Open Access

Interferon‑τ regulates the expression and function of bovine leukocyte antigen by downregulating bta‑miR‑204

  • Authors:
    • Xiaoyan Wang
    • Ting Yuan
    • Nannan Yin
    • Xiaofei Ma
    • Yaping Yang
    • Jing Yang
    • Aftab Shaukat
    • Ganzhen Deng
  • View Affiliations

  • Published online on: April 8, 2021     https://doi.org/10.3892/etm.2021.10026
  • Article Number: 594
  • Copyright: © Wang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

IFN‑τ is a pregnancy recognition factor that regulates embryo implantation in ruminants. IFN‑τ has been suggested to be involved in the expression of microRNA (miRNA/miR) and bovine leukocyte antigen (BoLA), which is an analog of the human major histocompatibility complex class I. However, little is known about whether the miRNAs are involved in the expression of BoLA in ruminants. The present study firstly verified that bta‑miR‑204 was downregulated and that BoLA was upregulated in the uterine tissues of dairy cows during early pregnancy. Subsequently, luciferase reporter assays, reverse transcription‑quantitative PCR and western blot analysis were used to validate BoLA as the target gene of bta‑miR‑204. Moreover, BoLA was markedly upregulated and bta‑miR‑204 was downregulated in bovine endometrial epithelial cells (bEECs) treated with IFN‑τ. In addition, the results indicated that when the expression level of BoLA was increased by IFN‑τ, the expression level of programmed death‑ligand 1 (PD‑L1) and programmed death‑ligand 2 (PD‑L2) was also increased. Furthermore, when BoLA was silenced in bEECs by small interfering RNA, the expression of PD‑L1 and PD‑L2 was not affected by IFN‑τ. The expression level of PD‑L1 and PD‑L2 was also increased in the uterine tissues of pregnant dairy cattle. In conclusion, IFN‑τ may function by suppressing the expression of bta‑miR‑204 to increase the expression of BoLA during the embryo implantation period in cattle. IFN‑τ may induce PD‑L1 and PD‑L2 transcription by regulating BoLA, which may influence the T cell immune response, thereby regulating pregnant cattle immunization.

Introduction

Successful embryo implantation is a key step in pregnancy and is a complicated physiological process that consists of various steps, including blastocyst hatching, invasion, migration, attachment and placentation (1,2). During this period, the uterus undergoes several alterations to establish an optimal environment for embryonic growth. A complex regulatory network of molecular interactions exists at the fetomaternal interface (3). IFN-τ is produced during the early embryo implantation, especially in ruminants, such as cattle, sheep and deer, and serves a key role in the maternal recognition of pregnancy (4-6). Previous studies have indicated that IFN-τ upregulated the expression of bovine leukocyte antigen (BoLA)-I, which is the equivalent of the major histocompatibility complex class I (MHC-I) antigen in bovines, and may modulate immune responses and contribute to fetomaternal tolerance in dairy cattle (7-10). Our previous has revealed that IFN-τ stimulation activated a wide variety of microRNAs (miRNAs/miRs) in BEECs (11). Whether the upregulation of BoLA-I expression is associated with miRNAs is still unknown. Moreover, the underlying mechanisms of the contributions of IFN-τ to embryo implantation also remain unclear.

miRNAs are a class of small, noncoding, single-stranded RNAs comprising 22-25 nucleotides. miRNAs have been suggested to negatively regulate gene expression by targeting mRNAs to interfere with post-transcriptional protein translation (12). Because of their ability to silence genes, miRNAs can modulate a variety of physiological and pathological processes, including cellular proliferation, apoptosis and immune responses (13-15). A previous study has indicated that miRNAs regulated the molecules involved in peri-implantation and pregnancy, such as let-7a and miR-320(16). The functional study of miRNAs may be helpful in revealing the molecular pathways associated with the embryo implantation process.

Preliminary deep sequencing data indicated that bta-miRNA-204 was downregulated in bovine endometrial epithelial cells (bEECs) following IFN-τ treatment (11). Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses indicated the target genes of bta-miRNA-204, whose function analysis found that those predicted genes were enriched in graft-vs.-host disease and allograft rejection, including BoLA-I (17,18) In this research, we will reveal the inner association between bta-miRNA-204 and BoLA-IIn the present study, bioinformatics algorithms were used to predict which genes may be regulated by bta-miRNA-204. Of note, BoLA was indicated to be a target gene of bta-miRNA-204. BoLA gene, which is also known as BoLA-A, belongs to the classic BoLA-I family, and encodes the heavy chain of BoLA class I molecules (19). As BoLA-I serves a crucial role in the regulation of immunosuppression and implantation during early embryonic development (20), the present study investigated whether IFN-τ-mediated regulation of bta-miRNA-204 contributes to effective embryo implantation.

Programmed cell death receptor 1 (PD-1) binds to the programmed death-ligand 1 or 2 (PD-L1/PD-L2) to form a costimulatory signal that negatively regulates T cell immunity. PD-L1 and PD-L2 are expressed by antigen presenting cells (APCs) (21). On the other hand, APCs also express MHC molecules that can activate T cells by interacting with the T cell receptor (TCR) (22,23). Tumor cells frequently upregulate the expression of PD-L1 or PD-L2 to facilitate their escape from the immune system. Although there have been numerous studies about the PD-1/PD-L signaling pathway in tumor immune escape, this pathway has not been well described in pregnant immune tolerance (24). As the expression of PD-L1 and PD-L2 is regulated by several factors and IFN-τ can stimulate bEECs to produce MHC, whether it can also stimulate bEECs to express PD-L1 and PD-L2 is still unknown (10,25,26). Moreover, there may be a connection between MHC and PD1 ligands based on the costimulatory signaling pathway of T cells (27), but few reports exist on this domain, therefore their relationship should be further examined. The main purpose of the present study was to preliminary explore whether IFN-τ could stimulate bEECs to produce both MHC and PD-L1 and PD-L2.

