.

Table I.

Gene specific primers used for reverse transcription-quantitative polymerase chain reaction.

GenePrimer sequence
Binding of immunoglobulin proteinSense: AAAGAAGACGGGCAAAGATGT
Antisense: TGCTTGATGCTGAGAAGACAG
CCAAT/enhancer-binding protein homologous proteinSense: ACCACTCTTGACCCTGCTTCT
Antisense: CTCTGGGAGGTGCTTGTGAC
β-actinSense: GTTGTCGACGACGAGCG
Antisense: GCACAGAGCCTCGCCTT
Western blotting

LO2 cells were washed with PBS three times and ice-cold radioimmunoprecipitation assay buffer (Vazyme, Piscataway, NJ, USA) was added for cell lysis. Lysates were centrifuged at 12,000 × g at 4°C for 25 min. The supernatant was collected and total proteins were quantified by bicinchoninic acid assay. Samples (20 µg) were separated by 10% SDS-PAGE, transferred onto a polyvinylidene fluoride membranes and blocked with 5% skimmed milk for 1 h at room temperature. Membranes were subsequently incubated with primary antibodies against the following: B-cell lymphoma 2 (Bcl-2; cat. no. 2872), Bcl-2-associated X protein (Bax; cat. no. 5023), caspase 3 (cat. no. 9662), cleaved caspase 3 (cat. no. 9661), binding of immunoglobulin protein (BIP; cat. no. 3177), CCAAT/enhancer-binding protein homologous protein (CHOP; cat. no. 2895), beclin-1 (cat. no. 3495), LC3 (cat. no. 4108), activating transcription factor 4 (ATF4; cat. no. 11815), X-box binding protein 1 (XBP-1; cat. no. 83418) and GAPDH (cat. no. 5174; all 1:1,000; all Cell Signaling Technology, Inc., Danvers, MA, USA) at 4°C overnight. Membranes were washed with 1X TBS with 1% Tween-20 and incubated with horseradish-conjugated goat anti-rabbit secondary antibodies (cat. no. ab6721; 1:10,000; Abcam) for 1 h at room temperature. Immunoreactive bands were visualized using a chemiluminescence solution (Thermo Fisher Scientific, Inc.) and normalized to GAPDH using Image J software version 1.8.0 (National Institutes of Health, Bethesda, MA, USA).

Statistical analysis

Results are presented as the mean ± standard deviation. Statistical analysis was performed using one-way analysis of variance with Bonferroni's correction on SPSS 20 software (IBM Corp., Armonk, NY, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

Baicalin pretreatment attenuates H/R-induced damage to LO2 cells

Cell viability and LDH levels were detected to investigate the effect of baicalin on LO2 cell damage. The results demonstrated that, compared with the control group, cell viability was decreased in the H/R group. Treatment with 100 µmol/l baicalin significantly ameliorated the effects of H/R (Fig. 1A). LDH, a marker of cell injury, was significantly elevated in the H/R group, while pretreatment with 100 µmol/l baicalin significantly reversed this effect (Fig. 1B). These results suggest that baicalin pretreatment attenuated H/R-induced damage in LO2 cells.

Baicalin pretreatment inhibits apoptosis following H/R

Bcl-2 is an anti-apoptotic protein, whereas Bax is a pro-apoptotic protein (12). Bcl-2 protein expression was lower in the H/R group compared with the control, whereas Bax expression was increased (Fig. 2A). Pretreatment with baicalin significantly increased the expression of Bcl-2 and inhibited the expression of Bax compared with the H/R group (Fig. 2A). The results of flow cytometry revealed that the percentage of apoptotic cells in the H/R group was increased compared with the control group; however, pretreatment with 100 µmol/l baicalin significantly decreased apoptosis compared with the H/R group (Fig. 2B). These results suggest that baicalin pretreatment inhibits apoptosis following H/R.

