Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
March-2019 Volume 17 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March-2019 Volume 17 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

The mitochondrial tRNAAla 5587T>C and tRNALeu(CUN) 12280A>G mutations may be associated with hypertension in a Chinese family

  • Authors:
    • Lin Lin
    • Peng Cui
    • Zhipeng Qiu
    • Min Wang
    • Yingchao Yu
    • Jing Wang
    • Qian Sun
    • Hairong Zhao
  • View Affiliations / Copyright

    Affiliations: Health Examination Department, Affiliated Qingdao Hiser Hospital of Qingdao University, Qingdao, Shandong 266000, P.R. China, Multidisciplinary Consultation Center, Affiliated Qingdao Hiser Hospital of Qingdao University, Qingdao, Shandong 266000, P.R. China, Emergency Department, Affiliated Qingdao Hiser Hospital of Qingdao University, Qingdao, Shandong 266000, P.R. China, Department of Joint Surgery, Affiliated Qingdao Hiser Hospital of Qingdao University, Qingdao, Shandong 266000, P.R. China, Department of General Medicine, Affiliated Qingdao Hiser Hospital of Qingdao University, Qingdao, Shandong 266000, P.R. China
  • Pages: 1855-1862
    |
    Published online on: December 28, 2018
       https://doi.org/10.3892/etm.2018.7143
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Hypertension is a very common cardiovascular disorder, however, the molecular mechanism underlying this disease remains poorly understood. Recently, an increasing number of studies have demonstrated that mitochondrial (mt)DNA mutations serve important roles in the pathogenesis of hypertension. The current study reported the clinical and molecular characterization of a Chinese family with maternally inherited hypertension (the penetrance of hypertension was 71.4%). In addition, the entire mitochondrial transfer (mt‑t)RNA genomes was amplified using a polymerase chain reaction (PCR) and identified through direct Sanger sequencing. Additionally, the mtDNA copy number in matrilineal relatives in this family was evaluated using quantitative PCR. The sequence analysis of the 22 mt‑tRNA genes led to the identification of tRNAAla 5587T>C (thymine to cytosine) and tRNALeu(CUN) 12280A>G (adenine to guanine) mutations. Notably, the heteroplasmic 5587T>C mutation was located at the 3' end of tRNAAla (position 73), which is highly conserved from bacteria to human mitochondria. In addition, the 12280A>G mutation was revealed to occurs at the dihydrouridine loop of tRNALeu(CUN) (position 15) and may decrease the steady‑state level of mt‑tRNA. As a result, 5587T>C and 12280A>G mutations may lead to the failure of tRNAs metabolism and subsequently cause mitochondrial protein synthesis defects. Molecular analysis revealed that patients carrying the 5587T>C and 12280A>G mutations had a lower copy number of mtDNA compared with a control with hypertension, but without the mutations, suggesting that these mutations may cause mitochondrial dysfunctions that are responsible for hypertension. Therefore, mt‑tRNAAla 5587T>C and tRNALeu(CUN) 12280A>G mutations may be involved in the pathogenesis of hypertension in this family.

Introduction

Hypertension is a major public health problem, affecting approximately 1 billion people worldwide (1). Hypertension is also an established risk factor for coronary heart disease, stroke and renal failure (2). Despite significant advances in the understanding of the pathophysiology of hypertension, it remains to be one of the most challenging disorders (3). It is generally believed that hypertension is influenced by genetic and environmental factors. Estimates of genetic variance range from 20–50% (4), and maternal and paternal patterns have been reported (5). In fact, previous studies demonstrated that mitochondrial dysfunction caused by mitochondrial (mt)DNA mutations were important causes for hypertension (6). Several mitochondrial transfer (mt-t)RNA mutations have been reported to be associated with hypertension, these mutations include mt-tRNAAla 5587T>C (thymine to cytosine) (7); mt-tRNAGln 4375C>T (8), mt-tRNAMet 4435A>G (9) and mt-tRNALeu(CUN) 12280A>G (adenine to guanine) (10). The authors of the current study noticed that these mutations may decrease the steady-state level of mt-tRNAs and subsequently cause the mitochondrial dysfunction that is responsible for hypertension. Nevertheless, the association between mtDNA mutations and high blood pressure remains unclear.

To investigate the contribution of mtDNA mutations to hypertension, a mutational analysis for mt-tRNA genes was performed in a large cohort of patients with hypertension. In the current study, the authors described a Han Chinese family with maternally transmitted hypertension. Sequence analysis of the 22 mt-tRNA genes led to the identification of two potential pathogenic mutations: tRNAAla 5587T>C and tRNALeu(CUN) 12280A>G. The mtDNA copy number in the patients carrying these mutations was then analysed.