Materials and methods

Reagents

Recombinant ovine IFN-τ was purchased from Creative Bioarray. FBS was purchased from SAFC Biosciences Pty Ltd. Bovine leukocyte antigen (HLA) class I (Thermo Fisher Scientific, Inc.; cat. no. MA5-28477), Actin Monoclonal Antibody (Thermo Fisher Scientific, Inc.; cat. no. MA1-744) HRP-conjugated goat anti-rabbit antibody and the primary antibody anti-cytokeratin-18 (CK-18; cat. no. MA5-12104) were provided by Abcam. Cell Counting Kit-8 (CCK-8) was purchased from Dojindo Molecular Technologies, Inc. LightCycler® FastStart DNA Master PLUS SYBR Green kit was purchased from Roche Applied Science. The microRNA and U6 small nuclear RNA normalization reverse transcription-quantitative PCR (RT-qPCR) kit was purchased from Shanghai GenePharma Co., Ltd. The bta-miR-204 mimic (bta-miR-204 agomir) and an inhibitor (bta-miR-204 antagomir), as well as were three BoLA small interfering (si)RNAs and a negative control (NC) siRNA were synthesized by Shanghai GenePharma Co., Ltd. The FastDigest XhoI and NotI, Lipofectamine® 2000 and Lipofectamine RNAiMAX kits were obtained from Thermo Fisher Scientific, Inc. Dual-Luciferase Reporter Assay System and psi-CHECK™-2 plasmid were obtained from Promega Corporation. The sequences of all primers were synthesized by Shanghai GenePharma Co., Ltd. and are listed in Table I. The sequences of the agomirs and antagomirs are presented in Table II. All other chemicals were reagent grade.

Table I

Primer sequences.

Table I

Primer sequences.

A, Primers for 3'-UTR cloning
NameSequence (5'-3')
BoLA 3'-UTR-F ATCTCGAGATGACATCGAGTGGCCAGAG
BoLA 3'-UTR-R GAGCGGCCGCAGGCGATTGGATTTGTCGGC
Mut-BoLA 3'-UTR-F ATACTCGAGCGAAAGCATGCGTCGTACCT
Mut-BoLA 3'-UTR-R ATGCGGCCGGCCGAAAGTTCCTTTGTGGG
B, Primers for reverse transcription-quantitative PCR
NameSequence (5'-3')
β-actin-F TGGACTTCGAGCAGGAGAT
β-actin-R CGTCACACTTCATGATGGAA
IFN-τ-F TGAACAGACTCTCTCCTCATCCC
IFN-τ-R TGGTTGATGAAGAGAGGGCTCT
BoLA-F CTCACACCGTCCAAGAGATG
BoLA-R CTCGTTCAGGGCGATGTAAT
RT-bta-miR-204 CTCAACTGGTGTCGTGGAGTCGG CAATTCAGTTGAGAGGCATAG
bta-miR-204-F CGTGGACTTCCCTTTGTCA
bta-miR-204-R CTCAACTGGTGTCGTGGA
PD-L1-F TTGGTCATCCCAGAACCATATC
PD-L1-R CCTTCCAGGGTACCTTTATTCC
PD-L2-F CTACAAGTACCTGACGCTGAAA
PD-L2-R CAACGATGAGGGAGAGAATGAA
U6-F CTCGCTTCGGCAGCACATATACT
U6-R ACGCTTCACGAATTTGCGTGTC

[i] F, forward; R, reverse; miR, microRNA; Mut, mutant; UTR, untranslated region; BoLA, bovine leukocyte antigen; PD-L, programmed death-ligand.

Table II

Sequences of agomirs and antagomirs.

Table II

Sequences of agomirs and antagomirs.

NameSequence (5'-3')
bta-miR-204 agomir UUCCCUUUGUCAUCCUAUGCCU GCAUAGGAUGACAAAGGGAAUU
bta-miR-204 agomir NC UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT
bta-miR-204 antagomir AGGCAUAGGAUGACAAAGGGAA
bta-miR-204 antagomir NC CAGUACUUUUGUGUAGUACAA

[i] NC, negative control; miR, microRNA.

Animals and experimental groups

All experimental procedures involving animals and their care conformed to the Guide for the Care and Use of Laboratory Animals of National Veterinary Research of China. The present study was approved by the Huazhong Agricultural University Animal Care and Use Committee (Wuhan, China; approval no. 20171354CA).

The pregnant cow (n=3) and nonpregnant female dairy cattle (n=5) were obtained from the Animal Experimental Center of Huazhong Agricultural University. All cattle were between 16 and 24 months old, and weighed between 350 and 390 kg. They were acclimatized for one week (24±1˚C, relative humidity of 60-65%, 12 h light/dark cycle with ad libitum supply of food and water. The body temperature and food intake of each cow was recorded every day. The dairy cattle were anesthetized with an intravenous injection of 40 mg/kg sodium pentobarbital to minimize suffering (28). The endometrial epithelium (for cell culture) and endometrial tissues of nonpregnant cows (n=5) were collected before ovulation. Pregnancy was induced by artificial insemination, and the day of insemination was designated day 0 of pregnancy (10,29). The endometrial tissues of cattle in early pregnancy were collected during implantation (day 9-25; n=3). An intravenous injection of ≥100 mg/kg sodium pentobarbital was used for euthanasia. All samples were obtained within 30 min after exsanguination and immediately transported to the laboratory on ice.

Primary bovine endometrial epithelial cell (bEEC) culture and identification

The collected caruncular endometrial epithelium was mixed with adequate 1% collagenase I (10-15 ml), cut into 1x1 mm pieces and incubated for 1 h in a sealed container in a thermostatic shaker at 37˚C and 88 revolutions/minute. Collagenase I was neutralized with FBS (1-1.5 ml) after the incubation period, and the tissue pieces were placed in a culture dish (35 mm) in 0.5-1 cm intervals. The culture dish was incubated in 5% CO2 at 37˚C for 3 h. After the cells adhered to the dish, the bEECs were cultured in DMEM/F12 (Thermo Fisher Scientific, Inc.; cat. no. 21041033) supplemented with 15% FBS, 2 mM L-glutamine, 50 U/ml penicillin, 50 U/ml streptomycin, 100 U/ml gentamicin and 10 ng/ml EGF, and maintained in a 5% CO2 humidified incubator at 37˚C. The nutrient solution was replaced after 8 h, and thereafter it was replaced every 12 h. Following 48 h, the tissue block was removed, and the medium was replaced every 48 h. The cells were transferred (via trypsinization at room temperature for 20 sec) to 6-well plates on coverslips and analyzed for the expression of the epithelial-specific marker CK-18. Cells were grown to approximately 70% confluence, fixed with 4% paraformaldehyde for 15 min at room temperature and washed three times with PBS. The cells were blocked with 10% normal goat serum at room temperature for 30 min and incubated with CK-18 primary antibody (diluted 1:100) overnight at 4˚C. The fluorescently labeled DyLight 594 (diluted 1:1,000) secondary antibody was incubated for 45 min at room temperature. DAPI (300 nM) was used to stain the cell nuclei for 1-5 min at room temperature. Fluorescent images were captured using laser scanning confocal microscopy (magnification, x50 and x100) and analyzed using ImageJ (https://imagej.nih.gov/ij/, National Institutes of Health; ImageJ bundled with 64-bit Java 1.8.0_172). The sixth or seventh generation of bEECs was used for subsequent experiments.

bta-miR-204 target analysis

The bioinformatics database TargetScan 7.2 (http://www.targetscan.org/) and RNAhybrid (https://bibiserv.cebitec.uni-bielefeld.de/rnahybrid/) were used to search for the target genes of bta-miR-204. The duplexes and the minimum free energy (mFE) between bta-miR-204 and the 3'-untraslated regions (3'-UTRs) of the potential targets were analyzed by RNA hybridization (30).

