Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
October-2021 Volume 22 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2021 Volume 22 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

lncRNA and mRNA sequencing of the left testis in experimental varicocele rats treated with Morinda officinalis polysaccharide

  • Authors:
    • Lihong Zhang
    • Xiaozhen Zhao
    • Wei Wang
  • View Affiliations / Copyright

    Affiliations: Department of Human Anatomy, Histology and Embryology, School of Basic Medical Sciences, Fujian Medical University, Fuzhou, Fujian 350108, P.R. China
    Copyright: © Zhang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 1136
    |
    Published online on: August 6, 2021
       https://doi.org/10.3892/etm.2021.10570
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Varicocele is a common disease of the male reproductive system. Morinda (M.) officinalis is a Chinese herbal medicine, whose main bioactive component M. officinalis polysaccharide (MOP) is believed to have a therapeutic effect on varicocele; however, the underlying molecular mechanisms of this effect are poorly understood. In the present study, 24 rats were randomly divided into three groups: i) Control group; ii) experimental varicocele group; and iii) 300 mg/kg MOP administration group. Analysis of mRNA and long non‑coding RNA (lncRNA) expression in rat left testicular tissue was performed. The results suggested that a total of 144 mRNAs and 63 lncRNAs, 63 mRNAs and 148 lncRNAs, and 173 mRNAs and 54 lncRNAs were differentially expressed between the varicocele non‑treatment and control groups, the varicocele treatment and varicocele non‑treatment groups, and the varicocele treatment and control groups, respectively. Following validation by reverse transcription‑quantitative PCR, the Yip1 domain family member 7 (YIPF7) gene was identified as a key mediator of varicocele pathogenesis and repair effect of MOP. Additionally, genes such as purinergic receptor P2X 4 (P2RX4), transmembrane protein 225B (TMEM255B) and Wnt family member 9B (WNT9B) were confirmed to be differentially expressed between the varicocele non‑treatment and control groups. We hypothesize that TMEM255B could be a potential novel diagnostic biomarker for varicocele; WNT9B and P2RX4 likely play notable roles in the pathophysiology of the disease through the Wnt signaling pathway and regulation of transmembrane ion channels, respectively. In summary, the present study delineated the molecular mechanisms underlying varicocele pathogenesis and the therapeutic effect of MOP, identified a potential novel diagnostic marker and therapeutic target for varicocele, and provided feasible directions for further studies in the future.

Introduction

Varicocele, an abnormal varix of the pampiniform plexus vein, is the most common cause of male infertility. The global incidence of varicocele is 15-20% in the general population and ~40% in patients who are infertile (1-4); this may have a negative impact on human evolution. For spermatogenesis to occur, the testis must descend into the scrotum during the embryonic period to provide proper the conditions of a temperature ~2˚C lower than the central body temperature (5). The upright human posture requires spermatic veins to work against gravity to return deoxygenated blood back to the heart (6). If the valves inside these veins fail, gravity can make the blood pool inside the testicle, eventually leading to enlargement of the veins and formation of a varicocele (7). In ~90% of cases, the disease occurs on the left side, due to the longer left testicular vein, hemodynamics and higher incidence of abnormal venous valves (8,9). Effective therapies for varicocele have yet to be determined (8,10-12). The experimental rat varicocele model, first established in 1981(13) by partly ligating the left renal vein, is widely used to investigate the pathophysiology, diagnosis and treatment of the disease. Researchers have shown that the following mechanisms contribute to the pathogenesis of varicocele: i) Neuroendocrine system dysfunction; ii) hypoxia; iii) accumulation of metabolites and toxicants; iv) oxidative stress; v) disruption of the blood-testis barrier (BTB); and vi) cell damage resulting from increased testicular temperature (14,15).

In China, Morinda officinalis F.C.How grows in the Guangdong, Guangxi and Fujiang provinces. The roots of M. officinalis are used in a Chinese herbal medicine known as Bajitian; it has a long history of use for the improvement of male sexual function and the treatment of male reproductive system defects in China (16). M. officinalis polysaccharide (MOP) is one of the main active components of M. officinalis. Our previous research found that MOP can repair varicocele-induced damage to the male rat reproductive system by promoting spermatogenesis, reconstructing the BTB, increasing the expression of tight junction (TJ) proteins and restoring hormonal balance, with 300 mg/kg being the most effective dosage (17). However, the molecular mechanisms underlying the pathophysiology of varicocele and the physiological functions and therapeutic effects of MOP in varicocele are yet to be explored in detail.