Baicalin pretreatment decreases caspase 3 expression following H/R

Caspase 3 is a downstream effector in the caspase cascade that directly mediates apoptosis upon activation by multiple upstream signals (22). Therefore, caspase 3 is regarded as an important pro-apoptotic indicator. Caspase 3 and cleaved caspase 3 were increased in the H/R group compared with the control group (Fig. 2C). In contrast, pretreatment with 100 µmol/l significantly decreased the expression of caspase 3 and cleaved caspase 3 compared with the H/R group (Fig. 2C).

Baicalin pretreatment inhibits endoplasmic reticulum (ER) stress following H/R

ER stress was assessed by measuring the expression of BIP and CHOP. Compared with the control group, levels of BIP and CHOP mRNA were higher in the H/R group, whereas pretreatment with 100 µmol baicalin significantly ameliorated the effects of H/R (Fig. 3A). Furthermore, the expression of BIP and CHOP at the protein level was increased in the H/R group compared with the control and significantly decreased in the 100 µmol/l baicalin group compared with the H/R group (Fig. 3B). These results suggest that baicalin pretreatment inhibits ER stress following H/R.

Baicalin pretreatment induced autophagy in vitro

To investigate whether baicalin pretreatment is able to induce autophagy, the expression of LC3 and beclin-1 was assessed. The results of western blotting revealed that the expression of LC3-II and beclin-1 were increased in the H/R group compared with the control (Fig. 4A). Furthermore, 100 µmol/l baicalin pretreatment significantly increases the expression of LC3-II and beclin 1 following H/R (Fig. 4A).

Baicalin pretreatment inhibits ER stress-induced autophagy in vitro

It has been reported that ER stress induces autophagy, whereas ATF4 and XBP1 are regarded as important inducers of autophagy following ER stress (23,24). Western blotting revealed that ATF4 and XBP1 was upregulated in the H/R group compared with the control (Fig. 4B). In contrast, baicalin pretreatment significantly reduced the expression of ATF4 and XBP1 compared with the H/R group (Fig. 4B).

Autophagy inhibition abrogates the protective effect of baicalin in vitro

To further confirm the role of autophagy in H/R injury, the autophagy inhibitor 3-MA was used. The results revealed that LC3-II and beclin-1 levels were increased in the H/R group compared with the control and further increased with baicalin pretreatment (Fig. 5A). However, co-administration with 3-MA significantly decreased the expression of LC3-II and beclin-1 compared with baicalin treatment alone (Fig. 5A).

To further investigate the effect of autophagy inhibition in H/R, the expression of caspase-3, cleaved caspase 3, Bcl-2, Bax, BIP and CHOP, as well as cell viability and LDH levels were measured. Co-treatment with 3-MA significantly increased the expression of caspase-3, cleaved caspase 3, Bcl-2, Bax, BIP and CHOP (Fig. 5A). Furthermore, cell viability was significantly decreased in the baicalin + 3-MA treatment group compared with baicalin treatment alone (Fig. 5B). LDH levels were significantly increased with 3-MA treatment compared with baicalin treatment alone (Fig. 5C). These results suggest that autophagy inhibition abrogates the protective effect of baicalin on apoptosis and ER stress in LO2 cells.

Discussion

As a flavonoid glycoside extracted from the root of the traditional Chinese medicinal herb Scutellaria baicalensis, baicalin has been reported to possess a protective effect against IR injury in multiple organs (1214). Zheng et al (13) demonstrated that baicalin treatment led to significantly reduced neurological deficit, smaller infarct volume and enhanced expression of induced myeloid leukemia cell differentiation protein-1 and BCL-2 in a rat model of cerebral artery occlusion/reperfusion, suggesting that baicalin's protective effect against cerebral IR injury is achieved via the inhibition of ischemia-induced neuronal apoptosis. Kong et al (14) revealed that baicalin improved left ventricular function, reduced creatine kinase and LDH release in the coronary effluent, and increased SOD and MDA activity in rats with IR injury. Lin et al (12) demonstrated that baicalin ameliorates kidney IR injury by inhibiting the production of proinflammatory cytokines, including tumor necrosis factor-α and interleukin-1β. In agreement with previous studies, the results of the present study demonstrated that baicalin pretreatment is able to attenuate hepatic injury and inhibit LO2 apoptosis, possibly via the induction of autophagy.