Plasmid construction

To construct the wild-type and mutant BoLA 3'-UTR luciferase reporter plasmids, the full length of the BoLA 3'-UTR or fragments covering the putative bta-miR-204 binding site were amplified by RT-qPCR using cDNA resulting from extractions from dairy cattle uterine tissues. The amplified products were subcloned into the XhoI and NotI sites of the psi-CHECK-2 vector. Mutagenesis of the seed region (the bta-miR-204 target site) was achieved by PCR (Shanghai GenePharma Co., Ltd.), using the 3'-UTR plasmid as the template. The following thermocycling conditions were used: 94˚C for 2 min; followed by 35 cycles of 94˚C for 20 sec; 56˚C for 20 sec and 72˚C for 150 sec; followed by 72˚C for 5 min and 15˚C for 1 min. The amplified products were digested using the DpnI restriction enzyme. E. coli DH5α cells were transformed with the plasmids, and colonies were grown on Luria-Bertani plates containing ampicillin at 37˚C for 16-18 h. The wild-type and mutant sequences were confirmed by enzyme digestion and sequencing. The recombinant wild-type and mutant plasmids were named Luc-BoLA (3'UTR) and Luc-BoLA (3'UTR)-Mut, respectively.

Dual-luciferase reporter assay

The dual-luciferase reporter assay included two reporters. One was Renilla luciferase, and the other was firefly luciferase in pmirGLO vector (Promega Corporation), which contained the examined 3'-UTR sequence. For the luciferase reporter assay, bEECs were plated in a 6-well plate to a density of 20-30%, 1 day before transfection. On the second day, 200 ng luciferase reporter plasmid and 10 pmol bta-miR-204 agomir, agomir NC, antagomir and antagomir NC were also transfected into bEECs using Lipofectamine 2000. Luc-BoLA (3'UTR) was transfected into bEECs without the indicated agomirs/antagomirs as the control. The cells were collected at 24 h post transfection, and dual-luciferase activity assays were performed using Dual-Luciferase Reporter Assay System according to the manufacturer's instructions. The luciferase activity was detected using a Lumat LB 9507 Ultra-Sensitive Tube Luminometer (Titertek-Berthold). The firefly luciferase activity of each sample was normalized to the Renilla luciferase activity. At least three independent repeats were performed for all the aforementioned transfection experiments.

siRNA design and cell transfection

The selection of siRNAs was based on the characterization of siRNAs in a previous study (31). According to the sequence characteristics of siRNA, the general design principle and previous design experience, several siRNAs were designed using siRNA online design tools. Three siRNA sequences were established to target cattle BoLA mRNA (BoLA siRNA1-3; Table III). To identify the most effective siRNA, 100 pmol (the amount recommended in the transfection protocol) of each of these siRNAs were used for transfection into primary bEECs using Lipofectamine RNAiMAX. RT-qPCR was used to evaluate the efficacy of the siRNAs in downregulating BoLA expression in the cells. The BoLA siRNA that exhibited the best inhibitory effect on BoLA mRNA expression was used in subsequent experiments. Primary bEECs were seeded into a 6-well plate with 30-40% cell density. The bEECs were treated with IFN-τ (200 ng/ml dissolved in DMSO). The blank group was treated with the same amount of DMSO. In addition, the other experimental groups were transfected with 100 pmol BoLA siRNA or NC siRNA at 37˚C for 6 h and subsequently treated with 200 ng/ml IFN-τ at 37˚C for another 12 h immediately after removal of transfection media.

Table III

Sequences of siRNA oligonucleotides.

Table III

Sequences of siRNA oligonucleotides.

NameSequence (5'-3')
BoLA siRNA1 GCUCAAGUCACCAAGCACATT UGUGCUUGGUGACUUGAGCTT
BoLA siRNA2 GCAUCAUUGUUGGACUGGUTT ACCAGUCCAACAAUGAUGCTT
BoLA siRNA3 GUGUCUCUCAUGGUUCCUATT UAGGAACCAUGAGAGACACTT
NC siRNA UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT

[i] NC, negative control; si, small interfering; BoLA, bovine leukocyte antigen.

Cell treatment and cell proliferation assays

Primary bEECs were seeded into a 6-well plate with 30-40% cell density. The bEECs were treated with 200 ng/ml IFN-τ (11). The blank group was treated with the same amount of DMSO. Furthermore, the other experimental groups were transfected with 100 pmol (in accordance with the transfection protocol) bta-miR-204 agomir, agomir NC, antagomir or antagomir NC using Lipofectamine 2000 at 37˚C for 6 h, as aforementioned. The siRNA groups were transfected with 100 pmol BoLA siRNA or NC siRNA. CCK-8 was used to examine cell proliferation according to the manufacturer's protocol at 6, 12, 24 and 48 h post-treatment. The cells were treated with 1 ml DMEM/F-12 with CCK-8 reagent (1:10 v/v) and incubated for 1 h. The absorbance of each well was measured at 450 nm using a microplate reader (Bio-Rad Laboratories, Inc.) to estimate the cell number.

RT-qPCR

Total RNA from primary bEECs was isolated using TRIzol® Reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.) and converted into cDNA (30˚C for 10 min followed by 42˚C for 30 min) with the PrimeScript 1st strand cDNA Synthesis Kit according to the manufacturer's instructions (Takara Bio, Inc.). Primer Premier 5 software (Premier Biosoft International) was used to design the specific primers (Table I). qPCR was performed on a StepOne Real-time PCR System (Thermo Fisher Scientific, Inc.) with the LightCycler® FastStart DNA Master PLUS SYBR Green mix in a 25-µl reaction. U6 was used as the housekeeping gene. The PCR producer for the bta-miR-204 reverse transcription reaction was 95˚C for 5 min; 40 cycles of 95˚C for 10 sec and 60˚C for 30 sec; 95˚C for 15 sec, 60˚C for 60 sec, 95˚C for 15 sec. The producer for the PCR reaction was 95˚C 3 min; followed by 95˚C for 12 sec and 62˚C for 40 sec. Each sample was assayed in triplicate. The results (fold changes) were quantified using the 2-ΔΔCq method (32).