Advances in high-throughput RNA sequencing (RNA-Seq) technology and bioinformatics analysis methods have enabled researchers to gain insight into the nature of diseases at the RNA level by studying the dynamics of mRNA, microRNA and long non-coding RNA (lncRNA) (18) expression levels. According to previous research, lncRNAs, which are >200 nucleotides long and found in multiple organisms (19), play notable roles at almost every step of gene expression and take part in various disease processes (20); for example, in Parkinson's disease (21), leukemia (22), diabetes (23), cardiovascular disease (24), colon cancer (25,26), lung cancer (27) and prostate cancer (28). Due to their diverse bioactivities, lncRNAs are regarded as potential targets for the diagnosis and treatment of varicocele.

In the present study, rats with surgically induced varicocele were treated with either saline or 300 mg/kg MOP by gavage. Identification of differentially expressed (DE) mRNAs and lncRNAs in rat left testicular tissue was conducted by RNA-Seq, and the results were verified by reverse transcription-quantitative PCR (RT-qPCR). Bioinformatics resources, such as Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis and co-expression network analysis, were utilized to explore the mechanisms underlying varicocele pathophysiology and the therapeutic effect of MOP, in addition to the interactions between DE mRNAs and lncRNAs in varicocele. The aim of the current study was to identify novel targets and methods for varicocele diagnosis and therapy, and establish a theoretical basis for the use of MOP in clinical practice.

Materials and methods

Extraction of MOP

The plant M. officinalis used in the present study was grown (via artificial cultivation) in the Nanjing county of Fujian province in China. MOP was extracted from dried root according to a previously described protocol (17,29,30). In brief, after being ground, the dried root was boiled in ethyl alcohol to remove oligosaccharides and lipids, extracted using deionized water and precipitated with 60% alcohol; thereafter, Sevag reagent (Sinopharm Chemical Reagent Co., Ltd) was added to remove the protein.

Experimental design

Male, 6- to 7-week-old Sprague-Dawley rats, weighing 200±10 g, were purchased from and kept in The Laboratory Animal Center of Fujian Medical University (Fuzhou, China). All rats were housed in normal atmosphere (N2, 78%; O2, 21%; CO2, 0.03%) and specific pathogen-free controlled environmental conditions, with a temperature of ~23˚C, a 12-h day/night cycle, a humidity of 40-70% and free access to standard rat food and water. All procedures conformed to the Guidelines for the Care and Use of Laboratory Animals established by Fujian Medical University. The study was approved by The Animal Approval Committee of Fujian Medical University (approval no. SYXK-2012-0001).

A total of 24 rats were randomly divided into three equal groups: Control group, varicocele non-treatment group (VC) and varicocele treatment group (VC + MOP). Induction of varicocele was attempted by partial ligation of the left renal vein under anesthesia using 30 mg/kg sodium pentobarbital by intraperitoneal injection (31). Control rats underwent the same operation without the partial ligation, and were fed a conventional diet for 12 weeks. Subsequently, 8 weeks post-surgery, rats in the VC and VC+MOP groups were given a daily oral gavage of 2 ml normal saline or 300 mg/kg MOP, respectively, for 4 weeks; rats in the Control group were given nothing except conventional diet. The rats (weight, 500±25 g) were sacrificed by cervical dislocation after being anesthetized using 30 mg/kg sodium pentobarbital by intraperitoneal injection to collect left testicular tissue, which was immediately placed in liquid nitrogen. Varicocele rats in which vascular dilation did not occur or left kidney atrophy occurred were excluded from the follow-up experiment.

mRNA and lncRNA sequencing analysis

RNA-Seq analysis was performed by Kangchen BioTech Co., Ltd. The process used was divided into three parts: i) Extraction of total RNA from rat left testicular tissue; ii) construction of a cDNA library; and iii) RNA sequencing.

