Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
June-2021 Volume 21 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2021 Volume 21 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

ΜicroRNA‑122 protects against ischemic stroke by targeting Maf1

  • Authors:
    • Mengmeng Wang
    • Xiaoman Liu
    • Yu Wu
    • Yi Wang
    • Jiahui Cui
    • Jing Sun
    • Ying Bai
    • Ming-Fei Lang
  • View Affiliations / Copyright

    Affiliations: Department of Neurology, Affiliated Xinhua Hospital of Dalian University, Dalian, Liaoning 116021, P.R. China, Medical College, Institute of Microanalysis, Dalian University, Dalian, Liaoning 116622, P.R. China, College of Environmental and Chemical Engineering, Institute of Microanalysis, Dalian University, Dalian, Liaoning 116622, P.R. China
  • Article Number: 616
    |
    Published online on: April 14, 2021
       https://doi.org/10.3892/etm.2021.10048
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The protection of brain tissue against damage and the reduction of infarct size is crucial for improving patient prognosis following ischemic stroke. Therefore, the present study aimed to investigate the regulatory effect of microRNA (miR)‑122 and its target gene repressor of RNA polymerase III transcription MAF1 homolog (Maf1) on the infarct area in ischemic stroke. Reverse transcription-quantitative PCR (RT‑qPCR) was performed to determine miR‑122 expression levels in an ischemic stroke [middle cerebral artery occlusion (MCAO)] mouse model. Nissl staining was conducted to measure the infarct area of the MCAO mouse model. Moreover, RT‑qPCR was performed to investigate the relationship between the expression of Maf1 and miR‑122 in the MCAO mouse model. Dual‑luciferase reporter assay in vitro and miR‑122 mimic or inhibitor treatment in vivo were conducted to verify that miR‑122 targeted and inhibited Maf1 expression. The results suggested that miR‑122 was upregulated in the brain tissue of MCAO model mice. miR‑122 overexpression effectively reduced the size of the infarct area in comparison with a control and miR‑122 knockdown in brain tissue resulted in the opposite effect. Moreover, Maf1 was confirmed to be a direct target of miR‑122. The results of a dual‑luciferase reporter assay indicated that miR‑122 bound to the 3'‑untranslated region of Maf1. Maf1 expression decreased after stroke model induction in comparison with that in sham animals, and Maf1 expression was negatively associated with the expression of miR‑122. In addition, miR‑122 knockdown increased Maf1 expression levels, whereas miR‑122 overexpression decreased Maf1 expression levels in comparison with a control. In conclusion, the results suggested that miR‑122 improved the outcome of acute ischemic stroke by reducing the expression of Maf1.

Introduction

Stroke is the second largest cause of death worldwide (1,2). The current treatment strategies for ischemic stroke are limited and early reperfusion is primarily established by intravenous thrombolysis or mechanical thrombectomy. However, there are no effective clinical drugs that improve patient prognosis following cerebral tissue infarction (3,4).

MicroRNAs (miRNAs/miRs) are a class of non-coding RNAs that control the translation of the target protein through inhibition of the 3'-untranslated region (UTR) of the target gene (5-7). It has been reported that >33% of human genes are regulated by miRNAs (6). Previous studies have demonstrated that miRNAs are physiologically and pathologically involved in ischemic stroke (7,8). Among them, miR-122 has been reported to be associated with ischemic stroke. miR-122 is encapsulated in exosomes and secreted into body fluids, where it is stable in serum and may serve as a promising biomarker for ischemic stroke (9,10). miR-122 protects against amyloid-β-induced neuronal injury (11); however, the molecular mechanism underlying miR-122-mediated protection against loss of brain function is not completely understood.

It was initially determined that repressor of RNA polymerase III transcription MAF1 homolog (Maf1) was highly expressed in brain tissue with an abundance identified in the hippocampus and cortex (12). Subsequently TORC1 in the mTOR pathway was revealed to be involved in the phosphorylation of Maf1, which led to Maf1 inactivation (13). Since mTOR protects brain tissues from ischemic injuries, downregulation of Maf1 may have an inhibitory effect on the development of ischemic brain injuries (14,15). In addition, H2O2 is produced by brain tissue after ischemic stroke, which can reduce cell function and further aggravate brain injury (16). H2O2 can serve as a messenger and promote the synthesis of the transcription factor Maf1 (17,18). Therefore, it was hypothesized that Maf1 may serve an important role in the development and progression of ischemic stroke; however, the biological function of Maf1 and its relationship with ischemic stroke are not completely understood.

miR-122 may serve as a potential therapeutic target for ischemic stroke (19), whereas Maf1 may aggravate ischemic stroke, but the specific underlying mechanism is not completely understood (20-23). Therefore, it was hypothesized that miR-122 may be involved in the development of ischemic stroke by targeting Maf1. The present study aimed to investigate the relationship between Maf1 and miR-122 in the development and progression of ischemic stroke.