Patients and methods

Pedigree information

A Han Chinese family (Fig. 1) with maternally inherited hypertension was recruited to the current study from department of General Medicine, Affiliated Qingdao Hiser Hospital of Qingdao University (Qingdao, China). There were 13 individuals in this family; five matrilineal relatives (I-2, II-4, II-6, III-5 and III-6) and an unrelated member of the family (II-5) suffered from hypertension, although II-5 did not have the investigated mutations (Fig. 1). Notably, members including I-2 (proband's mother), II-4 (proband), II-5 (proband's brother-in-law), II-6 (proband's sister), III-5 (proband's daughter) and III-6 (proband's niece) were involved in the current study. This protocol was approved by the ethics committee of the Affiliated Qingdao Hiser Hospital of Qingdao University. Detailed demographics, anthropometrics, vital parameters and medical history were recorded for each individual during interviews. Additionally, 500 unrelated Han Chinese healthy subjects (200 males and 300 females; age range, 21–55 years; mean age, 40±1.5 years) were collected from the Health Examination Department, Affiliated Qingdao Hiser Hospital of Qingdao University and used as controls; written informed consent was obtained from all subjects involved in the current study. Notably, the control subjects were healthy individuals, without any diseases or any family history of mitochondrial disorders, including deafness, vision loss, neurological disorders or cardiovascular diseases. Control subjects who had a family history of mitochondrial diseases were excluded.

Figure 1.

One Han Chinese family with hypertension carrying the mt-tRNAAla 5587T>C and tRNALeu(CUN) 12280A>G mutations. The affected individuals are presented as filled symbols, the arrow indicates the proband. mt, mitochondrial; t, transfer.

Measurement of the blood pressure (BP)

Members of this family, as well as 500 healthy subjects underwent BP assessments; two doctors measured the systolic and diastolic BP via an electronic measuring device, and repeated three times. Hypertension was defined according to the guidelines of the Joint National Committee on Detection, Evaluation and Treatment of High Blood Pressure (JNC VI) (11) and the World Health Organization-International Society of Hypertension (12) as a systolic BP of ≥140 mmHg and/or a diastolic BP of ≥90 mmHg, or a history of hypertension with current antihypertensive drug treatment (13).

Detecting the hypertension-associated mt-tRNA mutations

The blood samples of each individual were collected in sterile ethylenediaminetetraacetic acid test tubes. To analysis the mutations/polymorphisms in mt-tRNA genes, the genomic DNA was extracted from the blood samples using the Puregene DNA Isolation kit (Gentra Systems, Inc., Minneapolis, MN, USA). The 22 mt-tRNA genes were polymerase chain reaction (PCR) amplified using 11 primers as described previously (7). The PCR products were purified and analyzed by direct sequencing in an ABI 3700 automated DNA sequencer (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA) using a Big Dye Terminator Cycle sequencing reaction kit version 3.1 (Applied Biosystems; Thermo Fisher Scientific, Inc.). DNA Star software version 5.01 (DNASTAR Inc., Madison, WI, USA) was used to identify genetic variants in mt-tRNAs by comparing the sequence data with the Cambridge reference sequence (NC_012920) (14) and the protocols of Sanger sequencing; the Sanger sequencing primers were described in a previous investigation (15).

mt-tRNA structure analysis

The published secondary structures of mt-tRNALeu(CUN) and tRNAAla were used to define the stem-and-loop structure (16). Using the cloverleaf structure, the position of the 12280A>G and 5587T>C mutations were localized.

Analysis of the conservation index (CI)

To assess the potential pathogenic roles of the tRNALeu(CUN) 12280A>G and tRNAAla 5587T>C mutations, the CIs of the mutations were evaluated using phylogenetic conservation analysis (7). The following species were selected for the phylogenetic conservation analysis: Homo sapiens, Gorilla gorilla, Macaca mulatta, Pan paniscus, Papio hamadryas, Trachypithecus obscures, Muntiacus reevesi, Mus musculus, Balaenoptera bonaerensis, Cynocephalus variegates and Pongo pygmaeus abelii. The CI was calculated by comparing the human mtDNA variants with other species; a CI>75% was considered to have functional potential (17).

