Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
April-2019 Volume 17 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2019 Volume 17 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Transcriptome profiling and pathway analysis of the effects of mono‑(2‑ethylhexyl) phthalate in mouse Sertoli cells

  • Authors:
    • Liqiang Wang
    • Tonghai Dou
    • Shuguang Li
    • Yang Liu
  • View Affiliations / Copyright

    Affiliations: Key Laboratory of Public Health Safety of The Ministry of Education, School of Public Health, Fudan University, Shanghai 200032, P.R. China, Department of Microbiology and Microbial Engineering, School of Life Sciences, Fudan University, Shanghai 200438, P.R. China, Shanghai Institute of Quality Inspection and Technical Research, National Quality Supervision and Inspection Center for Food Products (Shanghai), Shanghai 200233, P.R. China
  • Pages: 2821-2829
    |
    Published online on: February 4, 2019
       https://doi.org/10.3892/etm.2019.7239
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Phthalates are confirmed to have toxic effects on the reproductive system and are likely to have further damaging actions in humans. The present study explored the molecular mechanisms of the toxic effect of mono‑(2‑ethylhexyl) phthalate (MEHP) on mouse Sertoli cells. Cell apoptosis and proliferation assays were used to assess the effects of MEHP on the TM4 Sertoli cell line derived from mouse testes. TM4 cells were treated with two doses of MEHP or left untreated as a control group, followed by RNA extraction and analysis using high‑throughput transcriptome sequencing technology. The gene expression profile obtained was then subjected to a bioinformatics analysis to explore the molecular mechanisms of reproductive toxicity. The results revealed that 528 and 269 genes were upregulated in the high‑ and low‑dose MEHP groups of cells compared with the control group, while 148 and 173 genes were downregulated. Gene ontology (GO) analysis indicated that the differently expressed genes were associated with the GO term ‘extracellular region’ of the cellular component domain in the high and low MEHP groups. Compared with the control group, eight common pathway changes were identified in the high‑ and low‑dose MEHP groups, including ‘terpenoid backbone biosynthesis’. Reverse transcription‑quantitative polymerase chain reaction analysis was used to validation, and hermetic effects were observed for certain genes. These results provide an important basis and experimental data for further research into the mechanisms of phthalate‑induced toxicity.

Introduction

Phthalates are a group of industrial chemicals that are used as plasticizers, lubricants and solvents, and impart favorable characteristics to various consumer products, including food packaging, pharmaceuticals, medical devices, construction materials and household furnishings (1). In 2006, the total production of plasticizer phthalates was ~4.06 million metric tons (2). As a result of ubiquitous exposure, phthalates and their metabolites are detected in biological samples from humans, including urine and serum (3). Individuals are continuously exposed to phthalates via ingestion, inhalation, intravenous injection and skin absorption, beginning in utero, and dietary intake from contaminated foods is thought to be the most important means of exposure (4–6). Di-(2-ethylhexyl) phthalate (DEHP) is the most abundant phthalate in the environment (7). Phthalates may provoke various adverse effects, including endocrine disruption, as well as developmental and reproductive dysfunction (8). The mechanisms of their toxic effects on the reproductive system have remained to be fully elucidated; however, certain effects are potentially associated with anti-androgenic activity (9).

The molecular mechanisms of phthalate toxicity have been heavily investigated; however, previous studies have only focused on one or several cellular and molecular biological processes, or the expression of a small number of genes/proteins. It is difficult to collate this information to systematically explain the molecular mechanisms of phthalate toxicity. In recent years, next-generation sequencing (NGS) technology has emerged to provide an effective method for high-throughput sequence determination, and has markedly improved the speed and efficiency of the identification of novel key genes or biomarkers (10,11).

Previous studies have indicated that phthalates decrease the number of Sertoli cells per tubule in testis cross-sections in a dose dependent manner, promote disruption of cellular tight junction proteins (12), and decrease androgen receptor (13) and follicle-stimulating hormone (FSH) receptor expression. Sertoli cells appear to be the primary target of DEHP and mono-(2-ethylhexyl) phthalate (MEHP), an active metabolite of DEHP, in rodents (14–16). TM4 is an immature Sertoli cell line derived from the testis of an immature BALB/c mouse, and it is a particularly good model for investigating endocrine disruption, including the effects of phthalates, as the cells maintain the ability to respond to FSH stimulation and express androgen and estrogen receptors (17). Considering that NGS technology is recognized as a reliable method to determine mechanisms of drug-induced activity and to identify biomarkers (18), the present study performed whole-transcriptome sequencing of control- and MEHP-treated TM4 cells to identify differentially expressed genes (DEGs) and to provide novel insight into the toxic mechanisms of phthalates.

Materials and methods

Materials and chemicals

The TM4 normal mouse Sertoli cell line was obtained from the American Type Culture Collection (Manassas, VA, USA). Fetal bovine serum (FBS) was purchased from Thermo Fisher Scientific, Inc. (Waltham, MA, USA). MEHP standard reagent was obtained from Shanghai Aladdin Biochemical Technology Co., Ltd. (Shanghai, China). The Annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) apoptosis kit (cat. no. AD10) and Cell Counting Kit-8 (CCK-8; cat. no. CK04) were obtained from Dojindo Molecular Technologies, Inc. (Kumamoto, Japan). The TruSeq® RNA LT Sample Prep Kit v2 (cat. no. RS-122), ruSeq PE Cluster Kit v3-cBot-HS (cat. no. GD-401-3001) and TruSeq SBS Kit v3-HS (cat. no. FC-401) used for RNA library construction were obtained from Illumina, Inc. (San Diego, CA, USA). The SYBR Premix Ex Taq reagent kit (cat. no. RR420) and PrimeScript RT reagent kit (cat. no. RR037) were purchased from Takara Biotechnology Co., Ltd. (Dalian, China).