Materials and methods

Experimental animals

A total of 60 female C57BL/6 mice (age, 6-8 weeks; weight, 20-25 g) were purchased from the Experimental Animal Center of Dalian Medical University. The animals were housed at 23±2˚C with 55±5% humidity under a 12-h light/dark cycle with free access to food and water. The present study was approved by the Animal Care Committee of the Xinhua Hospital affiliated to Dalian University and performed in accordance with the National Institutes of Health Guidelines (no. 85-23; revised 1996) for the Care and Use of Laboratory Animals (24).

Lateral ventricle injection

Mice were randomly divided into six groups (n=6 per group) for two experimental studies: The effect of miR-122 on infarct size after stroke (control, miR-122 mimic and miR-122 inhibitor groups) and the effect of miR-122 on Maf1 after stroke (control, miR-122 mimic and miR-122 inhibitor groups).

Firstly, 3.5 µl miR-122 negative control (NC), mimic or inhibitor (cat. nos. B04002, B03001 and B02003; Shanghai GenePharma Co., Ltd.) was mixed with 3.5 µl RNAi-mate reagent (cat. no. G04002; Shanghai GenePharma Co., Ltd.) at room temperature for 15 min and stored for later use. After the mice were anesthetized with 400 mg/kg 4% chloral hydrate via intraperitoneal injection, the mixture (7 µl) was injected into the lateral ventricle (over 20 min) at the coordinate (bregma, -2.5 mm; dorsoventral, 1 mm; lateral, 1.5 mm). Subsequently, the wound was sutured and the mice were returned to the cage. At 24 h post-injection, the mouse middle cerebral artery occlusion (MCAO) model was established.

MCAO model

A total of 60 female C57BL/6 mice were selected for this model. The sham operated animals received the same operation as those in the experimental groups except for the coagulation of the blood vessels. The MCAO model (permanent coagulation of the distal middle cerebral artery) is highly reproducible and has a high success rate (the overall mortality is of <5%) (25). Moreover, the relative infarct volume in relation to brain size corresponds to the majority of human strokes (25). Mice were anesthetized with an intraperitoneal injection of 400 mg/kg chloral hydrate. After aseptic preparation of the surgical site, the skin between the ear and the eye was cut under a stereomicroscope (Shanghai Yuyan Instruments Co., Ltd.) using electrocoagulation forceps (Shanghai Yuyan Instruments Co., Ltd.). Once the temporal muscle was removed, a drill (Shanghai Yuyan Instruments Co., Ltd.) with a diameter of 2.5 mm was used to thin out the skull over the middle cerebral artery. The bone was carefully withdrawn to expose the middle cerebral artery, which was then coagulated with electrocoagulation forceps. Subsequently, the wound was sutured and the animal was maintained at 32˚C for recovery (25). At 24 h post-model induction, 6 mice in each group were anesthetized with 400 mg/kg chloral hydrate and sacrificed by decapitation. Brain tissues were harvested and sectioned into 2-mm slices. Subsequently, the ischemic site was identified by incubation of the sections with 2% 2,3,5-triphenyl tetrazolium chloride (cat. no. T8170; Beijing Solarbio Science & Technology Co., Ltd.) at 37˚C for 15 min in the dark.

Coronal section

Brain tissues were fixed with 4% paraformaldehyde for 6 h at 4˚C, the surface liquid was removed by blotting and then the tissues were dehydrated with 15% sucrose solution overnight at 4˚C. Subsequently, the tissues were incubated with 30% sucrose solution overnight at 4˚C. Coronal sections were prepared into 30-µm sections using a frozen microtome (Leica Microsystems GmbH).

Nissl stain

Sections were washed twice with PBS for 5 sec and stained with Nissl staining solution (cat. no. E607316; Sangon Biotech Co., Ltd.) for 15 min at 25˚C. Subsequently, the sections were washed twice with PBS for 5 sec and then washed with 95% ethanol for 5 sec. Stained sections were examined under a Nikon Eclipse Ti inverted fluorescent microscope with a charge-coupled device camera at a magnification of x100. Microscopic images were analyzed with ImageJ (version 1.48; National Institutes of Health).

Prediction of miR-122 target gene

TargetScan (version 7.2; www.targetscan.org/vert_72), miRWalk (version 3; mirwalk.umm.uni-heidelberg.de) and miRDB (version 6.0; mirdb.org) gene prediction software were used to predict the target genes of miR-122. The intersection of the results was identified and used to investigate the association between target genes and ischemic stroke.

Reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was extracted from the cerebral cortex (n=6 per group) using TRIzol® (cat. no. B610409; Sangon Biotech Co., Ltd.). Total RNA was reverse transcribed into cDNA using PrimeScriptTM RT reagent kit (cat. no. RR047A; Takara Biotechnology Co., Ltd.) at 37˚C for 15 min and 85˚C for 5 sec. Subsequently, qPCR was performed using SYBR Green Supermix (cat. no. RR820Q; Takara Biotechnology Co., Ltd.). The following thermocycling conditions were used for qPCR: Denaturation at 95˚C for 30 sec; followed by 40 cycles of 95˚C for 10 sec and 60˚C for 30 sec; and cooling to 4˚C. The following primers were used for qPCR: miR-122 (cat. no. ssD809230039; Sangon Biotech Co., Ltd.); Maf1 forward, 5'-GATTGCCACCCTCAATGAGTCC-3' and reverse, 5'-CTCCTCATCCACTGCATTCCAC-3' (Sangon Biotech Co., Ltd.); CEL-39 (cat. no. ssD1083145001; Sangon Biotech Co., Ltd.); and actin-β (ACTB) forward, 5'-GTGCTATGTTGCTCTAGACTTCG-3' and reverse, 5'-ATGCCACAGGATTCCATACC-3' (Sangon Biotech Co., Ltd.). miRNA and mRNA expression levels were analyzed using the 2-ΔΔCq method (26) and normalized to the internal reference genes CEL-39 and ACTB, respectively.

Construction of vector

Maf1-3'UTR primers were designed by Sangon Biotech Co., Ltd. (forward, 5'-ATCCAGCTCTGACCAATC-3' and reverse, 5'-CCAGGTTCCATCTAAGTCAC-3'). The PCR products were cloned into the XhoI and NotI sites of the siCheck vector (Invitrogen; Thermo Fisher Scientific, Inc.) to construct the Maf1-wild-type (WT)-3'UTR vector. The 3'UTR of Maf1 containing the predicted binding site of miR-122 was subjected to site-directed mutation (Sangon Biotech Co., Ltd.) to construct the Maf1-mutant (MUT)-3'UTR vector.

Dual-luciferase reporter assay

Cells (293A) were divided into the following four groups: i) Maf1-WT-3'UTR + miR-122 NC (Maf1-WT-3'UTR + NC); ii) Maf1-WT-3'UTR + miR-122 mimic (Maf1-WT-3'UTR + miR-122); iii) Maf1-MUT-3'UTR vector + miR-122 NC (Maf1-MUT-3'UTR + NC); and iv) Maf1-MUT-3'UTR vector + miR-122 mimic (Maf1-MUT-3'UTR + miR-122). 293A cells (Dalian University Microanalysis Laboratory) were plated in 24-well plates at a density of 1x105 cells per well in DMEM (Thermo Fisher Scientific, Inc.) containing 10% FBS (Thermo Fisher Scientific, Inc.). Cells were incubated at 37˚C and 5% CO2 and cultured to 90-95% confluence. Subsequently, cells were co-transfected with 50 nM miRNA and 1 µg vector using Lipofectamine® 2000 (cat. no. 11668019; Thermo Fisher Scientific, Inc.). At 48 h post-transfection, luciferase activity was assessed using a dual-luciferase reporter assay kit (cat. no. RG027; Beyotime Institute of Biotechnology) and a fluorescence microplate reader at a wavelength of 560 nm for luciferin and 465 nm for renilla luciferase). Firefly luciferase activity was normalized to Renilla luciferase activity.

Statistical analysis

Statistical analyses were conducted using SPSS software (version 22.0; IBM Corp.). The data were analyzed using unpaired Student's t-test or one-way ANOVA and Tukey's post-hoc test. Data are expressed as the mean ± standard deviation. P<0.05 was considered to indicate a statistically significant difference. All experiments were performed at least six times.

Results

Establishment of the MCAO model

As presented in Fig. 1A, the middle cerebral artery was exposed in a Y shape. After the middle cerebral artery was coagulated using electrocoagulation forceps, spontaneous recanalization was not observed (Fig. 1B). After MCAO establishment, the infarct brain area was white in color, whereas healthy brain tissues were stained red (Fig. 1C and D).