In brief, total RNAs were extracted using TRIzol® Reagent (Takara Bio Europe SAS) according to the manufacturer's instructions, followed by purification by Ribo-Zero™ Magnetic Gold Kit (Human/Mouse/Rat) (cat. no. MRZG12324; Epicentre, Illumina, Inc.). The quantity, integrity and concentration of the extracted RNAs were verified by 1% agarose gel electrophoresis and NanoDrop ND-1000 spectrophotometry (Thermo Fisher Scientific, Inc.). For library preparation, the KAPA Stranded RNA-Seq Library Prep kit (cat. no. KK8401; Illumina, Inc.) was used (paired-ended sequencing; 500 bp), with 1-2 µg of sample RNA. The established libraries were examined using an Agilent 2100 Bioanalyzer G2938C (Agilent Technologies, Inc.) and quantified by RT-qPCR. The samples were denatured to single-stranded DNA with 0.1 M NaOH (final density, 8 pM; concentrations measured by RT-qPCR) and amplified using TruSeqSR Cluster Kit v3-cBot-HS (cat. no. GD-401-3001; Illumina, Inc.). The libraries were pooled and sequenced on the Illumina HiSeq 4000 system (Illumina, Inc.) using 150 cycles of paired-end sequencing.

The quality of the raw sequencing data was assessed using FastQC software v0.11.7 (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/), before the adapter sequences and poor quality bases were trimmed from the reads using the Cutadapt software v1.17 (http://dx.doi.org/10.14806/ej.17.1.200) (32). The Hisat2 software v2.0.4 (http://ccb.jhu.edu/software/hisat2) and StringTie software v1.2.2 (http://ccb.jhu.edu/software/stringtie) (33) were used to calculate fragments per kilobase of transcript per million mapped reads (FPKM) values, which represented the final expression levels of the genes. Differential gene expression level analyses were performed using the Ballgown package in R v2.10.0 (https://www.r-project.org) (32). An average FPKM value >0.5 was chosen as the cut-off for gene expression in the samples.

RT-qPCR

To confirm the results of RNA-Seq, specific DE patterns were validated by RT-qPCR, with three biological replicates for each group. TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) was used to extract the total RNAs from rat testicular tissue, according to the manufacturer's instructions. cDNA was synthesized using 3 µg total RNAs, SuperScript III reverse transcriptase (Invitrogen; Thermo Fisher Scientific, Inc.), 5X reverse transcription buffer solution (Invitrogen; Thermo Fisher Scientific, Inc.), 2.5 mM dNTPs (HyTest, Ltd), primers (Invitrogen; Thermo Fisher Scientific, Inc.), and the GeneAmp PCR 9700 System (50˚C for 60 min, 70˚C for 15 min and stored at 4˚C for infinite time; Applied Biosystems; Thermo Fisher Scientific, Inc.). The RT-qPCR analysis was performed using the SYBR®-Green Real-time PCR Master mix (Arraystar, Inc.) and ViiA™ 7 Real-time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.), with three technical replicates set for each sample. The thermocycling conditions were as follows: 95˚C for 10 min; 95˚C for 10 sec, then 60˚C for 1 min (40 cycles); 95˚C for 10 sec; 60˚C for 1 min; and 95˚C for 15 sec. The primers were designed and purchased from Kangchen BioTech Co., Ltd. The primer sequences are shown in Table I. The relative expression of each gene was quantified by comparing its Cq value (2-ΔΔCq method) with that of the housekeeping gene, β-actin (34).

Table I

Quantitative PCR primer sequences.

Table I

Quantitative PCR primer sequences.