Cell culture

TM4 cells were cultured at 37°C with 5% CO2 in Dulbecco's modified Eagle's medium supplemented with 10% FBS and 0.5% penicillin-streptomycin.

Apoptosis analysis

The cells (>1×106) were seeded on a 6-well cell culture plate. Following cell attachment at 60–70%, MEHP dissolved in dimethylsufloxide (DMSO) was added. The final concentrations used were 1×10−4, 1×10−5 and 1×10−6 mol/l (1% v/v DMSO). An equal volume of DMSO was added to the control group. Each treatment group was set up in three wells. After 48 h, apoptosis was detected using a flow cytometer (FACS Calibur; Becton, Dickinson and Company, Franklin, Lakes, NJ, USA) according to the instructions of the Annexin V FITC/PI apoptosis kit.

Cell proliferation assay

TM4 cells were seeded in each well of a 96-well plate (3,000 cells per well) and incubated for 24 h at 37°C to allow for cell attachment. After 24 h, cells were exposed to serially diluted concentrations of MEHP (1×10−3, 5×10−4, 2.5×10−4, 1.25×10−4, 6.25×10−5, 3.13×10−5, 1.56×10−5, 7.81×10−6, 3.91×10−6 and 1.95×10−6 mmol/l; con1-con10, respectively). Each treatment group was set up in three wells. The cells were cultured in medium containing 10% FBS and 1% v/v DMSO. After 24 or 48 h, the relative cell number was estimated using a CCK-8 proliferation kit. The absorbance at 450 nm was read using an Envision plate reader (PerkinElmer, Inc., Waltham, MA, USA) for cell counting.

RNA library construction and sequencing

Based on the results of the proliferation assay, TM4 cells were exposed to 1×10−3 (con1) and 2.5×10−4 (con3) mmol/l MEHP for 48 h. The cells were then subjected to transcriptome sequencing. Total RNA from TM4 cells in the treated and control group was isolated using TRIzol reagent (Thermo Fisher Scientific, Inc.). The RNA quantity and quality were examined using a Nanodrop 2000 instrument (Nanodrop Technologies; Thermo Fisher Scientific, Inc.) and electrophoresis, respectively. A total of three RNA libraries were constructed using Illumina TruSeq Stranded mRNA library prep kits according to the manufacturer's protocols and all sequencing was performed using the Illumina Hiseq2500 (Illumina, Inc.). The experimental results were processed using FastQC0.11.2 software (Babraham Bioinformatics, Cambridge, UK).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

DEGs were selected from the results of the transcriptome sequencing (P<0.005) and verified by RT-qPCR. Primers (details in Table II) were designed to span intron boundaries to avoid amplification of genomic DNA and to amplify all known isoforms of each gene based on the National Center for Biotechnology Information (NCBI) Reference Sequence Database (RefSeq; http://www.ncbi.nlm.nih.gov/refseq/). Total RNA from TM4 cells in the treated and control group was isolated using TRIzol reagent (Thermo Fisher Scientific, Inc.; cat. no. 15596026). RNA was transcribed into DNA using Transcriptor First Stand cDNA Synthesis kit (Roche Diagnostics, Basel, Switzerland; cat. no. 04897030001). The RT-Primers were Anchored-oligo(dT)18 Primer and Random Hexamer Primer. Primers were synthesized by Sigma-Aldrich (Merck KGaA, Darmstadt, Germany). qPCR was performed in triplicate using 1 µl diluted complementary (c)DNA template (400 ng) in a µl total volume of 10 µl. Reactions were performed in a 384-well plate format using the ABI Viia7 Real-time PCR system (Thermo Fisher Scientific, Inc.) and Sensifast SYBR Lo-ROX Master Mix (Bioline; Meridian Life Science, Inc., Memphis, TN, USA). A third-step thermocycling protocol was used, with an initial hold at 95°C for 2 min to activate the polymerase, followed by 95°C for 2 min, 40 cycles of 95°C for 5 sec, 60°C for 20 sec, 72°C for 20 sec. The 2−ΔΔCq method was used for data normalization (19). GAPDH was used as the housekeeping gene.

Table II.

Primers used for polymerase chain reaction analysis.

Table II.

Primers used for polymerase chain reaction analysis.

Primer namePrimer sequence (5′-3′)Product length (bp)
COL1A1-S TCAGCTTTGTGGACCTCCG197
COL1A1-A ATTGCATTGCACGTCATCG
ACTN1-S AGGACACCTTCATCGTACATACCAT198
ACTN1-A CCTGAGGCGTGATGGTTGTATAG
VCL-S GTTGGAAAAGAGACTGTTCAGACCA171
VCL-A CCTAGAGCCGTCAATGAGGTAATC
CAV1-S GCAGACGAGGTGACTGAGAAGC224
CAV1-A AAGATCGTAGACAACAAGCGGTAA
MYL9-S ACTTTTCTTCTCTGCAGCAGGG253
MYL9-A ATACTCGTCTGTGGGGTTCTTCC
THBS1-S TTCCTGATGGTGAATGCTGCC158
THBS1-A GCCCTCGCATCTGTTGTTGA
COL3A1-S GTTTCTTCTCACCCTTCTTCATCC247
COL3A1-A AGGCTGTGGGCATATTGCA
SDC4-S CCCTCAGAGCCCAAGGAACT179
SDC4-A AAGAGGATGCCTACCACGCC
CD44-S ATCCCTCCGTTTCATCCAGC226
CD44-A CATGGTGGGTAAGGTACTGTTGAA
FDPS-S AGGAGGTCCTAGAGTACAATGCC195
FDPS-A TGAGGGAAGAGTCCATGATGTC
IDI1-S CCATTAAGTAACCCAGGCGAG162
IDI1-A ACCATCAGATTGGGCCTTGT
CYP51-S ATTTGGAGCTGGGCGTCAT262
CYP51-A TTCTCAGAGGCTTCATTCTTTGC
SQLE-S ACCCGGAAGTGATCATCGTG203
SQLE-A ATGGGCATTGAGACCTTCTACTGT
SPP1-S TGTCCTCTGAAGAAAAGGATGACTT238
SPP1-A TCGACTGTAGGGACGATTGGAG
GAPDH-S GCCTTCCGTGTTCCTACC183
GAPDH-A AGAGTGGGAGTTGCTGTTG