Analysis of mtDNA content

To see whether tRNALeu(CUN) 12280A>G and tRNAAla 5587T>C mutations caused mitochondrial dysfunction, the mtDNA content from each individual with hypertension was determined using quantitative PCR and the 2−ΔΔCq method (18). The mtDNA content was normalized to a single copy nuclear gene (β-globin). The primer sequences for amplifying the gene were as follows: mtDNA ND1: Forward, 5′-AACATACCCATGGCCAACCT-3′ and reversed, 5′-AGCGAAGGGTTGTAGTAGCCC-3′; and β-globin: Forward, 5′-GAAGAGCCAAGGACAGGTAC-3′ and reverse, 5′-CAACTTCATCCACGTTCACC-3′. The PCR reaction solution (20 µl) contained 2X Taqman Universal PCR Master Mix (Takara Biotechnology Co., Ltd., Dalian, China), 500 nmol/l of each primer, 200 nmol/l Taqman Probe and 100 ng of total DNA. The PCR conditions were as follows: 2 min at 50°C and 10 min at 95°C, followed by 40 cycles of denaturation for 15 sec at 95°C and 60 sec annealing/extension at 60°C. Each experiment was repeated three times.

Statistical analysis

The statistical analysis was performed using the SPSS 17.0 software (SPSS Inc., Chicago, IL, USA). Differences in categorical variables were assessed with Fisher's exact test. P<0.05 indicated that the difference between groups was statistically significant.

Results

Clinical analysis

A maternally transmitted Han Chinese family with hypertension (Fig. 1) was recruited from the Affiliated Qingdao Hiser Hospital of Qingdao University. The proband (II-4) was a 55-year-old female who was admitted to the department of General Medicine, Affiliated Qingdao Hiser Hospital of Qingdao University with a high BP (140/95 mmHg). The proband did not smoke or drink alcohol and did not have a history of coronary heart disease, renal failure or hyperlipidemia. In addition, the authors of the current study observed that the age of onset from the first generation was 66 years, while the mean age of onset were younger for the second generation (43.5 years, ranged between 42 and 45 years) and the third generation (32.0 years, ranged between 30 and 34 years); the mean age of onset of hypertension for the affected members of the family was 43.50±12.52 years. The BP of each individual with hypertension was listed in Table I.

Table I.

Clinical information for family members with hypertension.

Table I.

Clinical information for family members with hypertension.

SubjectsSexAge of onset (years)Systolic pressure (mmHg)Diastolic pressure (mmHg)
I-2F6615590
II-4F4514095
II-6F4214585
III-5F3414590
III-6F3015075
II-5Mn/a13075

[i] F, female; M, male; n/a, not applicable.

Mutational screening for mt-tRNA genes and structural analysis

The hypertension was maternally transmitted, which suggested that mitochondrial dysfunction may be the molecular basis for this disease; in addition, recent experimental studies suggested a positive association between mt-tRNA mutations and hypertension (19,20). Therefore, the mt-tRNA mutations were analyzed from the matrilineal relatives (I-2, II-1, II-4, II-6, III-4, III-5 and III-6) from this pedigree. The PCR was performed to amplify the entire mt-tRNAs, the PCR products were then purified and analyzed by direct sequencing. As a result, two mutations were identified: A homoplasmic tRNALeu(CUN) 12280A>G mutation and a heteroplasmic tRNAAla 5587T>C mutation in the matrilineal relatives (I-2, II-1, II-4, II-6, III-4, III-5 and III-6) with hypertension (Fig. 2), and no other mt-tRNA mutations were identified in the family. The 12280A>G mutation was localized at position 15 in the dihydrouridine (DHU)-loop of tRNALeu(CUN) (Fig. 3), which was highly conserved from various species (Table II). Notably, the 12280A>G created a novel base-pairing (15C-19G) and may cause the failure in tRNA metabolism. While the 5587T>C mutation occurred at position 73 near the end of tRNAAla; notably, the T to C transition at position 73 was extremely conserved, suggesting that the 5587T>C mutation may alter the secondary structure of tRNAAla (21). The 5587T>C and 12280A>G mutations was not identified in 500 healthy subjects; the Fisher's exact test was performed and it was revealed that the 5587T>C and 12280A>G had statistical significance (both P<0.05; Table III).

Figure 2.

Identification of 5587T>C and 12280A>G mutations using direct sequencing.

Figure 3.

Structure of tRNA and location of the mutations. (A) The 5587T>C mutation is localized at the 3′ end of tRNAAla. (B) The 12280A>G mutation occurs at DHU loop of tRNALeu(CUN). DHU, dihydrouridine.

Table II.

Alignment of the mt-tRNALeu(CUN) gene from different species.

Table II.

Alignment of the mt-tRNALeu(CUN) gene from different species.