GenePrimer sequence, 5'-3'
YIPF7 
     Forward ATAATGATTCTAATGCTTACGGA
     Reverse ACAAGAACATCTCTGGTGGAAC
WNT9B 
     Forward GTGTGTGGTGACAACCTGAAGTA
     Reverse TGACACGCCATGACACTTGC
     TMEM255B 
     Forward GCTTGTGCCCTCCGTCTATGA
     Reverse AGGGCTGTAGTGGCAGAGGGT
P2RX4 
     Forward ATATTCCGTCTTGGCACAATC
     Reverse CTCTATCCAGGTTGCAGTCCC
GPR162 
     Forward F:TTGCCGTGGAAACCTTGGTG
     Reverse R:CCTAAGCCCATTTCTCCTGCC
CLSTN2 
     Forward TCAAAGAACCAGCCTACAAAG
     Reverse AAGCAGTTACCAGGATCTCATAC
AKR1B8 
     Forward CAGTTGAGCGACCAGGAGATG
     Reverse CTGCGTCATAGGGAAACTCTT
NILR1 
     Forward CCAGGAGGAAAGCGTTTATGC
     Reverse GGGTTTTACTTGGGCGTATGTCT
AABR07007833.1 
     Forward GTGTTCACTACCTCATTCCGTC
     Reverse TCCTGCTCCTCTTGGTTCTTA
AABR07014649.1 
     Forward TGATGAGAAGACTATGAAGAATGC
     Reverse AAGTTTGGTTTGAATGCTGC
AABR07050146.1 
     Forward CTGAGGCAAAGGGACTCTGTA
     Reverse CTTTGTTGGAGGGACAGCTC
AABR07058711.1 
     Forward TGCTCCATAAGTATCGAAGGC
     Reverse CAGATATTAGCCACAAACCTCA
AABR07069067.1 
     Forward GCAGCTTCTTGACATCACATT
     ReverseA TAGGCATTCCTTAGAGCATTT
AC125688.1 
     Forward CTATTCATAGCACCTCTGTGCTG
     Reverse CGTGGAGTTCTCTGATCTTTGTA
AABR07004428.1 
     Forward CACCCACGGAGATCCCACT
     Reverse GAGCCTTCCCTGTAGCTGGTT
β-ACTIN 
     Forward CGAGTACAACCTTCTTGCAGC
     Reverse ACCCATACCCACCATCACAC

[i] AKR1B8, Aldo-keto reductase family 1, member B8; CLSTN2, calsyntenin 2; GPR162, G protein-coupled receptor 162; NILR1, leukocyte immunoglobulin like receptor B2; P2RX4, purinergic receptor P2X 4; TMEM255B, transmembrane protein 225B; WNT9B, Wnt family member 9B; YIPF7, Yip1 domain family member 7.

Statistical analyses

RNA-Seq and RT-qPCR were performed in three independent biological replicates for each group. Only genes with an absolute fold-change >1.2 and P-value ≤0.05 were considered to be differentially expressed between the groups. The data were analyzed in SPSS v21.0 (IBM Corp.), and the results are presented as the mean ± standard deviation. Pearson's correlation was used in scatter plot of DE genes. One-way ANOVA was used to compare gene expression levels between two groups, and P≤0.05 was considered to indicate a statistically significant difference.

Bioinformatic analyses

GO classification and KEGG pathway enrichment analyses were performed using the website of Gene Ontology Resource (http://www.geneontology.org) and KEGG pathway database (https://www.kegg.jp/kegg/pathway.html) respectively. The co-expression of DE mRNA (coding genes) and lncRNA (non-coding genes) networks were visualized using Cytoscape v2.8.3 (http://cytoscape.org). The present study data were uploaded to the Gene Expression Omnibus (GEO) website (https://www.ncbi.nlm.nih.gov/geo/; accession no. GSE139447; secure token: sfaxocskhpoxnix).

Results

Identification of DE mRNAs and lncRNAs

The present study data were uploaded to the Gene Expression Omnibus website. The top 10 upregulated and downregulated DE genes (including mRNAs and lncRNAs) are listed in Tables II and III, respectively. Hierarchical cluster (Fig. 1), scatter plot (Fig. 2) and volcano plot (Fig. 3) analyses of the DE genes are presented. Overall, there were 144 DE mRNAs and 63 DE lncRNAs in the VC group vs. the Control group, 63 DE mRNAs and 148 DE lncRNAs in the VC + MOP group vs. the VC group and 173 DE mRNAs and 54 DE lncRNAs in the VC + MOP group vs. the Control group. The most significantly upregulated DE genes in VC group vs. the Control group, VC + MOP group vs. the VC group, and VC + MOP group vs. the Control group were TMEM255B, actin g 2 smooth muscle and calsyntenin 2, respectively. The most significantly downregulated DE genes in VC group vs. the Control group, VC + MOP group vs. the VC group, and VC + MOP group vs. the Control group were AABR07050146.1, YIPF7 and ATP-dependent helicase ATRX chromatin remodeler, respectively.