Figure 1

MCAO model establishment. (A) The arrow indicates the middle cerebral artery which was not coagulated. (B) The arrow indicates the middle cerebral artery which was coagulated using electrocoagulation forceps. (C) Representative image of TTC-stained brain surface after ischemic stroke modeling. Pale areas indicate ischemic focal points. (D) Representative image of TTC-stained coronary surface after MCAO. Pale areas indicate ischemic focal points. MCAO, middle cerebral artery occlusion; TTC, 2,3,5-triphenyl tetrazolium chloride.

miR-122 decreases the infarct area

To investigate the relationship between miR-122 and ischemic stroke, the expression level of miR-122 was examined and the effect of miR-122 on the infarct area was evaluated. As presented in Fig. 2A, the expression of miR-122 (sham, 1.00±0.06; MCAO, 1.82±0.10; P<0.05; n=6) was significantly increased after MCAO induction in comparison with sham animals (Fig. 2A). Compared with MCAO model rats treated with control miRNA, the size of the area of infarction was significantly reduced in MCAO model rats that were injected with miR-122 mimic in the lateral ventricle in comparison with control animals. By contrast, the area of infarction increased significantly in comparison with the control following injection of miR-122 inhibitor in the lateral ventricle (control, 2.85±0.27; mimic, 1.19±0.05; inhibitor 6.53±0.17; mimic vs. control and inhibitor vs. control, P<0.05; n=6; Fig. 2B).

Figure 2

miR-122 overexpression in MCAO model rats effectively reduces the infarct area. (A) miR-122 expression in brain tissue. (B) Alterations to the infarct area after lateral ventricle injection of miR-122 NC, mimic or inhibitor. *P<0.05 vs. sham; #P<0.05 vs. control. miR, microRNA; MCAO, middle cerebral artery occlusion; NC, negative control.

Predicted target gene of miR-122

To reduce the false positive probability of the target gene prediction, gene prediction was performed using the intersection of the prediction results obtained from the three different types of gene prediction software: TargetScan, miRWalk and miRtaget2. Maf1 was identified as a target gene of miR-122 in humans, mice and rats (Table I).

Table I

Maf1 is predicted to be a target gene for miR-122.

Table I

Maf1 is predicted to be a target gene for miR-122.

RNAPredicted consequential pairing
mmu-miR-1223' GUUUGUGGUAACAGUGUGAGGU
mouse-Maf15' ...UCUUAUUGGGCCUGUAA...
rat-Maf15' ...CUUAUUGGGCCUGUACACUCCA...
human-Maf15' ...UUCUACUGGGCCUGCACACUCCA...

[i] Maf1, repressor of RNA polymerase III transcription MAF1 homolog.

Maf1 is a direct target of miR-122

After sequence analysis, it was observed that the 3'UTR of Maf1 was a putative target of miR-122 (Fig. 3A). As the 3'UTR of Maf1 mRNA was predicted to contain a target region of miR-122, a dual-luciferase reporter assay was conducted to investigate whether miR-122 directly targeted Maf1. 293a cells were transfected with Maf1-WT-3'UTR + NC as a negative control. Compared with the negative controls, co-transfection with miR-122 reduced the luciferase activity of Maf1-WT-3'UTR vector (control, 11.5±0.10; miR-122, 5.8±0.00; P<0.01; Fig. 3B). However, there was no significant alteration to the luciferase activity of Maf1-MUT-3'UTR vector following co-transfection with miR-122 mimics compared with co-transfection with miR-122 mimics negative control (control, 6.5±0.15; miR-122, 7.5±0.05; P>0.05; Fig. 3B).

Figure 3

Maf1 is a direct target of miR-122. (A) The sequence of miR-122/Maf1-WT-3'UTR/Maf1-MUT-3'UTR. Yellow represents the miR-122 and Maf1-WT-3'UTR function sites and the Maf1-MUT-3'UTR mutation sites. (B) Luciferase activity of 293A cells following transfection with miRNA and vector for 48 h. *P<0.05 vs. control. Ctrl, control; Maf1, repressor of RNA polymerase III transcription MAF1 homolog; miR, microRNA; WT, wild-type; UTR, untranslated region; MUT, mutant; NS, not significant.

miR-122 inhibits Maf1 expression

Subsequently, whether miR-122 inhibited Maf1 expression in vivo was investigated. The results demonstrated that compared with the sham group, the expression of Maf1 in the MCAO group was significantly reduced (sham, 1.00±0.04; MCAO, 0.21±0.04; P<0.01; n=6; Fig. 4A). Furthermore, RT-qPCR results suggested that the expression of Maf1 was significantly reduced after injection of miR-122 mimic in the lateral ventricle. By contrast, the expression of Maf1 increased significantly after the injection of miR-122 inhibitor in the lateral ventricle. The expression levels of miR-122 were as follows: 1.00±0.16, 3.98±0.26 and 0.10±0.04 (mimic vs. control and inhibitor vs. control, P<0.05; n=6; Fig. 4B). Maf1 expression levels were as follows: 1.00±0.03, 0.73±0.02 and 1.80±0.09 (mimic vs. control and inhibitor vs. control, P<0.05; n=6; Fig. 4C).