[i] S, sense; A, antisense; COL1A1, collagen type 1 α1 chain; ACTN1, actin α1; VCL, vinculin; CAV1, caveolin 1; MYL9, myosin light chain 9; THBS1, thrombospondin 1; SDC4, syndecan 4; FDPS, farnesyl diphosphate synthase; IDI1, isopentyl-diphosphate δ isomerase 1; CYP51, cytochrome P 450 family 51; SQLE, squalene epoxidase; SPP, secreted phosphoprotein 1

Analysis of transcriptome sequencing results

Sequencing data were checked for sequencing quality using FASTQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). Adaptors and poor-quality sequences were then removed using Trim Galore v0.3.7 (http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/). Pairs of trimmed reads were aligned against the human genome (hg19 build) using Tophat (v 2.1; http://ccb.jhu.edu/software/tophat/index.shtml).

Mapped fragments per kilobase of transcript per million (FPKM) of each gene or transcript variant were calculated using Cufflink software (http://cole-trapnell-lab.github.io/cufflinks/). Cuffdiff software produces the P-value and q-value. The number of DEGs screened by the Q-value may be too small for enrichment analysis. More DEGs may be obtained by using the P-value, which is conducive to subsequent enrichment analysis. Furthermore, certain randomly emerging DEGs can be filtered out by enrichment analysis to avoid their influence on the experimental result. Therefore, the P-value was selected as a screening index, with a cutoff criterion of P < 0.05, which was used to screen for DEGs. Functional enrichment analysis of DEGs was performed using Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis (www.genome.jp/kegg) and gene ontology (GO) analysis (http://www.geneontology.org/).

Statistical analysis

All data were analyzed using SPSS 18.0 software (SPSS, Inc., Chicago, IL, USA). Fisher's exact test was used to identify the DEGs. The Benjamini-Hochberg correction was used to control for false-positives. Normally distributed data are presented as the mean ± standard deviation, while a Kruskal-Wallis test was used to analyze data with an abnormal distribution, which are presented as the median and interquartile range (Q). Shapiro-Wilk test was used to examine whether data were normally distributed. First, one-way analysis of variance was used to determine significant differences among all groups, including one control group and two treated groups. If the difference was statistically significant, a Fisher's least-significant differences test was used for further mutual and random comparison among the three groups. P<0.05 was considered to indicate a statistically significant difference.

Results

Analysis of apoptosis

TM4 cells treated with different concentrations of MEHP for 48 h were analyzed using flow cytometry to detect apoptosis. The results indicated that MEHP at concentrations of ≤1×10−4 mol/l did not significantly affect the viability of the cells (χ2=7.421; P=0.06; Table I). Therefore, MEHP was used at this non-toxic concentration range for the subsequent cell proliferation assays.

Table I.

Results of the flow cytometric early apoptosis (%) assay.

Table I.

Results of the flow cytometric early apoptosis (%) assay.

MEHP, mol/lM, % (Xmin, Xmax)Q (%)χ2P-value
0 (control)0.39 (0.34, 0.45)0.067.420.06
1×10−40.49 (0.47, 0.98)0.14
1×10−50.48 (0.20, 0.55)0.16
1×10−60.46 (0.38, 0.56)0.14

[i] Values are expressed as the M (Xmin, Xmax). M, median of early apoptotic cells; Xmin, minimum value; Xmax, maximum value; Q, interquartile range; MEHP, mono-(2-ethylhexyl) phthalate

Cell proliferation

The cell growth curves indicated that the differences in cell proliferation among the groups were more marked after 48 h of exposure compared with those at 24 h. The cell proliferation rates of the con1 and con3 groups were significantly lower than those in the other groups (Fig. 1). In order to better reflect the differences in phenotypic changes of the cells, con1 and con3 were used as the high and low doses, respectively, in the transcriptome sequencing experiments and the exposure time was set at 48 h.

Figure 1.

Effect of MEHP on cell proliferation. Cell proliferation curve following exposure to MEHP for (A) 24 h and (B) 48 h. **P<0.01 vs. control (0 mM). MEHP, mono-(2-ethylhexyl) phthalate; OD, optical density.

Transcriptome sequencing and DEG analysis

To determine the effects of MEHP on Sertoli cells, transcriptome sequencing was performed using a cDNA library generated from an equal amount of RNA isolated from the control or MEHP-treated TM4 cells. An average of 10,947 genes (with a required FPKM value of >0.7) were detected among the different groups.

A total of 528 and 269 genes were identified to be upregulated in the con1 and con3 group cells, respectively, compared with the control group (DMSO); in addition, 148 and 173 genes were downregulated, respectively (Fig. 2). Among these genes, 165 were consistently upregulated and 45 were consistently downregulated in the two MEHP-treated groups (con1 and con3). These 210 DEGs were regarded as candidates for further investigation.