Figure 1

Hierarchical cluster analysis of differentially expressed genes between test groups. (A) VC and control, (B) VC + MOP and VC, and (C) VC + MOP and control groups. Each row represents one gene, each column represents one sample; the red and green strips represent the upregulated and downregulated differentially expressed genes, respectively. The genes with fold-change >1.2 and P≤0.05 were selected as the differentially expressed genes. VC, varicocele; MOP, Morinda officinalis polysaccharide.

Figure 2

Scatter plots showing upregulated and downregulated differentially expressed genes. (A) VC and control, (B) VC + MOP and VC, and (C) VC + MOP and control groups. The x-axis and y-axis represent the average log2 (FPKM) of genes in compared groups, dotted line defines the fold-change >1.2. The red and green plots represent upregulated and downregulated differentially expressed genes, respectively; the gray plots represent the genes with no significant difference. VC, varicocele; MOP, Morinda officinalis polysaccharide.

Figure 3

Volcano plots of differentially expressed genes. (A) VC and control, (B) VC + MOP and VC and (C) VC + MOP and control groups. The X-axis and the Y-axis represent the log2 (fold-change) and -log10 (P-value), respectively; two vertical dotted lines define the fold-change >1.2, one horizontal dotted line defines the P≤0.05. The red and green plots represent upregulated and downregulated differentially expressed genes, respectively; the gray plots represent the genes with no significant difference. The genes with fold-change >1.2 and P≤0.05 were selected as the differentially expressed genes. VC, varicocele; MOP, Morinda officinalis polysaccharide.

Table II

Top 10 upregulated differentially expressed genes between groups by RNA-sequencing analysis.

Table II

Top 10 upregulated differentially expressed genes between groups by RNA-sequencing analysis.

A, VC vs. Control
Tract IDGene nameGene typeFold-changeP-value
ENSRNOG00000026336 TMEM255BProtein-coding7.72 6.9x10-4
ENSRNOG00000006494TUBG2Protein coding2.68 7.4x10-3
ENSRNOG00000054954NILR1Protein coding2.33 3.2x10-2
ENSRNOG00000026497PIGCProtein coding2.26 7.5x10-4
ENSRNOG00000051890 LOC102549170lincRNA2.09 1.7x10-2
ENSRNOG00000016143GPR162Protein coding1.91 1.1x10-3
ENSRNOG00000053415 AABR07014649.1lincRNA1.74 1.2x10-2
ENSRNOG00000058993 AABR07062183.1Protein coding1.70 9.7x10-3
ENSRNOG00000002207GUF1Protein coding1.69 3.7x10-2
ENSRNOG00000052173RANBP3LProtein coding1.61 1.4x10-3
B, VC + MOP vs. VC
Tract IDGene nameGene typeFold-changeP-value
ENSRNOG00000029401ACTG2Protein coding3.04 3.0x10-2
ENSRNOG00000017669CHD1LProtein coding2.30 1.3x10-2
ENSRNOG00000061865 AABR07019334.1lincRNA2.05 5.3x10-3
ENSRNOG00000060166 AABR07069067.1lincRNA1.76 3.1x10-2
ENSRNOG00000059729 AC116236.2lincRNA1.63 1.2x10-2
ENSRNOG00000007335CCL11Protein coding1.58 3.2x10-2
ENSRNOG00000057837 AABR07017236.1Protein coding1.57 8.9x10-3
ENSRNOG00000057135 AABR07070714.2lincRNA1.56 4.4x10-2
ENSRNOG00000042665 AABR07007130.2Protein coding1.56 2.8x10-2
ENSRNOG00000052005 AABR07028945.1lincRNA1.55 1.6x10-2
C, VC + MOP vs. Control
Tract IDGene nameGene typeFold-changeP-value
ENSRNOG00000043085CLSTN2Protein coding2.11 2.4x10-2
ENSRNOG00000023861SNAP91Protein coding2.08 2.9x10-2
ENSRNOG00000059602 AABR07072984.1lincRNA1.73 4.5x10-2
ENSRNOG00000059504 AABR07015078.2Protein coding1.67 2.9x10-2
ENSRNOG00000052211 AABR07058167.1lincRNA1.65 6.2x10-3
ENSRNOG00000052668TCF24Protein coding1.63 3.9x10-2
ENSRNOG00000057070 AABR07014350.1lincRNA1.63 5.4x10-3
ENSRNOG00000034129 AABR07061382.1Protein coding1.51 4.5x10-2
ENSRNOG00000023035SMIM8Protein coding1.50 6.3x10-3
ENSRNOG00000011969DOCK9Protein coding1.48 1.2x10-4