Figure 4

miR-122 inhibits the expression of Maf1. (A) Maf1 expression levels in the sham operation and MCAO groups. (B) miR-122 expression in the brain tissue after lateral ventricle injection of miR-122 NC, mimic or inhibitor. (C) Maf1 expression levels in the brain tissue following injection of miR-122 NC, mimic or inhibitor into the lateral ventricle. *P<0.05 vs. sham; #P<0.05 vs. control. miR, microRNA; Maf1, repressor of RNA polymerase III transcription MAF1 homolog; NC, negative control.

Discussion

It has been reported that there is a close relationship between miRNA and ischemic stroke (1,27,28), with the expression of ~20% miRNAs changing during the development and progression of ischemic stroke (29). By regulating the translation process of mRNA, miRNAs can affect protein expression, which subsequently alters biological functions such as axon regeneration, angiogenesis and inflammatory responses (30-33). Several studies have indicated that miR-122 can maintain the caliber and tube shape of blood vessels and reduce neuronal death in an ischemic stroke model (19,34). In addition, miR-122 may serve a pivotal immunomodulatory role in hepatocytes via miR-122-RTKs/STAT3-IRF1-IFNs regulatory circuitry or target TLR4 (35,36). Nerve cells, blood vessels and immunity are critical to the prognosis of infarct area in ischemic stroke (37,38). Therefore, the present study investigated the effect of miR-122 on the outcome of ischemic stroke. Compared with the level in the sham group, the expression of miR-122 increased significantly after MCAO. In addition, increased miR-122 expression effectively reduced the infarct area. By contrast, inhibition of miR-122 expression in brain tissue significantly increased the infarct area, which was consistent with previous studies (19,39). Therefore, the results indicated that miR-122 may exert a protective effect against ischemic stroke by reducing the infarct area.

miRNAs function by regulating the expression of downstream target genes (1); therefore, studying the downstream target genes of miR-122 during the development and progression of ischemic stroke may be important.

Previous studies have indicated that the Maf1 gene is associated with oxygen free radicals, such as H2O2, and the mTOR signaling pathway induced by ischemia (17-18,20). It has also been speculated that the Maf1 gene is associated with ischemic stroke-induced cell death, which further exacerbates brain damage (21-23). The present study demonstrated that the 3'UTR of Maf1 mRNA was a binding site for miR-122 using gene prediction software. Therefore, Maf1 was investigated as a target gene of miR-122. A dual-luciferase reporter assay was performed, which verified that miR-122 bound to the 3'UTR of Maf1. In addition, after MCAO, the expression of miR-122 was increased in comparison with that in a sham model, whereas the expression of Maf1 was reduced, indicating that miR-122 may be negatively associated with Maf1 expression. Therefore, it was hypothesized that the expression of Maf1 may be inhibited by miR-122 after MCAO. Increased miR-122 expression inhibited Maf1 expression and decreased miR-122 expression increased Maf1 expression in vivo. In summary, the present study indicated that miR-122 inhibited Maf1 expression after MCAO. The results of the present study may be beneficial in evaluating the relationship between Maf1 and ischemic stroke and also indicated that miR-122 may be able to improve the outcome of ischemic stroke by regulation of the Maf1 gene. However, the specific role and regulatory mechanism underlying Maf1 and miR-122 activity during the development of ischemic stroke are not completely understood and require further investigation. In contrast to other studies that used male mice, only female mice were used in the present study. Therefore, potential differences in findings in experiments using male mice cannot be ruled out. More studies with male mice may further clarify whether miR-122 promotes the outcome of acute ischemic stroke by reducing the expression of Maf1.

Acknowledgements

Not applicable.

Funding

Funding: The present study was funded by the Joint Foundation of Natural Science Foundation of Liaoning Province and Shenyang National Laboratory for Materials Science (grant no. 2019JH3/30100006), the National Natural Science Foundation of China (grant no. 21505013), the Liaoning BaiQianWan Talents Program [grant no. (2019)45] and Dalian Science and Technology Innovation Funds (grant no. 2018J13SN087).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

MW, YB and ML conceived and designed the study, and MW performed the majority of the experiments. MW, XL and YW constructed the MCAO model. YW, JC and JS cultured the cells. MW wrote the manuscript. All authors read and approved the manuscript and agree to be accountable for all aspects of the research.

