International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Undiagnosed pneumonia was first reported in Wuhan (Hubei province) in December 2019, followed by outbreaks in several parts of China in the following month, and also in South Korea, Japan, Thailand, America, Australia and other countries. A novel coronavirus has been isolated from the respiratory tract of patients, which has been named severe acute respiratory syndrome (SARS) coronavirus (CoV) 2 (SARS-CoV-2) by the International Virus Classification Committee (1). The disease, which is caused by SARS-CoV-2, was named coronavirus disease 2019 (COVID-19) by the World Health Organization (1,2).
Coronaviruses are single-stranded positive strand RNA viruses, which are divided into four genera: α, β, λ and δ (1,2). Coronaviruses have been indicated to infect numerous animals, including bats, pigs, cattle, mice and monkeys (3,4). A total of six types of coronavirus in infected individuals exist, which belong to the genera α (229E and NL63) and β (OC43, HKU1, Middle East respiratory syndrome-related CoV and SARS-CoV) (2). SARS-CoV-2 is a newly discovered β-coronavirus (4), and it has been speculated that it was transmitted to humans by bats.
At present, Wuhan is the most serious epidemic area in China. COVID-19 is a public health emergency with the fastest speed and the widest scope in Chinese history. Although COVID-19 has been listed in China as a class B infectious disease, a prevention and control scheme for class A infectious diseases has been adopted (4). The clinical and imaging features of COVID-19 have been rarely reported, to the best of our knowledge. In the current study, the clinical and imaging characteristics of COVID-19 were summarized via comparing and analyzing the clinical, laboratory and imaging data of patients with COVID-19 and non-COVID-19, which may aid in the improvement of the understanding and diagnosis of the disease, and in limiting the spread of COVID-19.
The study protocol was approved by the Regional Ethics Committee for Clinical Research of the Second Affiliated Hospital of Qiqihar Medical College (Qiqihar, China). Written informed consent was obtained from all patients. For patients that were minors, informed consent was obtained from their parents or guardians.
A retrospective study was conducted in 152 patients with pneumonia diagnosed in the Second Affiliated Hospital of Qiqihar Medical College and the First Hospital of Jilin University from December 30, 2019 to February 29, 2020. Inclusion criteria: Clinical symptoms such as cough, sputum, fever and chest tightness; physical examination with or without lung rales, or tubular breathing; and a CT diagnosis showing pneumonia. Pharyngeal swabs for nucleic acid detection of respiratory secretions were used for all patients. All patients have complete clinical records. Malignant tumor, secondary infection of bronchiectasis and pulmonary fibrosis pneumonia were excluded. The clinical characteristics of the patients are presented in Table I.
Throat swabs were collected from all of the patients. The swab head was broken and immersed in an Eppendorf (EP) tube containing 2 ml of isotonic salt solution. The cap of the tube was closed and sent to the hospital laboratory within 15 min to 2 h. Total RNA was extracted using nucleic acid extraction or purification kits (Zhongshan Daan gene company; cat. no. DA0623). The procedures were as follows: 200 µl liquid from the EP tube was taken and put into the nucleic acid extraction plate hole, which was pre-loaded with 20 µl protease K. According to the magnetic bead extraction method (5), total RNA was extracted using the Tianlong nucleic acid automatic extraction instrument (Shaanxi Xi'an Tianlong Technology Co., Ltd.; nucleic acid extractor NP968). A total of 5 µl of extracted RNA was added into the PCR reaction tubules which were pre-loaded with 19 µl fluorescent PCR probe (designed for the conservative ORF1a/b: Forward primer: CCCTGTGGGTTTTACACTTAA, reverse primer: ACGATTGTGCATCAGCTGA, fluorescent probe: 5'-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3' and N genes: Forward primer: GGGGAACTTCTCCTGCTAGAAT, reverse primer: CAGACATTTTGCTCTCAAGCTG, fluorescent probe: 5'-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3') and 1 µl RT-PCR enzyme mixed amplification reagent (Sun Yat-sen University Daan Gene Co., Ltd.). An ABI 7500 real time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) was used to carry out the amplification procedure, the details were as follows: 50˚C for 15 min, 95˚C for 15 min, followed by 45 cycles of 94˚C for 15 sec and 55˚C for 45 sec.