Western blot analysis

Total protein from primary bECCs and tissues was extracted by RIPA Lysis and Extraction Buffer (cat. no. 8990, Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. The protein concentration was determined using a BCA Protein Assay kit. Samples with equal amounts of protein (50 µg) were separated using 10% SDS-PAGE and transferred to a PVDF membrane, which was blocked in 5% skimmed milk in 0.4% TBS-Tween-20 (TBST) at room temperature for 2 h. The membrane was incubated with the primary antibody (1:500 dilution) at 4˚C overnight. Following washing with TBST, the membrane was incubated with the secondary antibody (1:1,500 dilution) at room temperature for 2 h. Protein expression was detected using the ECL Plus Western Blotting Detection system (Hangzhou Bioer Co., Ltd) and analyzed using ImageQuant LAS 4000 mini software (Cytiva) according to the ImageQuant LAS 4000 User Manual 28-9607-42 AC. β-actin was used as a loading control.

Statistical analysis

Data are presented as the mean ± SEM (n=3). Statistical analyses were performed using Microsoft Excel 2016 (Microsoft Corporation) and GraphPad Prism 6 (GraphPad Software, Inc.). Comparisons among all groups were performed with one-way ANOVA followed by Tukey's multiple comparisons test. P<0.05 was considered to indicate a statistically significant difference.

Results

Expression of bta-miR-204, IFN-τ and BoLA in the endometrial tissues of dairy cattle

A previous study using deep sequencing indicated that IFN-τ (200 ng/ml) decreased the expression of bta-miRNA-204 in bEECs (10). To evaluate whether pregnancy affects the expression of IFN-τ, bta-miR-204 and BoLA, their levels in pregnant cattle were compared with the respective levels in nonpregnant cattle. The results revealed that the mRNA expression level of bta-miR-204 was significantly decreased in cattle during early pregnancy, but the expression level of BoLA in early pregnant cattle was increased compared with that in nonpregnant cattle (Fig. 1A and B). Moreover, the mRNA level of IFN-τ was significantly higher in the endometrium of early pregnant cattle compared with that in nonpregnant cattle (Fig. 1C). Moreover, the protein expression level of BoLA was indicated to be increased in cattle during early pregnancy using western blot analysis (Fig. 1D and E).

Identification of primary bEECs

Immunofluorescent studies were performed according to the aforementioned procedure. Primary bEECs were positive for the epithelial-specific marker CK-18. The proportion of CK-18+ cells was >95%, as determined using confocal microscopy (Fig. 2).

Prediction of the target gene of bta-miR-204

As miRNAs are well documented to exert their function by affecting the expression of their target gene(s) (33), the present study attempted to identify the direct target of bta-miR-204 associated with IFN-τ treatment. Data collection and analysis revealed that BoLA was a potential target gene of bta-miR-204. The predicted target site is a 1437-1462 base sequence of BoLA mRNA, and the seed region of bta-miR-204 is a 23-30 base sequence (Fig. 3A). The mFE between the BoLA 3'-UTR and bta-miR-204 was calculated with RNAhybrid software (https://bibiserv.cebitec.uni-bielefeld.de/rnahybrid/). The mFE was ~16.9 kcal/mol, which indicated high stability of the duplex.

BoLA is a direct target of bta-miR-204

Luciferase reporter assays were performed to further investigate whether bta-miR-204 directly targets the 3'-UTR of BoLA in bEECs. The target sequences of the wild-type and mutant 3'-UTR of BoLA were cloned separately into a luciferase reporter vector to generate Luc-BoLA (3'UTR) and Luc-BoLA (3'UTR)-Mut, respectively (Fig. 3A). The luciferase activity was inhibited by the binding of bta-miR-204 to the 3'-UTR of BoLA. Co-transfection of Luc-BoLA (3'UTR) with bta-miR-204 agomir and bta-miR-204 antagomir in bEECs resulted in a significant alteration in the luciferase activity compared with that in the control groups, which were transfected with Luc-BoLA (3'UTR) only or co-transfected with Luc-BoLA (3'UTR) and bta-miR-204 agomir NC or Luc-BoLA (3'UTR) and bta-miR-204 antagomir NC. BoLA 3'-UTR luciferase activity was inhibited by bta-miR-204 agomir, which mimics bta-miR-204, while it was increased following transfection with bta-miR-204 antagomir, which is an inhibitor of bta-miR-204. Furthermore, the luciferase activity of BoLA (3'UTR)-Mut was unaffected following transfection with bta-miR-204 agomir compared with the transfection with Luc-BoLA (3'UTR) only or the co-transfection of Luc-BoLA (3'UTR)-Mut and bta-miR-204 agomir NC. This result indicated that the mutated seed sequence of BoLA (3'-UTR) and bta-miR-204 agomir did not bind to each other to affect the luciferase activity (Fig. 3B). The results demonstrated that bta-miR-204 negatively regulated BoLA expression by directly binding to its complementary sequence in the 3'-UTR of BoLA in a sequence-specific manner.

Effects of IFN-τ, bta-miR-204 and BoLA siRNAs on cell proliferation

CCK-8 cell proliferation assays were performed to investigate whether the proliferative capacity of bEEC was affected by IFN-τ, bta-miR-204 agomir/NC, bta-miR-204 antagomir/NC and BoLA siRNAs/NC. The results indicated that little difference existed between the IFN-τ-treated group and the blank group. Similarly, little difference was observed between the transfection groups and the blank group, respectively (Fig. 4). Therefore, IFN-τ, bta-miR-204 agomir, and bta-miR-204 antagomir exhibited little effect on the proliferation of primary bEECs compared with the control groups.

IFN-τ positively regulates BoLA expression

To determine the roles of IFN-τ and bta-miR-204 in the regulation of BoLA expression, treatment of bEECs with IFN-τ and suppression or overexpression of bta-miR-204 was performed. After transient transfection with bta-miR-204 agomir, bta-miR-204 overexpression was detected in bEECs by qPCR (Fig. 5A). Furthermore, bta-miR-204 agomir NC, bta-miR-204 antagomir and bta-miR-204 antagomir NC were also overexpressed in bEECs via transient transfection. The statistical analysis demonstrated that compared with the blank group, the expression level of bta-miR-204 was downregulated both after IFN-τ treatment and in the bta-miR-204 antagomir group (Fig. 5A). In addition, compared with the NC group the mRNA (Fig. 5B) and protein (Fig. 5C) expression of BoLA were upregulated as a consequence of the decreased expression of bta-miR-204 While, mRNA and protein expression levels of BoLA were downregulated in the bta-miR-204 groups. Collectively, these results indicated that IFN-τ upregulated BoLA expression by negatively regulating bta-miR-204 expression in bEECs.