Ethics approval and consent to participate

The present study was approved by the Animal Care Committee of the Xinhua Hospital affiliated to Dalian University and performed in accordance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Zhou J, Chen L, Chen B, Huang S, Zeng C, Wu H, Chen C and Long F: Increased serum exosomal miR-134 expression in the acute ischemic stroke patients. BMC Neurol. 18(198)2018.PubMed/NCBI View Article : Google Scholar

2 

Zheng M, Wang X, Yang J, Ma S, Wei Y and Liu S: Changes of complement and oxidative stress parameters in patients with acute cerebral infarction or cerebral hemorrhage and the clinical significance. Exp Ther Med. 19:703–709. 2020.PubMed/NCBI View Article : Google Scholar

3 

Catanese L, Tarsia J and Fisher M: Acute ischemic stroke therapy overview. Circ Res. 120:541–558. 2017.PubMed/NCBI View Article : Google Scholar

4 

Bai Y, Zhang Y, Han B, Yang L, Chen X, Huang R, Wu F, Chao J, Liu P, Hu G, et al: Circular RNA DLGAP4 ameliorates ischemic stroke outcomes by targeting miR-143 to regulate endothelial-mesenchymal transition associated with blood-brain barrier integrity. J Neurosci. 38:32–50. 2018.PubMed/NCBI View Article : Google Scholar

5 

Wang SW, Liu Z and Shi ZS: Non-Coding RNA in acute ischemic stroke: Mechanisms, biomarkers and therapeutic targets. Cell Transplant. 27:1763–1777. 2018.PubMed/NCBI View Article : Google Scholar

6 

Qi Z, Cai S, Cai J, Chen L, Yao Y, Chen L and Mao Y: miR-491 regulates glioma cells proliferation by targeting TRIM28 in vitro. BMC Neurol. 16(248)2016.PubMed/NCBI View Article : Google Scholar

7 

Qi R, Liu H and Liu C, Xu Y and Liu C: Expression and short-term prognostic value of miR-126 and miR-182 in patients with acute stroke. Exp Ther Med. 19:527–534. 2019.PubMed/NCBI View Article : Google Scholar

8 

Deng Y, Chen D, Gao F, Lv H, Zhang G, Sun X, Liu L, Mo D, Ma N, Song L, et al: Exosomes derived from microRNA-138-5p-overexpressing bone marrow-derived mesenchymal stem cells confer neuroprotection to astrocytes following ischemic stroke via inhibition of LCN2. J Biol Eng. 13(71)2019.PubMed/NCBI View Article : Google Scholar

9 

Stanzione R, Bianchi F, Cotugno M, Marchitti S, Forte M, Busceti C, Ryskalin L, Fornai F, Volpe M and Rubattu S: A decrease of brain MicroRNA-122 level is an early marker of cerebrovascular disease in the stroke-prone spontaneously hypertensive rat. Oxid Med Cell Longev. 2017(1206420)2017.PubMed/NCBI View Article : Google Scholar

10 

Li DB, Liu JL, Wang W, Luo XM, Zhou X, Li JP, Cao XL, Long XH, Chen JG and Qin C: Plasma exosomal miRNA-122-5p and miR-300-3p as potential markers for transient ischaemic attack in rats. Front Aging Neurosci. 10(24)2018.PubMed/NCBI View Article : Google Scholar

11 

Gu R, Wang L, Tang M, Li SR, Liu R and Hu X: LncRNA Rpph1 protects amyloid-β induced neuronal injury in SK-N-SH cells via miR-122/Wnt1 axis. Int J Neurosci. 130:443–453. 2020.PubMed/NCBI View Article : Google Scholar

12 

Smith KR, Oliver PL, Lumb MJ, Arancibia-Carcamo IL, Revilla-Sanchez R, Brandon NJ, Moss SJ and Kittler JT: Identification and characterisation of a Maf1/Macoco protein complex that interacts with GABAA receptors in neurons. Mol Cell Neurosci. 44:330–341. 2010.PubMed/NCBI View Article : Google Scholar

13 

Shetty M, Noguchi C, Wilson S, Martinez E, Shiozaki K, Sell C, Mell JC and Noguchi E: Maf1-dependent transcriptional regulation of tRNAs prevents genomic instability and is associated with extended lifespan. Aging Cell. 19(e13068)2020.PubMed/NCBI View Article : Google Scholar

14 

Yamada D, Kawabe K, Tosa I, Tsukamoto S, Nakazato R, Kou M, Fujikawa K, Nakamura S, Ono M, Oohashi T, et al: Inhibition of the glutamine transporter SNAT1 confers neuroprotection in mice by modulating the mTOR-autophagy system. Commun Biol. 2(346)2019.PubMed/NCBI View Article : Google Scholar

15 

Ma HX, Hou F, Chen AL, Li TT, Zhu YF and Zhao QP: Mu-Xiang-You-Fang protects PC12 cells against OGD/R-induced autophagy via the AMPK/mTOR signaling pathway. J Ethnopharmacol. 252(112583)2020.PubMed/NCBI View Article : Google Scholar