The patients underwent a 64-slice CT scan. The patients were placed on the supine position on a CT scan bed, and ceased breathing temporarily for the chest scan to take place. The CT parameters were as follows: The tube voltage was 120 kV, the tube current was 100-150 mA, the thickness of the layer was 1 mm and the distance of the layer was 1 mm. Two experienced radiologists retrospectively evaluated the CT images of the patients, according to the following factors: Ground-glass opacity (GGO), resolution, angiographic thickening, paving stone sign, air bronchi sign, halo sign and CT distribution. GGO was defined as mildly increased opacification that did not obscure the underlying vasculature. Angiographic thickening refers to the thickened blood vessels visible in GGO. Paving stone sign refers to the widening of the leaflet interval visible in GGO.
Within 24 h of admission, blood samples were collected at the Second Affiliated Hospital of Qiqihar Medical College and sent to the affiliated laboratory. The blood samples were tested for white blood cell count (normal range, 3.50-9.5x109/l), neutrophil ratio (normal range, 0.3-0.7), lymphocyte ratio (normal range, 0.2-0.5), monocyte ratio (normal range, 0.03-0.1), eosinophil ratio (normal range, 0.004-0.08), C-reactive protein (normal range, 0-5 mg/l) and procalcitonin (normal range, 0-0.5 µg/l). The patients' clinical manifestations and laboratory results were analyzed retrospectively.
Statistical analyses were performed using SPSS v18.0 software (SPSS, Inc.). The data are presented as the mean ± standard deviation for continuous variables. Data on categorical variables (laboratory inspection and CT findings) are presented as n-values and percentages. According to the nucleic acid detection results, the patients were divided into COVID-19 and non-COVID-19 groups. Data were compared using Student's unpaired t-tests for continuous variables and χ2 or Fisher's exact test for categorical variables. The relevant receiver operating characteristic (ROC) curves were plotted, and the AUC was calculated. P<0.05 was considered to indicate statistically significant difference.
The current study included 152 patients, of which 65 cases with a positive reverse transcription-quantitative PCR (RT-qPCR) test were diagnosed as COVID-19, and 87 cases with a negative RT-qPCR test were non-COVID-19 (Table I). Except for gender (P=0.036) and contact history (P<0.001), there was no significant difference in the clinical characteristics of asymptomatic (P=0.739), cough (P=0.438), fever (P=0.897) and sore throat (P=0.243) between the two groups. The difference between age (P=0.357) and underlying disease (P=0.608) in patients with diabetes was not statistically significant. In the COVID-19 group, 70.77% (46/65) patients were male, and 98.46% (64/65) patients had lived, traveled or contacted infected people in the affected area, which were higher than those in the non-COVID-19 group (Table I).
The normal/low white blood cell count (P<0.001), low lymphocyte ratio (P=0.002) and high CRP (P=0.036) exhibited a statistically significant difference between the two groups. 87.69% (57/65) patients in the COVID-19 group presented normal/low white blood cell count, 67.69% (44/65) patients exhibited low lymphocyte ratio, and 53.85% (35/65) patients displayed high CRP. In the non-COVID-19 group, 35.63% (31/87) patients had normal/low white blood cell counts, 42.53% (37/87) patients had low lymphocyte ratio and 36.78% (32/87) patients had high CRP. In the COVID-19 group, 33.85% (22/65) patients had high neutrophilic ratios, 41.54% (27/65) patients had high monocyte ratios, 58.46% (38/65) patients had low eosinophilic ratios and 50.77% (33/65) patients had high procalcitonin levels. In the non-COVID-19 group, 42.53% (37/87) patients had high neutrophilic ratios, 47.13% (41/87) patients had high monocyte ratios, 50.57% (44/87) patients had low eosinophilic ratios and 54.02% (47/87) patients had high procalcitonin levels. There was no statistically significant difference between the two groups of patients in the high neutrophil ratios (P=0.277), high monocyte ratios (P=0.493), low eosinophil ratio (P=0.334) and high procalcitonin (P=0.691) (Table II).