The upregulation of Bcl-2, downregulation of Bax and decreased percentage of apoptotic cells in the baicalin group indicated that apoptosis was decreased following baicalin pretreatment. Decreased apoptosis is associated with deactivation of the caspase cascade (22). As a downstream effector in the caspase cascade, caspase 3 directly mediates apoptosis when activated by various upstream signals (22) and as such has been reported to be a crucial modulator of apoptosis. In the present study, caspase 3 and cleaved caspase 3 were upregulated in the H/R group, but baicalin pretreatment was able to significantly decrease their expression, indicating that baicalin inhibits LO2 cells apoptosis.

ER stress is a cellular stress condition that disrupts ER function and results in massive accumulation of unfolded or misfolded proteins in the ER lumen (25). To maintain ER homeostasis, a series of adaptive responses called the unfolded protein response (UPR) is triggered upon ER stress (12). This process is mediated by 3 major stress sensors, namely inositol-requiring protein 1 (IRE1), ATF6 and protein kinase RNA-like ER kinase (22). UPR is associated with decreased protein load and upregulated ER chaperones, including BIP (22). With persisting ER stress, UPR fails and cells progress into the apoptosis phase, in which CHOP accumulation, IRE1 phosphorylation and c-JUN N-terminal kinase are activated (22). Herein, BIP and CHOP are regarded as vital markers of ER stress. In the present study, the expression of BIP and CHOP were increased in the H/R group and decreased by baicalin pretreatment, implying that ER stress occurs following H/R and may be successfully inhibited by baicalin pretreatment.

Autophagy is a lysosome-dependent dynamic intracellular pathway that involving the delivery and degradation of unfolded or misfolded proteins (26). It has been documented that ER stress is a potent trigger of autophagy (27). In the process of UPR, ATF4 and XBP-1 induce autophagy (23,24). In the present study, increased ATF4 and XBP-1 levels were observed in the H/R group. Similarly, beclin 1 and LC3-II were upregulate in the H/R group. Pretreatment with baicalin inhibited the expression of ATF4 and XBP-1; however, beclin 1 and LC3-II levels remained high in the baicalin groups, particularly at the 100 µmol/l dosage, revealing that baicalin pretreatment inhibited ER-induced autophagy and that baicalin is a potent inducer of autophagy. This ability is similar to that of a previously reported immunosuppressive drug, rapamycin (28). Zhu et al (28) revealed that, in a mouse model of, ischemia reperfusion injury and thapsigargin-treated primary hepatocytes, ATF4 and XBP1 were markedly upregulated, whereas rapamycin treatment downregulated their expression; in addition, it was also revealed that rapamycin is able to enhance autophagy.

To demonstrate the role of autophagy in the baicalin-mediated protective effect on H/R, the autophagy inhibitor 3-MA was administered. 3-MA is a commonly used autophagy inhibitor and is a specific inhibitor of autophagic/lysosomal protein degradation and the formation of autophagosomes (29). The phosphoinositide 3 kinase (PI3K)/protein kinase B (AKT)/mammalian target of rapamycin (mTOR) pathway has been implicated in autophagy (29). AKT is downstream of class I and class III PI3K (30). Class I PI3K is a major upstream modulator of mTOR that causes the suppression of autophagy, while the class III PI3K pathway has been recognized to activate autophagy through sequestration of cytoplasmic material (30). It has been reported that 3-MA is able to inhibit the class III PI3K pathway, thus inhibiting autophagy (31). The results of the present study revealed that pretreatment with 3-MA markedly inhibited autophagy, as evidenced by low expression of beclin-1 and LC3-II. Furthermore, high expression of BIP and CHOP were detected following the inhibition of autophagy, suggesting that autophagy inhibition aggravates ER stress. This is consistent with a previous study, in which autophagy was reported to eliminate accumulated misfolded proteins and degrade damaged organelles to ameliorate ER stress (32). Autophagy inhibition also increased LDH levels, increased the expression of caspase-3, cleaved caspase 3 and Bax and decreased cell viability and Bcl-2 expression, which indicates a protective effect of baicalin in H/R. In conclusion, the results of the present study demonstrate that baicalin may have a protective effect in H/R, possibly mediated by the induction of autophagy. Although the action and mechanism of baicalin on liver hypoxia/reoxygenation injury were investigated, there are certain limitations to the present study. The effect of baicalin on liver hypoxia/reoxygenation injury was only performed in vitro and requires further study in vivo. In addition the PI3K/AKT/mTOR signaling pathway was not investigated in the present study and represents an important pathway in autophagy. This should also be further investigated in any subsequent animal studies.