OrganismAcc-stemD-stemD-loopD-stemAc-StemAnticd-loopAc-stemV-regionT-stemT-loopT-stemAcc-stem
Homo sapiensACTTTTGGATAACAATCCATTGGTCTTACCCAAAAATTTTGGTGCACCAAATAAAA
AAA GCT GGC ACT GTA
Gorilla gorillaACTTTTGGATAACAATCCATTGGTCTTACCCAAAAATTTTGGTGCACCAAATAAAA
AAA GCT GGA ACT GTA
Macaca mulattaACTTTTGGATAACAATCCATTGACCTTAGTCAAAAACATTGGTGCACCAAATAAAA
AAA GCT GGA ACT GTA
Pan paniscusACTTTTGGATAACAATCCGTTGGTCTTACCCAAAAATTTTGGTGCACCAAATAAAA
AAA GCC GGC ACT GTA
PapioACTTTTGGATAACAATCCATTGGTCTTAACCAAAAACATTGGTGCACCAAATAAAA
hamadryasAAA GCT GGA ACT GTA
TrachypithecusACTTTTGGATAACAATCCGTTGGTCTTAACCAAAAATATTGGTGCACCAAATAAAA
obscurusAAA GAT GGA ACT GTA
Muntiacus reevesiACTTTTGGATGACAATCCGTTGGTCTTAATCAAAAAATTGGTGCACCAAATAAAA
AGA GAT GGA ACT GTA
Mus musculusACTTTTGGATAATAATCCATTGGTCTTAACCAAAAACCTTGGTGCACCAAATAAAA
ATA GTA GGA AAT GTA
BalaenopteraACTTTTGGATAACAATCCATTGGTCTTAACCAAAAAATTGGTGCACCAAATAAAA
bonaerensisACA GTT GGA ACT GTA
CynocephalusACTTTCGGATAAAAATCCATTGGTCTTAACCAAAAAATTTGGTGCACCAAATGAAA
variegatusAAA GCA GGA ACT GTA
Pongo pygmaeusACTTTTGGATAACAATCCCTTGGTCTTACCCAAAAATTTTGGTGCACCAAATAAAA
abeliiAAA GCT GGA ACT GTA

[i] The red letter indicates position 15, which corresponds to the 12280A>G mutation.

Table III.

5587T>C and 12280A>G mutations identified in affected individuals, but not controls.

Table III.

5587T>C and 12280A>G mutations identified in affected individuals, but not controls.

Number of individuals with the two mutations

GenesPositionReplacementPatients (%)Controls (%)P-value
tRNAAla   5,587T to C5 (100)0<0.05
tRNALeu(CUN)12,280A to G5 (100)0<0.05

[i] A total of 500 healthy tissues were used as controls.

Evolutionary conservation assessment

To evaluate potential pathogenic mutations, evolutionary conservation was assessed. The CIs of 12280A>G and 5587T>C mutations were analyzed, demonstrating them as 100% (Table II); a recent report by Ji et al (21) also revealed that the CI of the 5587T>C mutation was 100%.

mtDNA copy number analysis

As shown in Fig. 4, patients carrying mt-tRNALeu(CUN) 12280A>G and tRNAAla 5587T>C mutations have markedly a lower copy number of mtDNA compared with a control with hypertension, but without the mutations, suggesting that the 12280A>G and/or 5587T>C mutation may cause mitochondrial dysfunction by altering the mtDNA content.

Figure 4.

Quantification of mtDNA copy number. mt, mitochondrial.

Discussion

The present study reported that the clinical and molecular characterization of a Chinese pedigree with maternally inherited hypertension. Although many studies revealed the genetics of mitochondrial disorders, the molecular mechanism underlying hypertension remains unclear (22,23). Experimental studies identified a positive association between mtDNA mutations and hypertension (24,25). In particular, Watson et al (26) reported a double ND3 10398A>G Ddel CO1 HaeIII 6620T>C or 6260G>A mutation in hypertensive African-Americans with end-stage renal disease. In addition, in a recent case-control study, Liu et al (27) identified several mt-tRNA mutations that were associated with hypertension, including tRNAPhe 586G>A, tRNALys 8313G>A and tRNAHis 12147G>A, suggesting that mt-tRNA genes were likely to contain pathogenic mutations associated with hypertension.

For this purpose, the mutations/variants in 22 mt-tRNA genes from the matrilineal relatives in the pedigree were screened and two potential pathogenic mutations identified were: mt-tRNAAla 5587T>C and tRNALeu(CUN) 12280A>G. It was interesting to note that the heteroplasmic 5587T>C mutation occurred at the 3′ end of tRNAAla, which is very important for tRNA identity (28). Additionally, this mutation has been reported to be associated with Leber's hereditary optic neuropathy (21), hearing loss, progressive unstable gait, dysarthria, muscle cramps and myalgias (29). Functional analysis indicated that the 5587T>C mutation affected the aminoacylation of tRNAAla and efficiency of mitochondrial translation (21). Thus, the 5587T>C mutation may have the same impact for the pathogenesis of hypertension in this family.