The comparisons of the CT findings between patients with COVID-19 and non-COVID-19 are presented in Table III. In the COVID-19 group, 95.38% (62/65) patients showed GGO (Fig. 1) or GGO and consolidation, and 4.62% (3/65) patients showed consolidation. In the non-COVID-19 group, GGO or consolidation was found in 19.54% (17/87) patients and 80.46% (70/87) patients. GGO was the most common imaging feature in the COVID-19 group compared with non-COVID-19 group (P<0.001). In the COVID-19 group, 50.77% (33/65) patients had angiographic thickening in GGO (Fig. 2), 41.54% (27/65) patients had paving stone sign (Fig. 3), 35.38% (23/65) patients had air bronchi sign, 21.54% (14/65) patients had fibrotic session formation, 16.92% (11/65) patients had halo sign and 3.08% (2/65) patients had plural fusion. In the non-COVID-19 group, 12.64% (11/87) patients had angiographic thickening in GGO, 10.34% (9/87) patients had paving stone sign, 48.28% (42/87) patients had air bronchi sign, 32.18% (28/87) patients had fibrotic session formation, 26.44% (23/87) patients had halo sign and 8.05% (7/87) patients had plural fusion. The frequency of angiographic thickening in GGO (<0.001) and paving stone sign (<0.001) in the COVID-19 group was significantly higher than that in the non-COVID-19 group. There was no significant difference in the frequency of air bronchi sign (P=0.112), fibrotic reduction formation (P=0.146), halo sign (P=0.164) and plural fusion (P=0.349) between the two groups. In the COVID-19 group, 83.08% (54/65) patients presented with bilateral lung distribution, 80.00% (52/65) patients had multifocal distribution and 84.62% (55/65) patients had subpleural distribution. In the non-COVID-19 group, 56.32% (49/87) patients had bilateral lung distribution, 64.37% (56/87) patients had multifocal distribution, and 62.07% (54/87) patients had subpleural distribution (Fig. 4). Compared with the non-COVID-19 group, the lesions in the COVID-19 group were primarily characterized by bilateral lungs (P<0.001), multifocal (P=0.036) and subpleural distribution (P=0.002).
The ROCs of certain characteristics for the diagnosis of COVID-19 were plotted and the AUC was determined. GGO or GGO and consolidation presented an AUC of 0.879 and P<0.001 (Fig. 5A). Angiographic thickening in GGO for the diagnosis of COVID-19 exhibited an AUC of 0.691 and P<0.001 (Fig. 5B). Paving stone sign for COVID-19 diagnosis was plotted, with an AUC of 0.656 and P=0.001 (Fig. 5C). Bilateral lungs presented an AUC of 0.634 and P=0.005 (Fig. 5D). Finally, the ROC of subpleural distribution was plotted, with an AUC of 0.613 and P=0.018 (Fig. 5E).
Currently, COVID-19 is expanding in China, which poses a threat to human health. The genetic similarity between SARS-CoV-2 and SARS-CoV reaches ~83% (5). The quick and accurate diagnosis of COVID-19 represents a key method of saving lives and controlling the epidemic. It has been indicated that the diagnosis of COVID-19 via nucleic acid detection exhibited strong specificity but poor sensitivity (6). It has been hypothesized that clinical symptoms, laboratory tests and CT images may serve an important role in preclinical screening.
Epidemiological investigations have indicated that the incubation period of COVID-19 was 1-14 days (7). A total of 98.46% of the patients in the current study presented with a history of exposure to the virus, which was the principal element to the diagnosis of COVID-19. Droplet transmission is the main means of disease transmission (8), however, SARS-CoV-2 may also spread in the form of aerosols, resulting in a strong propagation speed (9), which may cause an outbreak of COVID-19. In the present study, no difference in the underlying disease between the two groups existed, which indicated that immunity was not associated with COVID-19. In the COVID-19 group, 70.77% of patients were male. Yan and Xia (10) revealed that 38/51 (74.51%) patients with COVID-19 were male, SARS-CoV-2 has been indicated to infect more males than females. SARS-CoV-2 has been indicated to infect type II alveolar epithelial cells, which may express angiotensin-converting enzyme 2 (ACE2) (6,7). A recent study revealed that male type II alveolar epithelial cells exhibited a 2.5x higher percentage of endocrine ACE2 expression compared with the same cells in females (11). It was hypothesized that this may account for the increased cases of virus infection in males compared with females. SARS-CoV-2 exhibits a viral envelope on its surface, with a round or oval shape and a diameter of 60-140 nm (4). As the virus infects type II alveolar epithelial cells and induces respiratory problems, the most frequently observed clinical symptoms were fever and cough, which was consistent with the patients' CT manifestations.