Acknowledgements

Not applicable.

Funding

The present study was supported by the grants from the National Natural Science Foundation of China (grant nos. 81400675 and 81603406).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

ZM and FL conceived the study and participated in the design of the study. JZ and JQ performed the experiments. FL analyzed the data and drafted the manuscript. GW revised the manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Carchman EH, Rao J, Loughran PA, Rosengart MR and Zuckerbraun BS: Heme oxygenase-1-mediated autophagy protects against hepatocyte cell death and hepatic injury from infection/sepsis in mice. Hepatology. 53:2053–2062. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Wang Y, Shen J, Xiong X, Xu Y, Zhang H, Huang C, Tian Y, Jiao C, Wang X and Li X: Remote ischemic preconditioning protects against liver ischemia-reperfusion injury via heme oxygenase-1-induced autophagy. PLoS One. 9:e988342014. View Article : Google Scholar : PubMed/NCBI

3 

Zhang W, Wang M, Xie HY, Zhou L, Meng XQ, Shi J and Zheng S: Role of reactive oxygen species in mediating hepatic ischemia-reperfusion injury and its therapeutic applications in liver transplantation. Transplant Proc. 39:1332–1337. 2007. View Article : Google Scholar : PubMed/NCBI

4 

Serracino-Inglott F, Habib NA and Mathie RT: Hepatic ischemia-reperfusion injury. Am J Surg. 181:160–166. 2001. View Article : Google Scholar : PubMed/NCBI

5 

Klune JR and Tsung A: Molecular biology of liver ischemia/reperfusion injury: Established mechanisms and recent advancements. Surg Clin North Am. 90:665–677. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Kato Y, Shimazu M, Wakabayashi G, Tanabe M, Morikawa Y, Hoshino K, Harada H, Kadomura T, Obara H, Urakami H, et al: Significance of portal venous flow in graft regeneration after living related liver transplantation. Transplant Proc. 33:1484–1485. 2001. View Article : Google Scholar : PubMed/NCBI

7 

Zheng L, Zhang C, Li L, Hu C, Hu M, Sidikejiang N, Wang X, Lin M and Rong R: Baicalin ameliorates renal fibrosis via inhibition of transforming growth factor β1 production and downstream signal transduction. Mol Med Rep. 15:1702–1712. 2017. View Article : Google Scholar : PubMed/NCBI

8 

Zhu J, Wang J, Sheng Y, Zou Y, Bo L, Wang F, Lou J, Fan X, Bao R, Wu Y, et al: Baicalin improves survival in a murine model of polymicrobial sepsis via suppressing inflammatory response and lymphocyte apoptosis. PLoS One. 7:e355232012. View Article : Google Scholar : PubMed/NCBI

9 

Waisundara VY, Siu SY, Hsu A, Huang D and Tan BK: Baicalin upregulates the genetic expression of antioxidant enzymes in Type-2 diabetic Goto-Kakizaki rats. Life Sci. 88:1016–1025. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Shieh DE, Cheng HY, Yen MH, Chiang LC and Lin CC: Baicalin-induced apoptosis is mediated by Bcl-2-dependent, but not p53-dependent, pathway in human leukemia cell lines. Am J Chin Med. 34:245–261. 2006. View Article : Google Scholar : PubMed/NCBI