Expression of PD-L1 and PD-L2 in IFN-τ-treated bEECs and endometrial tissues of dairy cattle

A previous study has reported that the expression level of MHC-I was positively associated with that of PD-L1 and PD-L2(34). Uterine tissues of pregnant or nonpregnant cattle and BoLA siRNA-transfected bEECs were used in this experiment to evaluate the effect of IFN-τ and BoLA on the PD-L1 and PD-L2 expression level. The results revealed that the mRNA expression of PD-L1 and PD-L2 in cattle during early pregnancy was significantly increased compared with that in nonpregnant cattle (Fig. 6A). RT-qPCR was used to evaluate the efficacy of the siRNAs in downregulating BoLA expression in bEECs. The results indicated that BoLA siRNA 1 exhibited the best inhibitory effect on BoLA mRNA expression, therefore it was used in subsequent experiments (Fig. 6B). In accordance with the in vivo results, the mRNA expression level of PD-L1 and PD-L2 in the bEECs was increased following IFN-τ treatment compared with that in the blank group. However, the expression level of PD-L1 and PD-L2 in the BoLA siRNA-transfected groups decreased compared with that in the IFN-τ treatment group (Fig. 6C). These results indicated that IFN-τ may induce PD-L1 and PD-L2 transcription via regulating BoLA expression.

Discussion

Embryo implantation is an important step for the establishment of normal pregnancy. In ruminants and humans, the interaction between the trophoblast cells and the cells of the apical surface of the luminal epithelium indicates implantation (35). The difference between ruminants and humans in controlling embryo implantation is that, in addition to estrogen and progesterone, ruminants also secrete IFN-τ to regulate the expression of various cytokines and transcription factors (36,37).

Previous studies have identified an important function of miRNAs in regulating potential gene expression during implantation in a range of species, such as humans, mice and swine (38-42). For instance, miR-200a was reported to regulate progesterone-progesterone receptor signaling via negatively regulating the expression of progesterone receptor and 20-hydroxysteroid dehydrogenase to influence endometrial receptivity and embryo implantation (43). miR-29a was indicated to regulate the expression of proapoptotic and antiapoptotic factors, thereby serving an important role during embryo implantation (44). Moreover, miR-148a and miR-152 were revealed to regulate the expression of HLA-G to affect the acceptance of the fetus (45,46).

In the present study, IFN-τ was indicated to reduce the expression of bta-miR-204 in bEECs. miR-204 is highly conserved in humans, rabbits, rats, mice and other vertebrates, and it has been revealed to be one of the most commonly altered miRNA in tumors (47-49). Previous studies have indicated that the expression of miR-204 was downregulated in tumor tissues and cells (50-52). This finding suggested that low-level miR-204 via the negative regulation of its target genes may aid the tumor to escape the immune system or proliferate, migrate and invade the tissues.

Previous studies have demonstrated that there were a number of similarities between embryo implantation and tumor invasion and metastasis, such as pathophysiological processes, gene expression, angiogenesis and immune escape (53-55). Based on these similarities, an analogy may be drawn between pregnancy and cancer in terms of immune tolerance (35,56). To further verify whether bta-miR-204 serves an important role in regulating embryo implantation as in regulating tumors, it was firstly observed that the mRNA and protein expression of BoLA were significantly increased in the endometrial tissues of pregnant dairy cattle compared with nonpregnant cattle and in bEECs treated with IFN-τ compared with control cells. These results were in accordance with the results of previous studies, which demonstrated the important and beneficial role of MHC-I in the establishment of pregnancy (57-59). Subsequently, using dual-luciferase reporter assay, BoLA was verified to be the direct target gene of the bta-miR-204.

Although previous research has revealed MHC-I as a key factor in regulating embryonic development, the specific molecular mechanisms and genes involved are not well understood (60). Several embryonic development-associated genes were analyzed to explore the possible mechanisms in embryo development (61). PD-L1 and PD-L2 are two ligands known to bind to PD-1 and have been associated with the regulation of tolerance and autoimmunity (62,63). PD-L1 and PD-L2 mRNAs have been detected in a variety of tissues, including the heart, lungs, placenta and tumor tissues (64,65). In the present study, the mRNA levels of PD-L1, PD-L2, BoLA and IFN-τ were indicated to be significantly increased in the endometrial tissues of pregnant dairy cattle compared with those in nonpregnant cattle. Aust et al (34) reported that a large number of MHC-I and MHC-II genes were positively associated with PD-L1 expression levels in tumor cells. To further elucidate the relationship between BoLA and PD-L1 or PD-L2, experiments were conducted using bEECs. The results revealed that PD-L1 and PD-L2 mRNA expression level increased following IFN-τ treatment, whereas it decreased after transfection with BoLA siRNA. These results indicated that IFN-τ upregulated PD-L1 and PD-L2 transcription, potentially via regulating BoLA expression. These data may provide a basis for explaining the diversity in immune escape mechanisms in pregnant dairy cattle during embryo implantation. A common immune escape mechanism of tumor cells is the downregulation of HLA-I (66). Another common immune escape mechanism in tumors and transplants is the activation of the PD/PD-L negative costimulatory pathway, which alters the balance between pathogenic and regulatory T cells (21,67,68). In particular, PD-L1 expression is crucial for the maintenance of tolerance at the utero-placental interface (69).

In the present study, the results revealed that IFN-τ may induce BoLA expression due to its negative regulation of bta-miR-204. In addition, as the expression level of BoLA was induced by IFN-τ, the mRNA level of PD-L1 and PD-L2 was also increased, and it was positively associated with the expression level of BoLA. These results further indicated the immune escape mechanism of IFN-τ in regulating implantation during early pregnancy in dairy cattle. However, the use of a single animal model is a limitation to the present study, and although the method presented was accurate, different species of animals should be tested in vivo or in vitro.

To conclude, on the basis of the experimental results, the current study indicated that IFN-τ increased the expression of BoLA by reducing the expression of bta-miR-204, and IFN-τ may induce the transcription of PD-L1 and PD-L2 by inhibiting bta-miR-204 to upregulate the expression of BoLA, thereby affecting the immune microenvironment of the maternal-fetal interface and promoting fetal immune escape.