Furthermore, the homoplasmic 12280A>G mutation was found at position 15 in the DHU loop of the tRNALeu(CUN) gene, which was extremely conserved in various species. Notably, the 12280A>G mutation created a novel base-pairing (15G-19C), which may alter its tertiary structure. Importantly, nucleotides at the same positions in mt-tRNAIle gene (4277T>C mutation) has been reported to be associated with hypertrophic cardiomyopathy (30). Therefore, the authors of the current study propose that the 12280A>G mutation may have the same impact on hypertension.

To see whether 5587T>C and 12280A>G mutations caused the mitochondrial dysfunction, the mtDNA copy number in patients carrying these mutations were evaluated using quantitative PCR. Consequently, it was determined that patients with these mutations have a lower copy number of mtDNA compared with a control with hypertension, but without the mutations, which is consistent with a previous study (31). In fact, the alteration of the mtDNA copy number, which reflects oxidant-induced cell damage, had been observed in a wide range of human mitochondrial diseases (32). Additionally, a decreased mtDNA copy number has been demonstrated to lead to increased ROS levels; ROS induced by mitochondrial dysfunction can increase mitochondrial Ca2+ accumulation and may act as potential pathophysiological mechanism in hypertension (33,34).

In conclusion, the authors of the current study hypothesise that mt-tRNAAla 5587T>C and tRNALeu(CUN) 12280A>G mutations possibly lead to molecular mechanisms that underlie the progression of maternally inherited essential hypertension. The molecular mechanisms may be as follows: The mutations altered the secondary structure of tRNAAla and tRNALeu(CUN), subsequently, the structural alternations led to a decrease in the steady-state levels of tRNAAla and tRNALeu(CUN), and caused the impairments of mt-tRNAs metabolism. As a result, mitochondrial protein synthesis, the respiration chain and ATP levels declined significantly; additionally, decreased tRNA steady-state levels may also affect tRNA aminoacylation, mtDNA copy number and ROS generation (35,36). Therefore, the mitochondrial dysfunction, caused by 5587T>C and 12280A>G mutations, may contribute to the progression of hypertension in this family. In fact, mutations that caused the mt-tRNA metabolism failure suggest a possible metabolic pathway, as indicated in several studies (37–39). However, the incomplete penetrance of hypertension and variable degree of blood pressure indicated that the 5587T>C and 12280A>G mutations were insufficient to produce the clinical phenotypes; thus, other modifiable factors, including environmental factors, nuclear genes and epigenetic modification may account for hypertension expression. The tRNAAla 5587T>C and tRNALeu(CUN) 12280A>G mutations should be added as risk factors for familial hypertension. The main limitation of the current study was the lack of functional experiments. Thus further investigations using trans-mitochondrial cybrid cells should be employed to determine the mitochondrial dysfunctions caused by 5587T>C and 12280A>G mutations, including assessing ROS production, ATP production and mitochondrial membrane potential.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

LL and HZ designed the current study. LL, PC, ZQ, MW, YY, JW and QS performed clinical and molecular analyses. HZ wrote the manuscript. All authors approved the final manuscript.

Ethics approval and consent to participate

The protocol of the current study was approved by the ethics committee of the Affiliated Qingdao Hiser Hospital of Qingdao University (Qingdao, China). Written informed consent was obtained from all subjects involved in the current study.

Patient consent for publication

All patients agreed for the publication of their data.

Competing interests

The authors declare that they have no competing interests.

References

1 

Guidelines Subcommittee. World health organization-international society of hypertension guidelines for the management of hypertension. Guidelines Subcommittee. J Hypertens. 17:151–183. 1999.PubMed/NCBI

2 

Kannel WB: Risk stratification in hypertension: New insights from the Framingham Study. Am J Hypertens. 13:S3–S10. 2000. View Article : Google Scholar

3 

El Shamieh S, Herbeth B, Azimi-Nezhad M, Benachour H, Masson C and Visvikis-Siest S: Human formyl peptide receptor 1 C32T SNP interacts with age and is associated with blood pressure levels. Clin Chim Acta. 413:34–38. 2012. View Article : Google Scholar : PubMed/NCBI

4 

Bender A, Krishnan KJ, Morris CM, Taylor GA, Reeve AK, Perry RH, Jaros E, Hersheson JS, Betts J, Klopstock T, et al: High levels of mitochondrial DNA deletions in substantia nigra neurons in aging and Parkinson disease. Nat Genet. 38:515–517. 2006. View Article : Google Scholar : PubMed/NCBI