In the current study, the total number of peripheral blood leukocytes in patients with COVID-19 was indicated to be at a normal/low level, the lymphocyte ratio was decreased, and CRP was increased in certain patients, which was consistent with the results of previous studies (12). This has also been observed in cases of SARS-CoV infection (6). A recent study reported that SARS-CoV-2 primarily infects lymphocytes (5). A decreased number of lymphocytes may result in decreased immunity in patients with COVID-19. Certain patients exhibit multiple organ failure (13). In the current study, steroids were used to prevent possible infection during treatment. SARS-CoV-2 nucleic acid can be detected in nasopharyngeal swabs, sputum, low respiratory secretions and blood, among other samples; however, certain patients require repeated tests before diagnosis, which may delay the diagnosis of COVID-19(14).
COVID-19 has a variety of manifestations in CT scans. Cheng et al (15) revealed that 81.81% (9/11) patients with COVID-19 exhibited a double lung infection. Chung et al (16) reported that 80.95% (17/21) patients exhibited a GGO that was distributed in the subpleural region. At present, a small number of studies has performed comparative analysis on imaging features, especially ROC curve plots, to the best of our knowledge (17). Comparative studies may more accurately summarize the image characteristics of COVID-19. Patrick et al (18) reported that 81.31% of patients with SARS-CoV pneumonia exhibited multiple inflammatory foci in the subpleural region of the lungs. Following the evaluation of recent and previous studies, it can be suggested that the distribution of COVID-19-induced inflammation is consistent with that in other viral pneumonias (14). The imaging findings of different viral pneumonias are similar (19). In patients with herpesvirus pneumonia, 31% of CT images revealed a paving stone sign (17). In the current study, angiographic thickening and paving stone sign were the principal CT features of COVID-19. However, the pathological basis of COVID-19 has not been reported, to the best of our knowledge. A recent study demonstrated that viral pneumonia, which was induced by SARS-CoV-2 infection of type II alveolar epithelial cells, induced hemorrhagic alveolar inflammation and necrosis, which resulted in diffuse alveolar injury (6). Alveolar injury may result in alveolar edema, bleeding and collapse of the alveolar cavity, which were indicated in the CT images as GGO. The pathological basis of angiographic thickening in GGO is unclear. In a previous study, it was also suggested that paving stone markers are common features of viral pneumonia (20). It has been hypothesized that SARS-CoV-2 infection may cause inflammation of the intralobular interstitial lymph network, resulting in thickening of the intralobular interstitial space as a fine grid-like shadow, which resembles a ‘paving stone sign’ (21). In the present study, the occurrence probability of air bronchi signs was similar in both groups, which was consistent with the findings of previous studies (22). At present, air bronchi signs cannot be used to identify bacterial pneumonia or viral pneumonia (17). A recent study reported that halo sign appeared in viral infection (23). In the present study, halo sign was also observed in patients with COVID-19; however, this was not observed in all patients. Moreover, in the current study, the CT images of some lesions with COVID-19 showed a clear strip shadow on the edge of the lesion, forming a fibrotic lesion. Whether the fibrotic lesion remains following patient recovery, requires additional investigation. Based on the ROC curve analysis of GGO or GGO and consolidation, angiographic thickening in GGO, paving stone sign, bilateral and subpleural distribution of the patients that were diagnosed with COVID-19, it was suggested that these CT features may be useful for the diagnosis of COVID-19. Among them, GGO or GGO and consolidation exhibited the highest clinical diagnostic value.
In conclusion, CT was indicated to represent not only a diagnostic tool for COVID-19, but also an evaluation tool for the treatment process. Although not all patients with COVID-19 exhibited typical CT features, the majority of CT scans presented similar features. CT is a quicker method than viral nucleic acid detection, which may generate false negative results and often requires repetition. The results of the present study indicated that the patients with COVID-19 exhibited specific clinical symptoms, laboratory examination results and CT characteristics. The male patients with contact history in the epidemic area were indicated to exhibit fever and cough symptoms. The results of the current study suggested that when the laboratory tests of the aforementioned patients present normal/low white blood cell counts, low lymphocyte ratios and increased CRP, a CT scan should be recommended. Moreover, when the CT scan indicates a multifocal GGO with subpleural and bilateral distribution in the lungs, which is accompanied by angiographic thickening in GGO and paving stone sign, whether the virus nucleic acid test is positive or negative, COVID-19 should be considered and medical isolation and observation should be performed.