Figure 2.

Composition of DEGs in two samples with different concentrations used for transcriptome sequencing. DEGs, differentially expressed genes; DMSO, dimethyl sulfoxide; up, upregulated; down, downregulated; con1, MEHP at 1×10−3 mmol/l; con2, MEHP at 5×10−4 mmol/l.

Enrichment analysis of DEGs

Functional enrichment analysis of DEGs was performed using the GO and KEGG methods. GO analysis of the con1 group provided significant enrichment of DEGs in 119 terms in the biological process (BP), 20 in the cellular component (CC) and 16 in the molecular function (MF) category (P<0.01). For the con3 group, the DEGs were significantly enriched in 116 BP, 6 CC and 12 MF terms (P<0.01). The top 30 GO categories with significant enrichment of DEGs (con1 and con3 vs. DMSO group) are presented in Fig. 3A and B, respectively. Based on the level of significance, the top term was ‘extracellular region’ in the CC domain in the con1 and con3 groups.

Figure 3.

GO analysis of DEGs. (A) GO categories of the con1 vs. DMSO group DEGs. (B) GO categories of the con3 vs. DMSO group DEGs. GO, gene ontology; DEGs, differentially expressed genes; DMSO, dimethyl sulfoxide; MF, molecular function; BP, biological process; CC, cellular component; con 1, MEHP at 1×10−3 mmol/l; con3, MEHP at 2.5×10−4 mmol/l.

In the KEGG analysis, 22 signaling pathways were significantly enriched by the DEGs from the con1 group (P<0.05; Fig. 4A). For the con3 group, 10 signaling pathways were significantly enriched by the DEGs (P<0.05; Fig. 4B). The pathways were mainly associated with tumors, steroid synthesis and cell adhesion. According to the statistical significance, the top three pathways were ‘focal adhesion’, ‘extracellular matrix (ECM)-receptor interaction’ and ‘terpenoid backbone biosynthesis’.

Figure 4.

Scatterplot for most enriched KEGG pathways of DEGs in the MEHP-treated group compared with control cells. (A) Differentially enriched KEGG pathways in the con1 group compared with the control group. (B) Differentially enriched KEGG pathways in the con3 group compared with the control group. Enrichment factor was the ratio of the number of DEGs to the total gene number. Smaller P-values indicate a higher degree of enrichment. KEGG, Kyoto Encyclopedia of Genes and Genomes; DEGs, differentially expressed genes; MEHP, mono-(2-ethylhexyl) phthalate; ECM, extracellular matrix; TGF, transforming growth factor; MAPK, mitogen-activated protein kinase; mmu, Mus musculus; con 1, con1, MEHP at 1×10−3 mmol/l; con3, MEHP at 2.5×10−4 mmol/l.

Compared with the control group, there were eight common enriched pathways in the high- and low-dose groups, including ‘terpenoid backbone biosynthesis’, ‘focal adhesion’, ‘ECM-receptor interaction’, ‘pathways in cancer’, ‘colorectal cancer’, ‘transforming growth factor-β signaling pathway’, ‘vascular smooth muscle contraction’ and ‘axon guidance’.

RT-qPCR validation of transcriptome sequencing

To validate the results of the transcriptome sequencing, transcripts of 14 key DEGs associated with the enriched KEGG pathways were detected using RT-qPCR (Fig. 5). The analysis confirmed the aberrant expression of collagen type I α 1 chain (COL1A1), actinin α 1 (ACTN1), vinculin (VCL), caveolin 1 (CAV1) and myosin light chain 9 (MYL9) for the ‘focal adhesion’ pathway, thrombospondin 1 (THBS1), COL3A1, secreted phosphoprotein 1 (SPP1), syndecan 4 (SDC4) and CD44 for the ‘ECM-receptor interaction’, and farnesyl diphosphate synthase (FDPS), isopentenyl-diphosphate δ isomerase 1 (IDI1), cytochrome P450 family 51 (CYP51) and squalene epoxidase (SQLE) for ‘terpenoid backbone biosynthesis and steroid biosynthesis’. Please clarify whether this only applies to SQLE.

Figure 5.

mRNA expression of 14 genes in the MEMP-treated TM4 cells. *P<0.05, **P<0.01. MEHP, mono-(2-ethylhexyl) phthalate; con1, MEHP at 1×10−3 mmol/l; con3, MEHP at 2.5×10−4 mmol/l; COL1A1, collagen type 1 α1 chain; ACTN1, actin α1; VCL, vinculin; CAV1, caveolin 1; MYL9, myosin light chain 9; THBS1, thrombospondin 1; SDC4, syndecan 4; FDPS, farnesyl diphosphate synthase; IDI1, isopentyl-diphosphate δ isomerase 1; CYP51, cytochrome P 450 family 51; SQLE, squalene epoxidase; SPP, secreted phosphoprotein 1.

The mRNA levels of COL1A, VCL, ACTN1, CAV1, MYL9, THBS1, COL3A, SDC4, CD44 and SPP1 were significantly decreased in the low-does (con3) and high-dose (con1) groups. However, four genes, FDPS, IDI1, CYP51 and SQLE, were increased in the low-dose group and decreased in the high-dose group.