Acknowledgements

Not applicable.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

XW and GD designed the study and participated in the data analysis and interpretation, manuscript drafting and critical revision. XW, NY and XM performed the experiments and contributed to data acquisition. TY, YY, JY and AS provided reagents and contributed to data analysis and interpretation and to critical revision of the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The present study was approved by the Huazhong Agricultural University Animal Care and Use Committee (Wuhan, China; approval no. 20171354CA).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Spencer TE, Johnson GA, Bazer FW and Burghardt RC: Fetal-maternal interactions during the establishment of pregnancy in ruminants. Soc Reprod Fertil Suppl. 64:379–396. 2007.PubMed/NCBI View Article : Google Scholar

2 

Spencer TE and Bazer FW: Uterine and placental factors regulating conceptus growth in domestic animals. J Anim Sci. 82 (Suppl):E4–E13. 2004.PubMed/NCBI View Article : Google Scholar

3 

Saito S: Cytokine network at the feto-maternal interface. J Reprod Immunol. 47:87–103. 2000.PubMed/NCBI View Article : Google Scholar

4 

Roberts RM: Interferon-tau, a type 1 interferon involved in maternal recognition of pregnancy. Cytokine Growth Factor Rev. 18:403–408. 2007.PubMed/NCBI View Article : Google Scholar

5 

Bazer FW, Spencer TE and Ott TL: Interferon tau: A novel pregnancy recognition signal. Am J Reprod Immunol. 37(412)1997.PubMed/NCBI View Article : Google Scholar

6 

Demmers KJ, Derecka K and Flint A: Trophoblast interferon and pregnancy. Reproduction. 121:41–49. 2001.PubMed/NCBI View Article : Google Scholar

7 

Yao GD, Shu YM, Shi SL, Peng ZF, Song WY, Jin HX and Sun YP: Expression and potential roles of HLA-G in human spermatogenesis and early embryonic development. PLoS One. 9(e92889)2014.PubMed/NCBI View Article : Google Scholar

8 

Ozato K, Wan YJ and Orrison BM: Mouse major histocompatibility class I gene expression begins at midsomite stage and is inducible in earlier-stage embryos by interferon. Proc Natl Acad Sci USA. 82:2427–2431. 1985.PubMed/NCBI View Article : Google Scholar

9 

Talbot NC, Powell AM, Ocón OM, Caperna TJ, Camp M, Garrett WM and Ealy AD: U.S. Department of Agriculture, Agricultural Research Service. Comparison of the interferon-tau expression from primary trophectoderm outgrowths derived from IVP, NT, and parthenogenote bovine blastocysts. Mol Reprod Dev. 75:299–308. 2008.PubMed/NCBI View Article : Google Scholar

10 

Zhu Z, Li B, Wu Y, Wang X and Deng G: Interferon-τ increases BoLA-I for implantation during early pregnancy in dairy cows. Oncotarget. 8:95095–95107. 2017.PubMed/NCBI View Article : Google Scholar

11 

Wu H, Tao Z, Ma X, Jiang K, Zhao G, Qiu C and Deng G: Specific microRNA library of IFN-τ, on bovine endometrial epithelial cells. Oncotarget. 8:61487–61498. 2017.PubMed/NCBI View Article : Google Scholar

12 

Valencia-Sanchez MA, Liu J, Hannon GJ and Parker R: Control of translation and mRNA degradation by miRNAs and siRNAs. Genes Dev. 20:515–524. 2006.PubMed/NCBI View Article : Google Scholar

13 

Skommer J, Rana I, Marques FZ, Zhu W, Du Z and Charchar FJ: Small molecules, big effects: The role of microRNAs in regulation of cardiomyocyte death. Cell Death Dis. 5(e1325)2014.PubMed/NCBI View Article : Google Scholar

14 

Sun E and Shi Y: MicroRNAs: Small molecules with big roles in neurodevelopment and diseases. Exp Neurol. 268:46–53. 2015.PubMed/NCBI View Article : Google Scholar

15 

Smyth LA, Boardman DA, Tung SL, Lechler R and Lombardi G: MicroRNAs affect dendritic cell function and phenotype. Immunology. 144:197–205. 2015.PubMed/NCBI View Article : Google Scholar

16 

Bidarimath M, Khalaj K, Wessels JM and Tayade C: MicroRNAs, immune cells and pregnancy. Cell Mol Immunol. 11:538–547. 2014.PubMed/NCBI View Article : Google Scholar

17 

Ye ZH, Wen DY, Cai XY, Liang L, Wu PR, Qin H, Yang H, He Y and Chen G: The protective value of miR-204-5p for prognosis and its potential gene network in various malignancies: A comprehensive exploration based on RNA-seq high-throughput data and bioinformatics. Oncotarget. 8:104960–104980. 2017.PubMed/NCBI View Article : Google Scholar

18 

Jacob RJ and Cramer R: PIGOK: Linking protein identity to gene ontology and function. J Proteome Res. 5:3429–3432. 2006.PubMed/NCBI View Article : Google Scholar

19 

Bo W, Xiao-Li HE, Yong-Sheng W, Xue-Jiao W, Yong Z and Yue-Mao Z: BoLA-I gene expression in early development of bovine SCNT embryo. Chin J Veterinary: ence, 2015.

20 

Loustau M, Wiendl H, Ferrone S and Carosella ED: HLA-G 2012 conference: The 15-year milestone update. Tissue Antigens. 81:127–136. 2013.PubMed/NCBI View Article : Google Scholar

21 

Keir ME, Butte MJ, Freeman GJ and Sharpe AH: PD-1 and its ligands in tolerance and immunity. Annu Rev Immunol. 26:677–704. 2008.PubMed/NCBI View Article : Google Scholar

22 

Mincheva-Nilsson L and Baranov V: Placenta-derived exosomes and syncytiotrophoblast microparticles and their role in human reproduction: Immune modulation for pregnancy success. Am J Reprod Immunol. 72:440–457. 2014.PubMed/NCBI View Article : Google Scholar

23 

Bardhan K, Anagnostou T and Boussiotis VA: The PD1: PD-L1/2 pathway from discovery to clinical implementation. Front Immunol. 7(550)2016.PubMed/NCBI View Article : Google Scholar

24 

Okazaki T and Honjo T: PD-1 and PD-1 ligands: From discovery to clinical application. Int Immunol. 19:813–824. 2007.PubMed/NCBI View Article : Google Scholar

25 

Eppihimer MJ, Gunn J, Freeman GJ, Greenfield EA, Chernova T, Erickson J and Leonard JP: Expression and regulation of the PD-L1 immunoinhibitory molecule on microvascular endothelial cells. Microcirculation. 9:133–145. 2002.PubMed/NCBI View Article : Google Scholar

26 

Chen J, Feng Y, Lu L, Wang H, Dai L, Li Y and Zhang P: Interferon-γ-induced PD-L1 surface expression on human oral squamous carcinoma via PKD2 signal pathway. Immunobiology. 217:385–393. 2012.PubMed/NCBI View Article : Google Scholar

27 

Ashizawa T, Iizuka A, Nonomura C, Kondou R, Maeda C, Miyata H, Sugino T, Mitsuya K, Hayashi N, Nakasu Y, et al: Antitumor effect of programmed death-1 (PD-1) blockade in humanized the NOG-MHC double knockout mouse. Clin Cancer Res. 23:149–158. 2017.PubMed/NCBI View Article : Google Scholar

28 

Blank C, Metzner M, Lorch A and Klee W: Euthanasia of cattle: A clinical comparison of T 61 and pentobarbital (Eutha 77). Berl Munch Tierarztl Wochenschr. 123:96–102. 2010.PubMed/NCBI(In German).