Not applicable.
The current study was funded by Clinical Research Fund of Qiqihar Medical Academy (grant no. QMSI2019L-16).
The datasets used and analyzed during the present study are available from the corresponding author on reasonable request.
DW participated in the project design and research, performed the statistical analysis, and was responsible for drafting and revision of the manuscript. YW and GD participated in the project design and coordination, assisted in writing the manuscript and helped with the statistical analysis. JH was responsible for sample collection. QW and FD performed the virological analysis and helped with the drafting of the manuscript. BJ, QZ, TZ and BL performed the CT analysis and sample collection and participated in performing the statistical analysis. All authors read and approved the final manuscript.
The study protocol was approved by the Regional Ethics Committee for Clinical Research of the Second Affiliated Hospital of Qiqihar Medical College (approval no. QMC-2020013). All patients provided written informed consent.
Written informed consent was obtained from all patients or their legal guardians for the use of their CT images and personal data in the current study.
The authors declare that they have no competing interests.
|
Carlos WG, Dela Cruz CS, Cao B, Pasnick S and Jamil S: Novel Wuhan (2019-nCoV) coronavirus. Am J Respir Crit Care Med. 201:P7–P8. 2020.PubMed/NCBI View Article : Google Scholar | |
|
World Health Organization: Middle East Respiratory Syndrome Coronavirus (MERS-CoV). November, 2019. urihttp://www.who.int/emergencies/mers-cov/en/simplehttp://www.who.int/emergencies/mers-cov/en/. Accessed January 19, 2020. | |
|
World Health Organization: Novel Coronavirus-China. urihttp://www.who.int/csr/don/12-january-2020-novel-coronavirus-china/en/simplehttp://www.who.int/csr/don/12-january-2020-novel-coronavirus-china/en/. Accessed January 19, 2020. | |
|
Chai X, Hu L, Zhang Y, Han W, Lu Z, Ke A, Zhou J, Shi G, Fang N, Fan J, et al: Specific ACE2 expression in cholangiocytes May cause liver damage after 2019-nCoV infection. BioRxiv: Feb 4, 2020. doi: org/10.1101/2020.02.03.931766. | |
|
Yu F, Du L, Ojcius DM, Pan C and Jiang S: Measures for diagnosing and treating infections by a novel coronavirus responsible for a pneumonia outbreak originating in Wuhan, China. Microbes Infect. 22:74–79. 2020.PubMed/NCBI View Article : Google Scholar | |
|
Huang C, Wang Y, Li X, Ren L, Zhao J, Hu Y, Zhang L, Fan G, Xu J, Gu X, et al: Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet. 395:497–506. 2020.PubMed/NCBI View Article : Google Scholar | |
|
People's Daily Online. Wuhan is expected to send 15 million passengers during Spring Festival in 2020 (In Chinese). December 28, 2019. urihttp://hb.people.com.cn/n2/2019/1228/c194063-33671662.htmlsimplehttp://hb.people.com.cn/n2/2019/1228/c194063-33671662.html. Accessed January 2, 2020. | |
|
The 2019-nCoV Outbreak Joint Field Epidemiology Investigation Team. Li Q: An outbreak of NCIP (2019-nCoV) infection in China-Wuhan, Hubei Province, 2019-2020. China CDC Weekly. 2:79–80. 2020. | |
|
Li Q, Guan X, Wu P, Wang X, Zhou L, Tong Y, Ren R, Leung KS, Lau EH, Wong JY, et al: Early transmission dynamics in Wuhan, China, of novel coronavirus-infected pneumonia. N Engl J Med. 382:1199–1207. 2020.PubMed/NCBI View Article : Google Scholar | |
|