Discussion

In the last 70 years, the use of phthalates has changed the materials science substantially, which has made exposure to phthalates unavoidable. In view of the harm that phthalates may cause to the body, particularly in sensitive populations, including infants and young children, the damaging effects of phthalates have received increasing attention (20–24). However, the internal exposure of the human body to phthalates was not as high as expected. Studies have reported that the mean concentrations of MEHP in the cord blood of neonates, the group considered to be most sensitive to the developmental and reproductive toxicity of phthalates, were 2×10−6 and 1.1×10−8 M (4,25). Although exposure to small amounts does not directly cause cell death, it may have sub-lethal cytological effects, including genetic damage and malfunction of cellular metabolism (26). MEHP is the major toxic metabolite of DEHP and is known to have reproductive and developmental toxicity (27–29); thus, in the present study, a low exposure dose of MEHP that was not lethal to TM4 cells was used in order to realistically mimic human internal exposure to DEHP, which is the most widely used phthalate. The appropriate dose of MEHP, which was not lethal to TM4 cells, was determined in a cell apoptosis assay. The concentration and exposure time used in the transcriptome sequencing experiment were determined from the results of a cell proliferation assay. Transcriptome sequencing of TM4 cells was performed following treatment with MEHP or control treatment. The combination of next-generation transcriptome sequencing technology and bioinformatics analysis provides a useful method to analyze the mechanisms of action of toxic chemical agents, and to identify potential hazardous compounds. To the best of our knowledge, the present study was the first to use transcription sequencing to investigate gene expression changes in the TM4 Sertoli cell line following treatment with MEHP.

Transcriptomics approaches have previously been used to investigate the toxic effects of DEHP (30). Studies have revealed that phthalates have effects on peroxisome proliferator-activated receptors (PPARs), tumor necrosis factor signaling pathways, calcium binding and numerous myosin proteins. In the present study, 165 genes were upregulated and 45 were downregulated in the two MEHP-treated groups of TM4 cells. The genes with the greatest change in expression out of the 210 DEGs may potentially be used as biomarkers of DEHP-induced damage and as a useful tool to further improve the identification of developmental toxicants (31). The DEGs of the high- and low-dose groups had 8 pathways in common. In the GO analysis, the terms with the highest significance, in the con1 and con3 groups, was ‘extracellular region’ in the CC domain. In the KEGG analysis, the top three pathways (P<0.01) were ‘focal adhesion’, ‘regulation of actin cytoskeleton’ and ‘ECM receptor interaction’. The results were consistent for the responses of TM4 cells to 1×10−3 and 2.5×10−4 mmol/l MEHP. In the study by Nardelli et al (32), 13 DEGs associated with PPAR and cholesterol biosynthesis signaling pathways were identified using a gene expression microarray. The present study provides evidence supporting the roles of genes associated with ‘focal adhesion’, ‘regulation of actin cytoskeleton’ and ‘ECM-receptor interaction’ as the key functional genes that mediate the effects of low-dose MEHP in Sertoli cells. Furthermore, the RT-qPCR results confirmed that the expression of genes with roles in ‘focal adhesion’ and ‘ECM-receptor interaction’ was decreased with the levels of MEHP exposure increasing, indicating a dose-response effect.

KEGG analysis revealed that the ‘focal adhesion’ pathway was enriched in the largest number of DEGs in the high- and low-dose groups, and RT-qPCR analysis confirmed that the gene expression of COL1A1, ACTN1, VCL, CAV1 and MYL9 was decreased following MEHP treatment in a dose-dependent manner. Ectoplasmic specialization (ES) is a unique cellular structure that maintains cell shape and connections between Sertoli cells. Actinin, fimbrin, espin and vinculin are all involved in ES (33,34). It was previously reported that MEHP is able to destroy the ES between rat Sertoli cells and spermatogenic cells, causing a release of the immature germ cells into the seminiferous tubule, which weakens reproductive function (35,36). The present study indicated that the expression of the genes that encode actinin and vinculin was decreased by MEHP, which was similar to the results of a previous study, in which Syrian hamster embryo cells were exposed to 50 µM DEHP for 24 h, revealing that the downregulated genes were associated with focal adhesion or cell junctions (37). This indicates that MEHP may affect the ECM-receptor interaction and focal adhesions to disrupt intercellular junctions and the formation of fissures between Sertoli cells and spermatogenic cells, resulting in the loss of spermatogenic cells from the seminiferous epithelium.

Previous studies have reported that target genes altered by phthalates are involved in several important signaling pathways, including steroid synthesis, as well as lipid and cholesterol homeostasis (38,39). Testosterone is the major androgen and anabolic hormone, with an important role in the growth and development of male animals. It has been previously demonstrated that DEHP is able to mimic or antagonize the actions of steroid hormones (40), and the effects of DEHP on testosterone and estrogen-like activity have also been reported (41). Considering the fundamental role of steroid hormones in reproductive and developmental functions, an imbalance in the synthesis and/or signaling of these hormones may adversely affect different aspects of sexual development (42). Of note, in the present study, the enrichment of two pathways, ‘terpenoid backbone biosynthesis’ and ‘steroid biosynthesis’, was higher in the low-dose MEHP group than the high-dose group and the control group, indicating that different doses of MEHP may exhibit opposing effects on the synthesis of steroidal compounds in Sertoli cells, which is potentially associated with the excitatory effect of MEHP. Biphasic effects of di (n-butyl) phthalate were observed on cholesterol side-chain cleavage enzyme and 3β-hydroxysteroid dehydrogenase mRNA, which were generally increased at a low dose of 10 mg/kg, and at higher doses (50–400 mg/kg), an apparent dose-dependent decrease was obtained (43). Hormesis is a concept describing a dose-response association where there is a stimulation at a low dose and inhibition at a high dose (44). Hormetic effects are considered as an adaptive response to a moderate stress induced by the stimulus (45). A study has proved that the developmental toxicity of DEHP may be hermetic by using a score test (46). In this light, the present results suggest a hormetic-like biphasic dose-response association of MEHP in Sertoli cells. Cell signaling-mediated bidirectional control of gene expression has been considered as the major hormetic mechanism triggered by exposure to xenobiotics (47). This indicates that ‘terpenoid backbone biosynthesis’ and ‘steroid biosynthesis’ signaling pathways were activated in response to this low level of exposure. This indicates that MEHP may affect testosterone synthesis via multiple mechanisms to cause reproductive toxicity.