29 

Mishra B, Kizaki K, Koshi K, Ushizawa K, Takahashi T, Hosoe M, Sato T, Ito A and Hashizume K: Expression of extracellular matrix metalloproteinase inducer (EMMPRIN) and its expected roles in the bovine endometrium during gestation. Domest Anim Endocrinol. 42:63–73. 2012.PubMed/NCBI View Article : Google Scholar

30 

Rehmsmeier M, Steffen P, Höchsmann M and Giegerich R: Fast and effective prediction of microRNA/target duplexes. RNA. 10:1507–1517. 2004.PubMed/NCBI View Article : Google Scholar

31 

Elbashir SM, Lendeckel W and Tuschl T: RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev. 15:188–200. 2001.PubMed/NCBI View Article : Google Scholar

32 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

33 

He L and Hannon GJ: MicroRNAs: Small RNAs with a big role in gene regulation. Nat Rev Genet. 5:522–531. 2004.PubMed/NCBI View Article : Google Scholar

34 

Aust S, Felix S, Auer K, Bachmayr-Heyda A, Kenner L, Dekan S, Meier SM, Gerner C, Grimm C and Pils D: Absence of PD-L1 on tumor cells is associated with reduced MHC I expression and PD-L1 expression increases in recurrent serous ovarian cancer. Sci Rep. 7(42929)2017.PubMed/NCBI View Article : Google Scholar

35 

Zhang S, Lin H, Kong S, Wang S, Wang H, Wang H and Armant DR: Physiological and molecular determinants of embryo implantation. Mol Aspects Med. 34:939–980. 2013.PubMed/NCBI View Article : Google Scholar

36 

Bazer FW, Ying W, Wang X, Dunlap KA, Zhou B, Johnson GA and Wu G: The many faces of interferon tau. Amino Acids. 47:449–460. 2015.PubMed/NCBI View Article : Google Scholar

37 

Shirasuna K, Matsumoto H, Matsuyama S, Kimura K, Bollwein H and Miyamoto A: Possible role of interferon tau on the bovine corpus luteum and neutrophils during the early pregnancy. Reproduction. 150:217–225. 2015.PubMed/NCBI View Article : Google Scholar

38 

Galliano D and Pellicer A: MicroRNA and implantation. Fertil Steril. 101:1531–1544. 2014.PubMed/NCBI View Article : Google Scholar

39 

Liu W, Niu Z, Li Q, Pang RT, Chiu PC and Yeung WS: MicroRNA and embryo implantation. Am J Reprod Immunol. 75:263–271. 2016.PubMed/NCBI View Article : Google Scholar

40 

Su L, Liu R, Cheng W, Zhu M, Li X, Zhao S and Yu M: Expression patterns of microRNAs in porcine endometrium and their potential roles in embryo implantation and placentation. PLoS One. 9(e87867)2014.PubMed/NCBI View Article : Google Scholar

41 

Song Y, An X, Zhang L, Fu M, Peng J, Han P, Hou J, Zhou Z and Cao B: Identification and profiling of microRNAs in goat endometrium during embryo implantation. PLoS One. 10(e0122202)2015.PubMed/NCBI View Article : Google Scholar

42 

Ponsuksili S, Tesfaye D, Schellander K, Hoelker M, Hadlich F, Schwerin M and Wimmers K: Differential expression of miRNAs and their target mRNAs in endometria prior to maternal recognition of pregnancy associates with endometrial receptivity for in vivo- and in vitro-produced bovine embryos. Biol Reprod. 91(135)2014.PubMed/NCBI View Article : Google Scholar

43 

Haraguchi H, Saito-fujita T, Hirota Y, Egashira M, Matsumoto L, Matsuo M, Hiraoka T, Koga K, Yamauchi N, Fukayama M, et al: MicroRNA-200a locally attenuates progesterone signaling in the cervix, preventing embryo implantation. Mol Endocrinol. 28:1108–1117. 2014.PubMed/NCBI View Article : Google Scholar

44 

Xia HF, Jin XH, Cao ZF, Hu Y and Ma X: MicroRNA expression and regulation in the uterus during embryo implantation in rat. FEBS J. 281:1872–1891. 2014.PubMed/NCBI View Article : Google Scholar

45 

Rebmann V, da Silva Nardi F, Wagner B and Horn PA: HLA-G as a tolerogenic molecule in transplantation and pregnancy. J Immunol Res. 2014(297073)2014.PubMed/NCBI View Article : Google Scholar

46 

Manaster I, Goldman-Wohl D, Greenfield C, Nachmani D, Tsukerman P, Hamani Y, Yagel S and Mandelboim O: MiRNA-mediated control of HLA-G expression and function. PLoS One. 7(e33395)2012.PubMed/NCBI View Article : Google Scholar

47 

Mohammed CP, Rhee H, Phee BK, Kim K, Kim HJ, Lee H, Park JH, Jung JH, Kim JY, Kim HC, et al: MiR-204 downregulates EphB2 in aging mouse hippocampal neurons. Aging Cell. 15:380–388. 2016.PubMed/NCBI View Article : Google Scholar

48 

Li T, Pan H and Li R: The dual regulatory role of miR-204 in cancer. Tumour Biol. 37:11667–11677. 2016.PubMed/NCBI View Article : Google Scholar

49 

Xia Z, Liu F, Zhang J and Liu L: Decreased expression of MiRNA-204-5p contributes to glioma progression and promotes glioma cell growth, migration and invasion. PLoS One. 10(e0132399)2015.PubMed/NCBI View Article : Google Scholar

50 

Shi Y, Huang J, Zhou J, Liu Y, Fu X, Li Y, Yin G and Wen J: MicroRNA-204 inhibits proliferation, migration, invasion and epithelial-mesenchymal transition in osteosarcoma cells via targeting Sirtuin 1. Oncol Rep. 34:399–406. 2015.PubMed/NCBI View Article : Google Scholar

51 

Yin JJ, Liang B and Zhan XR: MicroRNA-204 inhibits cell proliferation in T-cell acute lymphoblastic leukemia by down-regulating SOX4. Int J Clin Exp Pathol. 8:9189–9195. 2015.PubMed/NCBI

52 

Liu L, Wang J, Li X, Ma J, Shi C, Zhu H, Xi Q, Zhang J, Zhao X and Gu M: MiR-204-5p suppresses cell proliferation by inhibiting IGFBP5 in papillary thyroid carcinoma. Biochem Biophys Res Commun. 457:621–626. 2015.PubMed/NCBI View Article : Google Scholar

53 

Ferretti C, Bruni L, Dangles-Marie V, Pecking AP and Bellet D: Molecular circuits shared by placental and cancer cells, and their implications in the proliferative, invasive and migratory capacities of trophoblasts. Hum Reprod Update. 13:121–141. 2007.PubMed/NCBI View Article : Google Scholar

54 

Holtan SG, Creedon DJ, Haluska P and Markovic SN: Cancer and pregnancy: Parallels in growth, invasion, and immune modulation and implications for cancer therapeutic agents. Mayo Clin Proc. 84:985–1000. 2009.PubMed/NCBI View Article : Google Scholar

55 

Piechowski J: Trophoblastic implantation, a model of tumor and metastasis implantation. Bull Cancer. 102:806–813. 2015.PubMed/NCBI View Article : Google Scholar : (In French).