5 

Choi SJ, Lee HK, Kim NH and Chung SY: Mycophenolic acid mediated mitochondrial membrane potential transition change lead to T lymphocyte apoptosis. J Korean Surg Soc. 81:235–241. 2011. View Article : Google Scholar : PubMed/NCBI

6 

Ding Y, Xia B, Yu J, Leng J and Huang J: Mitochondrial DNA mutations and essential hypertension (Review). Int J Mol Med. 32:768–774. 2013. View Article : Google Scholar : PubMed/NCBI

7 

Zheng P, Li S, Liu C, Zha Z, Wei X and Yuan Y: Mitochondrial tRNAAla C5601T mutation may modulate the clinical expression of tRNAMet A4435G mutation in a Han Chinese family with hypertension. Clin Exp Hypertens. 40:595–600. 2018. View Article : Google Scholar : PubMed/NCBI

8 

Chen H, Sun M, Fan Z, Tong M, Chen G, Li D, Ye J, Yang Y, Zhu Y and Zhu J: Mitochondrial C4375T mutation might be a molecular risk factor in a maternal Chinese hypertensive family under haplotype C. Clin Exp Hypertens. 40:518–523. 2018. View Article : Google Scholar : PubMed/NCBI

9 

Lu Z, Chen H, Meng Y, Wang Y, Xue L, Zhi S, Qiu Q, Yang L, Mo JQ and Guan MX: The tRNAMet 4435A>G mutation in the mitochondrial haplogroup G2a1 is responsible for maternally inherited hypertension in a Chinese pedigree. Eur J Hum Genet. 19:1181–1186. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Teng L, Zheng J, Leng J and Ding Y: Clinical and molecular characterization of a Han Chinese family with high penetrance of essential hypertension. Mitochondrial DNA. 23:461–465. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Jones D, Basile J, Cushman W, Egan B, Ferrario C, Hill M, Lackland D, Mensah G, Moore M, Ofili E, et al: Managing hypertension in the southeastern United States: Applying the guidelines from the Sixth Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC VI). Am J Med Sci. 318:357–364. 1999. View Article : Google Scholar : PubMed/NCBI

12 

Chalmers J, MacMahon S, Mancia G, Whitworth J, Beilin L, Hansson L, Neal B, Rodgers A, Ni Mhurchu C and Clark T: 1999 World Health Organization-International Society of Hypertension Guidelines for the management of hypertension. Guidelines sub-committee of the World Health Organization. Clin Exp Hypertens. 21:1009–1060. 1999. View Article : Google Scholar : PubMed/NCBI

13 

Muntner P, Krousel-Wood M, Hyre AD, Stanley E, Cushman WC, Cutler JA, Piller LB, Goforth GA and Whelton PK: Antihypertensive prescriptions for newly treated patients before and after the main antihypertensive and lipid-lowering treatment to prevent heart attack trial results and seventh report of the joint national committee on prevention, detection, evaluation, and treatment of high blood pressure guidelines. Hypertension. 53:617–623. 2009. View Article : Google Scholar : PubMed/NCBI

14 

Andrews RM, Kubacka I, Chinnery PF, Lightowlers RN, Turnbull DM and Howell N: Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA. Nat Genet. 23:1471999. View Article : Google Scholar : PubMed/NCBI

15 

Rieder MJ, Taylor SL, Tobe VO and Nickerson DA: Automating the identification of DNA variations using quality-based fluorescence re-sequencing: Analysis of the human mitochondrial genome. Nucleic Acids Res. 26:967–973. 1998. View Article : Google Scholar : PubMed/NCBI

16 

Suzuki T, Nagao A and Suzuki T: Human mitochondrial tRNAs: Biogenesis, function, structural aspects, and diseases. Annu Rev Genet. 45:299–329. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Levin L, Zhidkov I, Gurman Y, Hawlena H and Mishmar D: Functional recurrent mutations in the human mitochondrial phylogeny: Dual roles in evolution and disease. Genome Biol Evol. 5:876–890. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Schmittgen TD, Zakrajsek BA, Mills AG, Gorn V, Singer MJ and Reed MW: Quantitative reverse transcription-polymerase chain reaction to study mRNA decay: Comparison of endpoint and real-time methods. Anal Biochem. 285:194–204. 2000. View Article : Google Scholar : PubMed/NCBI

19 

Xu Y, Chen X, Huang H and Liu W: The mitochondrial tRNAAla T5655C mutation may modulate the phenotypic expression of tRNAMet and tRNAGln A4401G mutation in a Han Chinese family with essential hypertension. Int Heart J. 58:95–99. 2017. View Article : Google Scholar : PubMed/NCBI