11 

Motoo Y and Sawabu N: Antitumor effects of saikosaponins, baicalin and baicalein on human hepatoma cell lines. Cancer Lett. 86:91–95. 1994. View Article : Google Scholar : PubMed/NCBI

12 

Lin M, Li L, Li L, Pokhrel G, Qi G, Rong R and Zhu T: The protective effect of baicalin against renal ischemia-reperfusion injury through inhibition of inflammation and apoptosis. BMC Complement Altern Med. 14:192014. View Article : Google Scholar : PubMed/NCBI

13 

Zheng WX, Cao XL, Wang F, Wang J, Ying TZ, Xiao W, Zhang Y, Xing H, Dong W, Xu SQ, et al: Baicalin inhibiting cerebral ischemia/hypoxia-induced neuronal apoptosis via MRTF-A-mediated transactivity. Eur J Pharmacol. 767:201–210. 2015. View Article : Google Scholar : PubMed/NCBI

14 

Kong F, Luan Y, Zhang ZH, Cheng GH, Qi TG and Sun C: Baicalin protects the myocardium from reperfusion-induced damage in isolated rat hearts via the antioxidant and paracrine effect. Exp Ther Med. 7:254–259. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Lin C, Tsai SC, Tseng MT, Peng SF, Kuo SC, Lin MW, Hsu YM, Lee MR, Amagaya S, Huang WW, et al: AKT serine/threonine protein kinase modulates baicalin-triggered autophagy in human bladder cancer T24 cells. Int J Oncol. 42:993–1000. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Zhang X, Tang X, Liu H, Li L, Hou Q and Gao J: Autophagy induced by baicalin involves downregulation of CD147 in SMMC-7721 cells in vitro. Oncol Rep. 27:1128–1134. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Shintani T and Klionsky DJ: Autophagy in health and disease: A double-edged sword. Science. 306:990–995. 2004. View Article : Google Scholar : PubMed/NCBI

18 

Geronimo-Olvera C, Montiel T, Rincon-Heredia R, Castro-Obregón S and Massieu L: Autophagy fails to prevent glucose deprivation/glucose reintroduction-induced neuronal death due to calpain-mediated lysosomal dysfunction in cortical neurons. Cell Death Dis. 8:e29112017. View Article : Google Scholar : PubMed/NCBI

19 

Rautou PE, Mansouri A, Lebrec D, Durand F, Valla D and Moreau R: Autophagy in liver diseases. J Hepatol. 53:1123–1134. 2010. View Article : Google Scholar : PubMed/NCBI

20 

Kaushal GP: Autophagy protects proximal tubular cells from injury and apoptosis. Kidney Int. 82:1250–1253. 2012. View Article : Google Scholar : PubMed/NCBI

21 

Yao W, Li H, Han X, Chen C, Zhang Y, Tai WL, Xia Z and Hei Z: MG53 anchored by dysferlin to cell membrane reduces hepatocyte apoptosis which induced by ischaemia/reperfusion injury in vivo and in vitro. J Cell Mol Med. 21:2503–2513. 2017. View Article : Google Scholar : PubMed/NCBI

22 

Lin M, Li L, Zhang Y, Zheng L, Xu M, Rong R and Zhu T: Baicalin ameliorates H2O2 induced cytotoxicity in HK-2 cells through the inhibition of ER stress and the activation of Nrf2 signaling. Int J Mol Sci. 15:12507–12522. 2014. View Article : Google Scholar : PubMed/NCBI

23 

Xue LX, Liu HY, Cui Y, Dong Y, Wang JQ, Ji QY, He JT, Yao M, Wang YY, Shao YK, et al: Neuroprotective effects of Activin A on endoplasmic reticulum stress-mediated apoptotic and autophagic PC12 cell death. Neural Regen Res. 12:779–786. 2017. View Article : Google Scholar : PubMed/NCBI