16 

Imai T, Iwata S, Miyo D, Nakamura S, Shimazawa M and Hara H: A novel free radical scavenger, NSP-116, ameliorated the brain injury in both ischemic and hemorrhagic stroke models. J Pharmacol Sci. 141:119–126. 2019.PubMed/NCBI View Article : Google Scholar

17 

Gunawardena D, Raju R and Münch G: Hydrogen peroxide mediates pro-inflammatory cell-to-cell signaling: A new therapeutic target for inflammation. Neural Regen Res. 14:1430–1437. 2019.PubMed/NCBI View Article : Google Scholar

18 

Sies H: Hydrogen peroxide as a central redox signaling molecule in physiological oxidative stress: Oxidative eustress. Redox Biol. 11:613–619. 2017.PubMed/NCBI View Article : Google Scholar

19 

Liu da Z, Jickling GC, Ander BP, Hull H, Zhan X, Cox C, Shroff N, Dykstra-Aiello C, Stamova B and Sharp FR: Elevating microRNA-122 in blood improves outcomes after temporary middle cerebral artery occlusion in rats. J Cereb Blood Flow Metab. 36:1374–1383. 2016.PubMed/NCBI View Article : Google Scholar

20 

Tsang CK, Chen M, Cheng X, Qi Y, Chen Y, Das I, Li X, Vallat B, Fu LW, Qian CN, et al: SOD1 phosphorylation by mTORC1 couples nutrient sensing and redox regulation. Mol Cell. 70:502–515. 2018.PubMed/NCBI View Article : Google Scholar

21 

Liu BW, Luo C, Zheng ZG, Xia ZY, Zhang Q, Ke C, Liu R and Zhao YH: Shengui sansheng san extraction is an angiogenic switch via regulations of AKT/mTOR, ERK1/2 and Notch1 signal pathways after ischemic stroke. Phytomedicine. 44:20–31. 2018.PubMed/NCBI View Article : Google Scholar

22 

Hou YY, Wang K, Wan WJ, Cheng Y, Pu X and Ye XF: Resveratrol provides neuroprotection by regulating the JAK2/STAT3/PI3K/AKT/mTOR pathway after stroke in rats. Genes Dis. 5:245–255. 2018.PubMed/NCBI View Article : Google Scholar

23 

Zhang SS, Li XX, Wang HY and Zheng XFS: Beyond regulation of pol III: Role of MAF1 in growth, metabolism, aging and cancer. Biochim Biophys Acta Gene Regul Mech. 1861:338–343. 2018.PubMed/NCBI View Article : Google Scholar

24 

National Research Council (US) Institute for Laboratory Animal Research: Guide for the Care and Use of Laboratory Animals. National Academies Press (US), Washington, DC, 1996.

25 

Llovera G, Roth S, Plesnila N, Veltkamp R and Liesz A: Modeling stroke in mice: Permanent coagulation of the distal middle cerebral artery. J Vis Exp. 31(e51729)2014.PubMed/NCBI View Article : Google Scholar

26 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

27 

Cheng X, Kan P, Ma Z, Wang Y, Song W, Huang C and Zhang B: Exploring the potential value of miR-148b-3p, miR-151b and miR-27b-3p as biomarkers in acute ischemic stroke. Biosci Rep. 38(BSR20181033)2018.PubMed/NCBI View Article : Google Scholar

28 

Si W, Ye S, Ren Z, Liu X, Wu Z, Li Y, Zhou J, Zhang S, Li Y, Deng R and Chen D: miR-335 promotes stress granule formation to inhibit apoptosis by targeting ROCK2 in acute ischemic stroke. Int J Mol Med. 43:1452–1466. 2019.PubMed/NCBI View Article : Google Scholar

29 

Liu W, Chen X and Zhang Y: Effects of microRNA-21 and microRNA-24 inhibitors on neuronal apoptosis in ischemic stroke. Am J Transl Res. 8:3179–3187. 2016.PubMed/NCBI

30 

Shi FP, Wang XH, Zhang HX, Shang MM, Liu XX, Sun HM and Song YP: MiR-103 regulates the angiogenesis of ischemic stroke rats by targeting vascular endothelial growth factor (VEGF). Iran J Basic Med Sci. 21:318–324. 2018.PubMed/NCBI View Article : Google Scholar

31 

Meng P, Zhu Q, Yang H, Liu D, Lin X, Liu J, Fan J, Liu X, Su W, Liu L, et al: Leonurine promotes neurite outgrowth and neurotrophic activity by modulating the GR/SGK1 signaling pathway in cultured PC12 cells. Neuroreport. 30:247–254. 2019.PubMed/NCBI View Article : Google Scholar