56 

Chen T, Darrassejèze G, Bergot AS, Courau T, Churlaud G, Valdivia K, Strominger JL, Ruocco MG, Chaouat G and Klatzmann D: Self-specific memory regulatory T cells protect embryos at implantation in mice. J Immunol. 191:2273–2281. 2013.PubMed/NCBI View Article : Google Scholar

57 

Thompson RN, Mcmillon R, Napier A and Wekesa KS: Pregnancy block by MHC class I peptides is mediated via the production of inositol 1,4,5-trisphosphate in the mouse vomeronasal organ. J Exp Biol. 210:1406–1412. 2007.PubMed/NCBI View Article : Google Scholar

58 

O'Gorman GM, Al Naib A, Ellis SA, Mamo S, O'Doherty AM, Lonergan P and Fair T: Regulation of a Bovine nonclassical major histocompatibility complex class I gene promoter1. Biol Reprod. 83:296–306. 2010.PubMed/NCBI View Article : Google Scholar

59 

Al Naib A, Mamo S, O'Gorman GM, Lonergan P, Swales A and Fair T: Regulation of non-classical major histocompatability complex class I mRNA expression in bovine embryos. J Reprod Immunol. 91:31–40. 2011.PubMed/NCBI View Article : Google Scholar

60 

Cheng Y, King NJ and Kesson AM: Major histocompatibility complex class I (MHC-I) induction by West Nile Virus: Involvement of 2 signaling pathways in MHC-I Up-Regulation. J Infect Dis. 189:658–668. 2004.PubMed/NCBI View Article : Google Scholar

61 

Townson DH: Immune cell-endothelial cell interactions in the bovine corpus luteum. Integr Comp Biol. 46:1055–1059. 2006.PubMed/NCBI View Article : Google Scholar

62 

Liu H, Bakthavatsalam R, Meng Z, Li Z, Li W, Perkins JD and Reyes J: PD-L1 signal on liver dendritic cells is critical for Foxp3+CD4+CD25+ Treg and liver tolerance induction in mice. Transplant Proc. 45:1853–1855. 2013.PubMed/NCBI View Article : Google Scholar

63 

Liang SC, Latchman YE, Buhlmann JE, Tomczak MF, Horwitz BH, Freeman GJ and Sharpe AH: Regulation of PD-1, PD-L1, and PD-L2 expression during normal and autoimmune responses. Eur J Immunol. 33:2706–2716. 2003.PubMed/NCBI View Article : Google Scholar

64 

Kim MY, Koh J, Kim S, Go H, Jeon YK and Chung DH: Clinicopathological analysis of PD-L1 and PD-L2 expression in pulmonary squamous cell carcinoma: Comparison with tumor-infiltrating T cells and the status of oncogenic drivers. Lung Cancer. 88:24–33. 2015.PubMed/NCBI View Article : Google Scholar

65 

Yang H, Bueso-ramos C, Dinardo C, Estecio MR, Davanlou M, Geng QR, Fang Z, Nguyen M, Pierce S, Wei Y, et al: Expression of PD-L1, PD-L2, PD-1 and CTLA4 in myelodysplastic syndromes is enhanced by treatment with hypomethylating agents. Leukemia. 28:1280–1288. 2014.PubMed/NCBI View Article : Google Scholar

66 

Garcia-Lora A, Algarra I and Garrido F: MHC class I antigens, immune surveillance, and tumor immune escape. J Cell Physiol. 195:346–355. 2003.PubMed/NCBI View Article : Google Scholar

67 

Francisco LM, Sage PT and Sharpe AH: The PD-1 pathway in tolerance and autoimmunity. Immunol Rev. 236:219–242. 2010.PubMed/NCBI View Article : Google Scholar

68 

Francisco LM, Salinas VH, Brown KE, Vanguri VK, Freeman GJ, Kuchroo VK and Sharpe AH: PD-L1 regulates the development, maintenance, and function of induced regulatory T cells. J Exp Med. 206:3015–3029. 2009.PubMed/NCBI View Article : Google Scholar

69 

Guleria I, Khosroshahi A, Ansari MJ, Habicht A, Azuma M, Yagita H, Noelle RJ, Coyle A, Mellor AL, Khoury SJ and Sayegh MH: A critical role for the programmed death ligand 1 in fetomaternal tolerance. J Exp Med. 202:231–237. 2005.PubMed/NCBI View Article : Google Scholar

Related Articles

Journal Cover

June-2021
Volume 21 Issue 6

Print ISSN: 1792-0981
Online ISSN:1792-1015

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Wang X, Yuan T, Yin N, Ma X, Yang Y, Yang J, Shaukat A and Deng G: Interferon‑τ regulates the expression and function of bovine leukocyte antigen by downregulating bta‑miR‑204. Exp Ther Med 21: 594, 2021
APA
Wang, X., Yuan, T., Yin, N., Ma, X., Yang, Y., Yang, J. ... Deng, G. (2021). Interferon‑τ regulates the expression and function of bovine leukocyte antigen by downregulating bta‑miR‑204. Experimental and Therapeutic Medicine, 21, 594. https://doi.org/10.3892/etm.2021.10026
MLA
Wang, X., Yuan, T., Yin, N., Ma, X., Yang, Y., Yang, J., Shaukat, A., Deng, G."Interferon‑τ regulates the expression and function of bovine leukocyte antigen by downregulating bta‑miR‑204". Experimental and Therapeutic Medicine 21.6 (2021): 594.
Chicago
Wang, X., Yuan, T., Yin, N., Ma, X., Yang, Y., Yang, J., Shaukat, A., Deng, G."Interferon‑τ regulates the expression and function of bovine leukocyte antigen by downregulating bta‑miR‑204". Experimental and Therapeutic Medicine 21, no. 6 (2021): 594. https://doi.org/10.3892/etm.2021.10026