24 

Kishino A, Hayashi K, Hidai C, Masuda T, Nomura Y and Oshima T: XBP1-FoxO1 interaction regulates ER stress-induced autophagy in auditory cells. Sci Rep. 7:44422017. View Article : Google Scholar : PubMed/NCBI

25 

Hoyer-Hansen M and Jäättelä M: Connecting endoplasmic reticulum stress to autophagy by unfolded protein response and calcium. Cell Death Differ. 14:1576–1582. 2007. View Article : Google Scholar : PubMed/NCBI

26 

B'Chir W, Maurin AC, Carraro V, Averous J, Jousse C, Muranishi Y, Parry L, Stepien G, Fafournoux P and Bruhat A: The eIF2α/ATF4 pathway is essential for stress-induced autophagy gene expression. Nucleic Acids Res. 41:7683–7699. 2013. View Article : Google Scholar : PubMed/NCBI

27 

Margariti A, Li H, Chen T, Martin D, Vizcay-Barrena G, Alam S, Karamariti E, Xiao Q, Zampetaki A, Zhang Z, et al: XBP1 mRNA splicing triggers an autophagic response in endothelial cells through BECLIN-1 transcriptional activation. J Biol Chem. 288:859–872. 2013. View Article : Google Scholar : PubMed/NCBI

28 

Zhu J, Hua X, Li D, Zhang J and Xia Q: Rapamycin attenuates mouse liver ischemia and reperfusion injury by inhibiting endoplasmic reticulum stress. Transplant Proc. 47:1646–1652. 2015. View Article : Google Scholar : PubMed/NCBI

29 

Hermann R, Vélez DE, Rusiecki TM, Fernández Pazos Mde L, Cordero Mestre VE, Prendes Marina MG, Rossini Perazzo JC, Savino EA and Varela A: Effects of 3-methyladenine on isolated left atria subjected to simulated ischaemia-reperfusion. Clin Exp Pharmacol Physiol. 42:41–51. 2015. View Article : Google Scholar : PubMed/NCBI

30 

Kim SH, Son KM, Kim KY, Yu SN, Park SG, Kim YW, Nam HW, Suh JT, Ji JH and Ahn SC: Deoxypodophyllotoxin induces cytoprotective autophagy against apoptosis via inhibition of PI3K/AKT/mTOR pathway in osteosarcoma U2OS cells. Pharmacol Rep. 69:878–884. 2017. View Article : Google Scholar : PubMed/NCBI

31 

Chen W, Sun Y, Liu K and Sun X: Autophagy: A double-edged sword for neuronal survival after cerebral ischemia. Neural Regen Res. 9:1210–1216. 2014. View Article : Google Scholar : PubMed/NCBI

32 

Cai Y, Arikkath J, Yang L, Guo ML, Periyasamy P and Buch S: Interplay of endoplasmic reticulum stress and autophagy in neurodegenerative disorders. Autophagy. 12:225–244. 2016. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

August-2018
Volume 16 Issue 2

Print ISSN: 1792-0981
Online ISSN:1792-1015

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Liu F, Zhang J, Qian J, Wu G and Ma Z: Baicalin attenuates liver hypoxia/reoxygenation injury by inducing autophagy. Exp Ther Med 16: 657-664, 2018.
APA
Liu, F., Zhang, J., Qian, J., Wu, G., & Ma, Z. (2018). Baicalin attenuates liver hypoxia/reoxygenation injury by inducing autophagy. Experimental and Therapeutic Medicine, 16, 657-664. https://doi.org/10.3892/etm.2018.6284
MLA
Liu, F., Zhang, J., Qian, J., Wu, G., Ma, Z."Baicalin attenuates liver hypoxia/reoxygenation injury by inducing autophagy". Experimental and Therapeutic Medicine 16.2 (2018): 657-664.
Chicago
Liu, F., Zhang, J., Qian, J., Wu, G., Ma, Z."Baicalin attenuates liver hypoxia/reoxygenation injury by inducing autophagy". Experimental and Therapeutic Medicine 16, no. 2 (2018): 657-664. https://doi.org/10.3892/etm.2018.6284