32 

Cheng J, Tang JC, Pan MX, Chen SF, Zhao D, Zhang Y, Liao HB, Zhuang Y, Lei RX, Wang S, et al: l-lysine confers neuroprotection by suppressing inflammatory response via microRNA-575/PTEN signaling after mouse intracerebral hemorrhage injury. Exp Neurol. 327(113214)2020.PubMed/NCBI View Article : Google Scholar

33 

Du K, Zhao C, Wang L, Wang Y, Zhang KZ, Shen XY, Sun HX, Gao W and Lu X: MiR-191 inhibit angiogenesis after acute ischemic stroke targeting VEZF1. Aging (Albany NY). 11:2762–2786. 2019.PubMed/NCBI View Article : Google Scholar

34 

Guo D, Ma J, Li T and Yan L: Up-regulation of miR-122 protects against neuronal cell death in ischemic stroke through the heat shock protein 70-dependent NF-κB pathway by targeting FOXO3. Exp Cell Res. 369:34–42. 2018.PubMed/NCBI View Article : Google Scholar

35 

Shi L, Zheng X, Fan Y, Yang X, Li A and Qian J: The contribution of miR-122 to the innate immunity by regulating toll-like receptor 4 in hepatoma cells. BMC Gastroenterol. 19(130)2019.PubMed/NCBI View Article : Google Scholar

36 

Xu H, Xu SJ, Xie SJ, Zhang Y, Yang JH, Zhang WQ, Zheng MN, Zhou H and Qu LH: MicroRNA-122 supports robust innate immunity in hepatocytes by targeting the RTKs/STAT3 signaling pathway. Elife. 8(e41159)2019.PubMed/NCBI View Article : Google Scholar

37 

Hatakeyama M, Ninomiya I and Kanazawa M: Angiogenesis and neuronal remodeling after ischemic stroke. Neural Regen Res. 15:16–19. 2020.PubMed/NCBI View Article : Google Scholar

38 

Jayaraj RL, Azimullah S, Beiram R, Jalal FY and Rosenberg GA: Neuroinflammation: Friend and foe for ischemic stroke. J Neuroinflammation. 16(142)2019.PubMed/NCBI View Article : Google Scholar

39 

Lv B, Cheng X, Sharp FR, Ander BP and Liu DZ: MicroRNA-122 mimic improves stroke outcomes and indirectly inhibits NOS2 after middle cerebral artery occlusion in rats. Front Neurosci. 12(767)2018.PubMed/NCBI View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang M, Liu X, Wu Y, Wang Y, Cui J, Sun J, Bai Y and Lang M: ΜicroRNA‑122 protects against ischemic stroke by targeting Maf1. Exp Ther Med 21: 616, 2021.
APA
Wang, M., Liu, X., Wu, Y., Wang, Y., Cui, J., Sun, J. ... Lang, M. (2021). ΜicroRNA‑122 protects against ischemic stroke by targeting Maf1. Experimental and Therapeutic Medicine, 21, 616. https://doi.org/10.3892/etm.2021.10048
MLA
Wang, M., Liu, X., Wu, Y., Wang, Y., Cui, J., Sun, J., Bai, Y., Lang, M."ΜicroRNA‑122 protects against ischemic stroke by targeting Maf1". Experimental and Therapeutic Medicine 21.6 (2021): 616.
Chicago
Wang, M., Liu, X., Wu, Y., Wang, Y., Cui, J., Sun, J., Bai, Y., Lang, M."ΜicroRNA‑122 protects against ischemic stroke by targeting Maf1". Experimental and Therapeutic Medicine 21, no. 6 (2021): 616. https://doi.org/10.3892/etm.2021.10048
Copy and paste a formatted citation
x
Spandidos Publications style
Wang M, Liu X, Wu Y, Wang Y, Cui J, Sun J, Bai Y and Lang M: ΜicroRNA‑122 protects against ischemic stroke by targeting Maf1. Exp Ther Med 21: 616, 2021.
APA
Wang, M., Liu, X., Wu, Y., Wang, Y., Cui, J., Sun, J. ... Lang, M. (2021). ΜicroRNA‑122 protects against ischemic stroke by targeting Maf1. Experimental and Therapeutic Medicine, 21, 616. https://doi.org/10.3892/etm.2021.10048
MLA
Wang, M., Liu, X., Wu, Y., Wang, Y., Cui, J., Sun, J., Bai, Y., Lang, M."ΜicroRNA‑122 protects against ischemic stroke by targeting Maf1". Experimental and Therapeutic Medicine 21.6 (2021): 616.
Chicago
Wang, M., Liu, X., Wu, Y., Wang, Y., Cui, J., Sun, J., Bai, Y., Lang, M."ΜicroRNA‑122 protects against ischemic stroke by targeting Maf1". Experimental and Therapeutic Medicine 21, no. 6 (2021): 616. https://doi.org/10.3892/etm.2021.10048
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team