Yan L and Xia L: Coronavirus disease 2019 (COVID-19): Role of chest CT in diagnosis and management. AJR Am J Roentgenol. 214:1280–1286. 2020.PubMed/NCBI View Article : Google Scholar | |
|
Lei J, Li J, Li X and Qi X: CT imaging of the 2019 novel coronavirus (2019-nCoV) pneumonia. Radiology. 295(18)2020.PubMed/NCBI View Article : Google Scholar | |
|
Read JM, Bridgen JR, Cummings DA, Ho A and Jewell CP: Novel coronavirus 2019-nCoV: Early estimation of epidemiological parameters and epidemic predictions. medRxiv: Jan 28, 2020 (Epub ahead of print). doi: 10.1101/2020.01.23.20018549. | |
|
Liu T, Hu J, Kang M, Lin L, Zhong H, Xiao J, He G, Song T, Huang Q, Rong Z, et al: Transmission dynamics of 2019 novel coronavirus (2019-nCoV). bioRxiv: Jan 26, 2020 doi: urihttps://doi.org/10.1101/2020.01.25.919787simplehttps://doi.org/10.1101/2020.01.25.919787. | |
|
Kanne JP: Chest CT findings in 2019 novel coronavirus (2019-nCoV) infections from Wuhan, China: Key Points for the Radiologist. Radiology. 295:16–17. 2020.PubMed/NCBI View Article : Google Scholar | |
|
Cheng Z, Lu Y, Cao Q, Qin L, Pan Z, Yan F and Yang W: Clinical features and Chest CT manifestations of coronavirus disease 2019 (COVID-19) in a single-center study in Shanghai, China. AJR Am J Roentgenol. 215:121–126. 2020.PubMed/NCBI View Article : Google Scholar | |
|
Chung M, Bernheim A, Mei X, Zhang N, Huang M, Zeng X, Cui J, Xu W, Yang Y, Fayad ZA, et al: CT imaging features of 2019 novel coronavirus (2019-nCoV). Radiology. 295:202–207. 2020.PubMed/NCBI View Article : Google Scholar | |
|
Shi H, Han X, Jiang N, Cao Y, Alwalid O, Gu J, Fan Y and Zheng C: Radiological findings from 81 patients with COVID-19 pneumonia in Wuhan, China: A descriptive study. Lancet Infect Dis. 20:425–434. 2020.PubMed/NCBI View Article : Google Scholar | |
|
Patrick DM, Petric M, Skowronski DM, Guasparini R, Booth TF, Krajden M, McGeer P, Bastien N, Gustafson L, Dubord J, et al: An outbreak of human coronavirus OC43 infection and serological cross-reactivity with SARS coronavirus. Can J Infect Dis Med Microbiol. 17:330–336. 2006.PubMed/NCBI View Article : Google Scholar | |
|
Zhao S, Ran J, Musa SS, Yang G, Wang W, Lou Y, Gao D, Yang L, He D and Wang MH: Preliminary estimation of the basic reproduction number of novel coronavirus (2019-nCoV) in China, from 2019 to 2020: A data-driven analysis in the early phase of the outbreak. Int J Infect Dis. 92:214–217. 2020.PubMed/NCBI View Article : Google Scholar | |
|
Wang D, Hu B, Hu C, Zhu F, Liu X, Zhang J, Wang B, Xiang H, Cheng Z, Xiong Y, et al: Clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus-infected pneumonia in Wuhan, China. JAMA. 323:1061–1069. 2020.PubMed/NCBI View Article : Google Scholar | |
|
Pan Y, Guan H, Zhou S, Wang Y, Li Q, Zhu T, Hu Q and Xia L: Initial CT findings and temporal changes in patients with the novel coronavirus pneumonia (2019-nCoV): A study of 63 patients in Wuhan, China. Eur Radiol. 30:3306–3309. 2020.PubMed/NCBI View Article : Google Scholar | |
|
Xu H, Zhong L, Deng J, Peng J, Dan H, Zeng X, Li T and Chen Q: High expression of ACE2 receptor of 2019-nCoV on the epithelial cells of oral mucosa. Int J Oral Sci. 12(8)2020.PubMed/NCBI View Article : Google Scholar | |
|
Wang D, Wu C, Gao J, Zhao S, Ma X, Wei B, Feng L, Wang Y and Xue X: Comparative study of primary pulmonary cryptococcosis with multiple nodules or masses by CT and pathology. Exp Ther Med. 16:4437–4444. 2018.PubMed/NCBI View Article : Google Scholar |