20 

Guo L, Yuan Y and Bi R: Mitochondrial DNA mutation m.5512A >G in the acceptor-stem of mitochondrial tRNATrp causing maternally inherited essential hypertension. Biochem Biophys Res Commun. 479:800–807. 2016. View Article : Google Scholar : PubMed/NCBI

21 

Ji Y, Qiao L, Liang X, Zhu L, Gao Y, Zhang J, Jia Z, Wei QP, Liu X, Jiang P and Guan MX: Leber's hereditary optic neuropathy is potentially associated with a novel m.5587T>C mutation in two pedigrees. Mol Med Rep. 16:8997–9004. 2017. View Article : Google Scholar : PubMed/NCBI

22 

Tranchant C and Anheim M: Movement disorders in mitochondrial diseases. Rev Neurol (Paris). 172:524–529. 2016. View Article : Google Scholar : PubMed/NCBI

23 

Ma K, Xie M, He X, Liu G, Lu X, Peng Q, Zhong B and Li N: A novel compound heterozygous mutation in VARS2 in a newborn with mitochondrial cardiomyopathy: A case report of a Chinese family. BMC Med Genet. 19:2022018. View Article : Google Scholar : PubMed/NCBI

24 

Zhu Y, Gu X and Xu C: Mitochondrial DNA 7908–8816 region mutations in maternally inherited essential hypertensive subjects in China. BMC Med Genomics. 11:892018. View Article : Google Scholar : PubMed/NCBI

25 

Zhao Y, Chen X, Li H, Zhu C, Li Y and Liu Y: Mitochondrial genome mutations in 13 subunits of respiratory chain complexes in Chinese Han and Mongolian hypertensive individuals. Mitochondrial DNA A DNA Mapp Seq Anal. 29:1090–1099. 2018.PubMed/NCBI

26 

Watson B Jr, Khan MA, Desmond RA and Bergman S: Mitochondrial DNA mutations in black Americans with hypertension-associated end-stage renal disease. Am J Kidney Dis. 38:529–536. 2001. View Article : Google Scholar : PubMed/NCBI

27 

Liu Y, Li Y, Wang X, Ma Q, Zhu C, Li Z, Yin T, Yang J, Chen Y and Guan M: Mitochondrial tRNA mutations in Chinese hypertensive individuals. Mitochondrion. 28:1–7. 2016. View Article : Google Scholar : PubMed/NCBI

28 

Levinger L, Mörl M and Florentz C: Mitochondrial tRNA 3′ end metabolism and human disease. Nucleic Acids Res. 32:5430–5431. 2004. View Article : Google Scholar : PubMed/NCBI

29 

Crimi M, Sciacco M, Galbiati S, Bordoni A, Malferrari G, Del Bo R, Biunno I, Bresolin N and Comi GP: A collection of 33 novel human mtDNA homoplasmic variants. Hum Mutat. 20:4092002. View Article : Google Scholar : PubMed/NCBI

30 

Perli E, Giordano C, Tuppen HA, Montopoli M, Montanari A, Orlandi M, Pisano A, Catanzaro D, Caparrotta L, Musumeci B, et al: Isoleucyl-tRNA synthetase levels modulate the penetrance of a homoplasmic m.4277T>C mitochondrial tRNA(Ile) mutation causing hypertrophic cardiomyopathy. Hum Mol Genet. 21:85–100. 2012. View Article : Google Scholar : PubMed/NCBI

31 

Lei L, Guo J, Shi X, Zhang G, Kang H, Sun C, Huang J and Wang T: Mitochondrial DNA copy number in peripheral blood cell and hypertension risk among mining workers: A case-control study in Chinese coal miners. J Hum Hypertens. 31:585–590. 2017. View Article : Google Scholar : PubMed/NCBI

32 

Huang J, Tan L, Shen R, Zhang L, Zuo H and Wang DW: Decreased peripheral mitochondrial DNA copy number is associated with the risk of heart failure and long-term outcomes. Medicine (Baltimore). 95:e33232016. View Article : Google Scholar : PubMed/NCBI

33 

Ding Y, Xia BH, Zhang CJ and Zhuo GC: Mitochondrial tRNALeu(UUR) C3275T, tRNAGln T4363C and tRNALys A8343G mutations may be associated with PCOS and metabolic syndrome. Gene. 642:299–306. 2018. View Article : Google Scholar : PubMed/NCBI

34 

Schaar CE, Dues DJ, Spielbauer KK, Machiela E, Cooper JF, Senchuk M, Hekimi S and Van Raamsdonk JM: Mitochondrial and cytoplasmic ROS have opposing effects on lifespan. PLoS Genet. 11:e10049722015. View Article : Google Scholar : PubMed/NCBI