The results of the present study demonstrated that the mechanisms of the toxicity of MEHP are complex, including effects on reproduction, development and metabolism involving a numerous different genes, cellular processes and signaling pathways. The interaction of these factors ultimately leads to the complex toxic effects of MEHP. Although the present study is limited to gene expression changes, the results of the present study provide a foundation for further examination of the toxic effects of low-level phthalate exposure. More gene and protein expression validation and functional analyses should be performed to fully elucidate the molecular mechanisms of phthalate toxicity.

Acknowledgements

Not applicable.

Funding

This work was supported by funding from the National Natural Science Foundation of China (grant no. 81202208).

Availability of data and materials

The datasets generated and/or analyzed during the current study are not publicly available due to ongoing research; however, data are available from the corresponding author on reasonable request.

Authors' contributions

LW was responsible for experimental design, implementation and writing of article. TD was responsible for experimental data processing. SL was responsible for experimental design and revision of the article. YL was responsible for experimental design and revision of the article. All authors have read and approved the manuscript.

Ethics approval and informed consent

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Schettler T: Human exposure to phthalates via consumer products. Int J Androl. 29:134–139; discussion 181–185. 2006. View Article : Google Scholar : PubMed/NCBI

2 

Markarian J: PVC additives-What lies ahead? Plast Addit Compound. 9:22–25. 2007. View Article : Google Scholar

3 

Högberg J, Hanberg A, Berglund M, Skerfving S, Remberger M, Calafat AM, Filipsson AF, Jansson B, Johansson N, Appelgren M and Håkansson H: Phthalate diesters and their metabolites in human breast milk, blood or serum, and urine as biomarkers of exposure in vulnerable populations. Environ Health Perspect. 116:334–339. 2008. View Article : Google Scholar : PubMed/NCBI

4 

Latini G, De Felice C, Presta G, Del Vecchio A, Paris I, Ruggieri F and Mazzeo P: In utero exposure to di-(2-ethylhexyl)phthalate and duration of human pregnancy. Environ Health Perspect. 111:1783–1785. 2003. View Article : Google Scholar : PubMed/NCBI

5 

Latini G, De Felice C, Presta G, Del Vecchio A, Paris I, Ruggieri F and Mazzeo P: Exposure to Di(2-ethylhexyl)phthalate in humans during pregnancy. A preliminary report. Biol Neonate. 83:22–24. 2003. View Article : Google Scholar : PubMed/NCBI

6 

Swan SH: Prenatal phthalate exposure and anogenital distance in male infants. Environ Health Perspect. 114:A88–A89. 2006. View Article : Google Scholar : PubMed/NCBI

7 

Fay M, Donohue JM and De Rosa C: ATSDR evaluation of health effects of chemicals. VI. Di(2-ethylhexyl)phthalate. Agency for toxic substances and disease registry. Toxicol Ind Health. 15:651–746. 1999. View Article : Google Scholar : PubMed/NCBI

8 

Lyche JL, Gutleb AC, Bergman A, Eriksen GS, Murk AJ, Ropstad E, Saunders M and Skaare JU: Reproductive and developmental toxicity of phthalates. J Toxicol Environ Health B Crit Rev. 12:225–249. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Fratantoni JC: Review: The platelet storage lesion: Possible role of plasticizers? Blood Cells. 18:435–440; discussion 441–443. 1992.PubMed/NCBI

10 

Hayes DN and Kim WY: The next steps in next-gen sequencing of cancer genomes. J Clin Invest. 125:462–468. 2015. View Article : Google Scholar : PubMed/NCBI

11 

Wang Q, Lu Q and Zhao H: A review of study designs and statistical methods for genomic epidemiology studies using next generation sequencing. Front Genet. 6:1492015. View Article : Google Scholar : PubMed/NCBI

12 

Fiorini C, Tilloy-Ellul A, Chevalier S, Charuel C and Pointis G: Sertoli cell junctional proteins as early targets for different classes of reproductive toxicants. Reprod Toxicol. 18:413–421. 2004. View Article : Google Scholar : PubMed/NCBI

13 

Rodriguez-Sosa JR, Bondareva A, Tang L, Avelar GF, Coyle KM, Modelski M, Alpaugh W, Conley A, Wynne-Edwards K, França LR, et al: Phthalate esters affect maturation and function of primate testis tissue ectopically grafted in mice. Mol Cell Endocrinol. 398:89–100. 2014. View Article : Google Scholar : PubMed/NCBI

14 

Sjöberg P, Bondesson U, Kjellen L, Lindquist NG, Montin G and Plöen L: Kinetics of di-(2-ethylhexyl) phthalate in immature and mature rats and effect on testis. Acta Pharmacol Toxicol (Copenh). 56:30–37. 1985. View Article : Google Scholar : PubMed/NCBI

15 

Sjöberg P, Lindqvist NG and Plöen L: Age-dependent response of the rat testes to di(2-ethylhexyl) phthalate. Environ Health Perspect. 65:237–242. 1986. View Article : Google Scholar : PubMed/NCBI

16 

Chapin RE, Gray TJ, Phelps JL and Dutton SL: The effects of mono-(2-ethylhexyl)-phthalate on rat Sertoli cell-enriched primary cultures. Toxicol Appl Pharmacol. 92:467–479. 1988. View Article : Google Scholar : PubMed/NCBI

17 

Galdieri M, Ziparo E, Palombi F, Russo MA and Stefanini M: Pure sertoli cell cultures: A new model for the study of somatic-Germ cell interactions. J Androl. 2:249–254. 1981. View Article : Google Scholar

18 

van Dijk EL, Auger H, Jaszczyszyn Y and Thermes C: Ten years of next-generation sequencing technology. Trends Genet. 30:418–426. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

20 

Casas L, Fernández MF, Llop S, Guxens M, Ballester F, Olea N, Irurzun MB, Rodríguez LS, Riaño I, Tardón A, et al: Urinary concentrations of phthalates and phenols in a population of Spanish pregnant women and children. Environ Int. 37:858–866. 2011. View Article : Google Scholar : PubMed/NCBI

21 

Frederiksen H, Aksglaede L, Sorensen K, Skakkebaek NE, Juul A and Andersson AM: Urinary excretion of phthalate metabolites in 129 healthy Danish children and adolescents: Estimation of daily phthalate intake. Environ Res. 111:656–663. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Guo Y and Kannan K: Comparative assessment of human exposure to phthalate esters from house dust in China and the United States. Environ Sci Technol. 45:3788–3794. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Romero-Franco M, Hernández-Ramírez RU, Calafat AM, Cebrián ME, Needham LL, Teitelbaum S, Wolff MS and López-Carrillo L: Personal care product use and urinary levels of phthalate metabolites in Mexican women. Environ Int. 37:867–871. 2011. View Article : Google Scholar : PubMed/NCBI

24 

Woodruff TJ, Zota AR and Schwartz JM: Environmental chemicals in pregnant women in the United States: NHANES 2003–2004. Environ Health Perspect. 119:878–885. 2011. View Article : Google Scholar : PubMed/NCBI

25 

Lin S, Ku HY, Su PH, Chen JW, Huang PC, Angerer J and Wang SL: Phthalate exposure in pregnant women and their children in central Taiwan. Chemosphere. 82:947–955. 2011. View Article : Google Scholar : PubMed/NCBI

26 

Midic U, Vincent KA, VandeVoort CA and Latham KE: Effects of long-term endocrine disrupting compound exposure on Macaca mulatta embryonic stem cells. Reprod Toxicol. 65:382–393. 2016. View Article : Google Scholar : PubMed/NCBI

27 

Moss EJ, Cook MW, Thomas LV and Gray TJ: The effect of mono-(2-ethylhexyl) phthalate and other phthalate esters on lactate production by Sertoli cells in vitro. Toxicol Lett. 40:77–84. 1988. View Article : Google Scholar : PubMed/NCBI

28 

Lamb JC IV and Chapin RE: Testicular and germ cell toxicity: In vitro approaches. Reprod Toxicol. 7 (Suppl 1):S17–S22. 1993. View Article : Google Scholar

29 

Davis BJ, Weaver R, Gaines LJ and Heindel JJ: Mono-(2-ethylhexyl) phthalate suppresses estradiol production independent of FSH-cAMP stimulation in rat granulosa cells. Toxicol Appl Pharmacol. 128:224–228. 1994. View Article : Google Scholar : PubMed/NCBI

30 

Stenz L, Escoffier J, Rahban R, Nef S and Paoloni-Giacobino A: Testicular dysgenesis syndrome and long-lasting epigenetic silencing of mouse sperm genes involved in the reproductive system after prenatal exposure to DEHP. PLoS One. 12:e01704412017. View Article : Google Scholar : PubMed/NCBI

31 

van Dartel DA, Pennings JL, Robinson JF, Kleinjans JC and Piersma AH: Discriminating classes of developmental toxicants using gene expression profiling in the embryonic stem cell test. Toxicol Lett. 201:143–151. 2011. View Article : Google Scholar : PubMed/NCBI

32 

Nardelli TC, Erythropel HC and Robaire B: Toxicogenomic screening of replacements for di(2-Ethylhexyl) phthalate (DEHP) using the immortalized TM4 sertoli cell line. PLoS One. 10:e01384212015. View Article : Google Scholar : PubMed/NCBI

33 

Vogl AW, Pfeiffer DC and Redenbach DM: Ectoplasmic (‘junctional’) specializations in mammalian Sertoli cells: Influence on spermatogenic cells. Ann NY Acad Sci. 637:175–202. 1991. View Article : Google Scholar : PubMed/NCBI

34 

Vogl AW, Pfeiffer DC, Mulholland D, Kimel G and Guttman J: Unique and multifunctional adhesion junctions in the testis: Ectoplasmic specializations. Arch Histol Cytol. 63:1–15. 2000. View Article : Google Scholar : PubMed/NCBI

35 

Li LH, Jester WF Jr and Orth JM: Effects of relatively low levels of mono-(2-ethylhexyl) phthalate on cocultured Sertoli cells and gonocytes from neonatal rats. Toxicol Appl Pharmacol. 153:258–265. 1998. View Article : Google Scholar : PubMed/NCBI

36 

Yao PL, Lin YC and Richburg JH: Mono-(2-ethylhexyl) phthalate-induced disruption of junctional complexes in the seminiferous epithelium of the rodent testis is mediated by MMP2. Biol Reprod. 82:516–527. 2010. View Article : Google Scholar : PubMed/NCBI