35 

Asano K, Suzuki T, Saito A, Wei FY, Ikeuchi Y, Numata T, Tanaka R, Yamane Y, Yamamoto T, Goto T, et al: Metabolic and chemical regulation of tRNA modification associated with taurine deficiency and human disease. Nucleic Acids Res. 46:1565–1583. 2018. View Article : Google Scholar : PubMed/NCBI

36 

Salinas-Giegé T, Giegé R and Giegé P: tRNA biology in mitochondria. Int J Mol Sci. 16:4518–4559. 2015. View Article : Google Scholar : PubMed/NCBI

37 

Zhou M, Xue L, Chen Y, Li H, He Q, Wang B, Meng F, Wang M and Guan MX: A hypertension-associated mitochondrial DNA mutation introduces an m1G37 modification into tRNAMet, altering its structure and function. J Biol Chem. 293:1425–1438. 2018. View Article : Google Scholar : PubMed/NCBI

38 

Li H, Geng J, Yu H, Tang X, Yang X and Xue L: Mitochondrial tRNAThr 15909A>G mutation associated with hypertension in a Chinese Han pedigree. Biochem Biophys Res Commun. 495:574–581. 2018. View Article : Google Scholar : PubMed/NCBI

39 

Zhou M, Wang M, Xue L, Lin Z, He Q, Shi W, Chen Y, Jin X, Li H, Jiang P and Guan MX: A hypertension-associated mitochondrial DNA mutation alters the tertiary interaction and function of tRNALeu(UUR). J Biol Chem. 292:13934–13946. 2017. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Lin L, Cui P, Qiu Z, Wang M, Yu Y, Wang J, Sun Q and Zhao H: The mitochondrial tRNAAla 5587T>C and tRNALeu(CUN) 12280A>G mutations may be associated with hypertension in a Chinese family. Exp Ther Med 17: 1855-1862, 2019.
APA
Lin, L., Cui, P., Qiu, Z., Wang, M., Yu, Y., Wang, J. ... Zhao, H. (2019). The mitochondrial tRNAAla 5587T>C and tRNALeu(CUN) 12280A>G mutations may be associated with hypertension in a Chinese family. Experimental and Therapeutic Medicine, 17, 1855-1862. https://doi.org/10.3892/etm.2018.7143
MLA
Lin, L., Cui, P., Qiu, Z., Wang, M., Yu, Y., Wang, J., Sun, Q., Zhao, H."The mitochondrial tRNAAla 5587T>C and tRNALeu(CUN) 12280A>G mutations may be associated with hypertension in a Chinese family". Experimental and Therapeutic Medicine 17.3 (2019): 1855-1862.
Chicago
Lin, L., Cui, P., Qiu, Z., Wang, M., Yu, Y., Wang, J., Sun, Q., Zhao, H."The mitochondrial tRNAAla 5587T>C and tRNALeu(CUN) 12280A>G mutations may be associated with hypertension in a Chinese family". Experimental and Therapeutic Medicine 17, no. 3 (2019): 1855-1862. https://doi.org/10.3892/etm.2018.7143
Copy and paste a formatted citation
x
Spandidos Publications style
Lin L, Cui P, Qiu Z, Wang M, Yu Y, Wang J, Sun Q and Zhao H: The mitochondrial tRNAAla 5587T>C and tRNALeu(CUN) 12280A>G mutations may be associated with hypertension in a Chinese family. Exp Ther Med 17: 1855-1862, 2019.
APA
Lin, L., Cui, P., Qiu, Z., Wang, M., Yu, Y., Wang, J. ... Zhao, H. (2019). The mitochondrial tRNAAla 5587T>C and tRNALeu(CUN) 12280A>G mutations may be associated with hypertension in a Chinese family. Experimental and Therapeutic Medicine, 17, 1855-1862. https://doi.org/10.3892/etm.2018.7143
MLA
Lin, L., Cui, P., Qiu, Z., Wang, M., Yu, Y., Wang, J., Sun, Q., Zhao, H."The mitochondrial tRNAAla 5587T>C and tRNALeu(CUN) 12280A>G mutations may be associated with hypertension in a Chinese family". Experimental and Therapeutic Medicine 17.3 (2019): 1855-1862.
Chicago
Lin, L., Cui, P., Qiu, Z., Wang, M., Yu, Y., Wang, J., Sun, Q., Zhao, H."The mitochondrial tRNAAla 5587T>C and tRNALeu(CUN) 12280A>G mutations may be associated with hypertension in a Chinese family". Experimental and Therapeutic Medicine 17, no. 3 (2019): 1855-1862. https://doi.org/10.3892/etm.2018.7143
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team