37 

Landkocz Y, Poupin P, Atienzar F and Vasseur P: Transcriptomic effects of di-(2-ethylhexyl)-phthalate in Syrian hamster embryo cells: An important role of early cytoskeleton disturbances in carcinogenesis? BMC Genomics. 12:5242011. View Article : Google Scholar : PubMed/NCBI

38 

Thompson CJ, Ross SM and Gaido KW: Di(n-butyl) phthalate impairs cholesterol transport and steroidogenesis in the fetal rat testis through a rapid and reversible mechanism. Endocrinology. 145:1227–1237. 2004. View Article : Google Scholar : PubMed/NCBI

39 

Liu K, Lehmann KP, Sar M, Young SS and Gaido KW: Gene expression profiling following in utero exposure to phthalate esters reveals new gene targets in the etiology of testicular dysgenesis. Biol Reprod. 73:180–192. 2005. View Article : Google Scholar : PubMed/NCBI

40 

Sharpe RM: Hormones and testis development and the possible adverse effects of environmental chemicals. Toxicol Lett. 120:221–232. 2001. View Article : Google Scholar : PubMed/NCBI

41 

Akingbemi BT, Ge R, Klinefelter GR, Zirkin BR and Hardy MP: Phthalate-induced Leydig cell hyperplasia is associated with multiple endocrine disturbances. Proc Natl Acad Sci USA. 101:775–780. 2004. View Article : Google Scholar : PubMed/NCBI

42 

Gunnarsson D, Leffler P, Ekwurtzel E, Martinsson G, Liu K and Selstam G: Mono-(2-ethylhexyl) phthalate stimulates basal steroidogenesis by a cAMP-independent mechanism in mouse gonadal cells of both sexes. Reproduction. 135:693–703. 2008. View Article : Google Scholar : PubMed/NCBI

43 

Bello UM, Madekurozwa MC, Groenewald HB, Aire TA and Arukwe A: The effects on steroidogenesis and histopathology of adult male Japanese quails (Coturnix coturnix japonica) testis following pre-pubertal exposure to di(n-butyl) phthalate (DBP). Comp Biochem Physiol C Toxicol Pharmacol. 166:24–33. 2014. View Article : Google Scholar : PubMed/NCBI

44 

Calabrese EJ and Baldwin LA: Hormesis: U-shaped dose responses and their centrality in toxicology. Trends Pharmacol Sci. 22:285–291. 2001. View Article : Google Scholar : PubMed/NCBI

45 

Calabrese EJ: Overcompensation stimulation: A mechanism for hormetic effects. Crit Rev Toxicol. 31:425–470. 2001. View Article : Google Scholar : PubMed/NCBI

46 

Hunt D and Rai SN: Testing threshold and hormesis in a random effects dose-response model applied to developmental toxicity data. Biom J. 47:319–328. 2005. View Article : Google Scholar : PubMed/NCBI

47 

Chen F, Liu SS, Yu M, Qu R and Wang MC: Blocking the entrance of AMP pocket results in hormetic stimulation of imidazolium-based ionic liquids to firefly luciferase. Chemosphere. 132:108–113. 2015. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang L, Dou T, Li S and Liu Y: Transcriptome profiling and pathway analysis of the effects of mono‑(2‑ethylhexyl) phthalate in mouse Sertoli cells. Exp Ther Med 17: 2821-2829, 2019.
APA
Wang, L., Dou, T., Li, S., & Liu, Y. (2019). Transcriptome profiling and pathway analysis of the effects of mono‑(2‑ethylhexyl) phthalate in mouse Sertoli cells. Experimental and Therapeutic Medicine, 17, 2821-2829. https://doi.org/10.3892/etm.2019.7239
MLA
Wang, L., Dou, T., Li, S., Liu, Y."Transcriptome profiling and pathway analysis of the effects of mono‑(2‑ethylhexyl) phthalate in mouse Sertoli cells". Experimental and Therapeutic Medicine 17.4 (2019): 2821-2829.
Chicago
Wang, L., Dou, T., Li, S., Liu, Y."Transcriptome profiling and pathway analysis of the effects of mono‑(2‑ethylhexyl) phthalate in mouse Sertoli cells". Experimental and Therapeutic Medicine 17, no. 4 (2019): 2821-2829. https://doi.org/10.3892/etm.2019.7239
Copy and paste a formatted citation
x
Spandidos Publications style
Wang L, Dou T, Li S and Liu Y: Transcriptome profiling and pathway analysis of the effects of mono‑(2‑ethylhexyl) phthalate in mouse Sertoli cells. Exp Ther Med 17: 2821-2829, 2019.
APA
Wang, L., Dou, T., Li, S., & Liu, Y. (2019). Transcriptome profiling and pathway analysis of the effects of mono‑(2‑ethylhexyl) phthalate in mouse Sertoli cells. Experimental and Therapeutic Medicine, 17, 2821-2829. https://doi.org/10.3892/etm.2019.7239
MLA
Wang, L., Dou, T., Li, S., Liu, Y."Transcriptome profiling and pathway analysis of the effects of mono‑(2‑ethylhexyl) phthalate in mouse Sertoli cells". Experimental and Therapeutic Medicine 17.4 (2019): 2821-2829.
Chicago
Wang, L., Dou, T., Li, S., Liu, Y."Transcriptome profiling and pathway analysis of the effects of mono‑(2‑ethylhexyl) phthalate in mouse Sertoli cells". Experimental and Therapeutic Medicine 17, no. 4 (2019): 2821-2829. https://doi.org/10.3892/etm.2019.7239
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team