[i] lincRNA, long intragenic non-coding RNA; VC, varicocele; MOP, Morinda officinalis polysaccharide; TMEM255B, transmembrane protein 225B; TUBG2, tubulin γ-2 chain; NILR1, leukocyte immunoglobulin-like receptor B2; PIGC, phosphatidylinositol glycan anchor biosynthesis class C; GPR162, G protein-coupled receptor 162; GUF1, GUF1 homolog, GTPase; RANBP3L, RAN binding protein 3-like; ACTG2, Actin, g smooth muscle; CHD1L, chromodomain-helicase-DNA-binding protein 1-like; CCL11, C-C motif chemokine 11; CLSTN2, calsyntenin 2; SNAP91, Clathrin coat assembly protein AP180; TCF24, transcription Factor 24; SMIM8, small integral membrane protein 8.

Table III

Total of 10 downregulated differentially expressed genes between groups by RNA-sequencing analysis.

Table III

Total of 10 downregulated differentially expressed genes between groups by RNA-sequencing analysis.

A, VC vs. Control
Tract IDGene nameGene typeFold-changeP-value
ENSRNOG00000054630 AABR07050146.1lincRNA0.48 4.8x10-2
ENSRNOG00000004517IGF1Protein coding0.49 1.8x10-3
ENSRNOG00000061865 AABR07019334.1lincRNA0.55 2.5x10-2
ENSRNOG00000001300P2RX4Protein coding0.58 2.4x10-2
ENSRNOG00000053160 AABR07071659.2lincRNA0.58 3.4x10-2
ENSRNOG00000009734AKR1B10Protein coding0.60 9.2x10-3
ENSRNOG00000060166 AABR07069067.1lincRNA0.62 9.9x10-3
ENSRNOG00000020945MS4A1Protein coding0.63 3.7x10-2
ENSRNOG00000060865 AABR07013167.1lincRNA0.64 4.4x10-2
ENSRNOG00000056171 AC107505.1lincRNA0.64 5.0x10-2
B, VC + MOP vs. VC
Tract IDGene nameGene typeFold-changeP-value
ENSRNOG00000002224YIPF7Protein coding0.47 1.9x10-2
ENSRNOG00000002207GUF1Protein coding0.48 1.9x10-2
ENSRNOG00000026976VOM2R57Protein coding0.52 4.0x10-3
ENSRNOG00000058242EPS8L3Protein coding0.59 1.8x10-2
ENSRNOG00000048209EPS8L3Protein coding0.60 3.0x10-2
ENSRNOG00000059026 AABR07055885.1lincRNA0.62 2.8x10-2
ENSRNOG00000027142OOG1Protein coding0.63 6.5x10-3
ENSRNOG00000003409 NEWGENE_1565644Protein coding0.64 4.9x10-2
ENSRNOG00000021010ARL2Protein coding0.68 3.5x10-2
ENSRNOG00000054516 AABR07056680.1lincRNA0.68 4.6x10-2
C, VC + MOP vs. Control
Tract IDGene nameGene typeFold-changeP-value
ENSRNOG00000046897ATRXProtein coding0.41 4.0x10-3
ENSRNOG00000008074CYP11A1Protein coding0.44 3.2x10-2
ENSRNOG00000053160 AABR07071659.2lincRNA0.46 1.1x10-2
ENSRNOG00000004517IGF1Protein coding0.47 9.5x10-4
ENSRNOG00000002079MAPK10Protein coding0.51 3.7x10-2
ENSRNOG00000060545 AC125688.1lincRNA0.52 8.0x10-4
ENSRNOG00000036641 LOC689065protein coding0.53 2.6x10-2
ENSRNOG00000061906 AABR07024261.1protein coding0.54 2.0x10-2
ENSRNOG00000057691 AC112557.1lincRNA0.58 7.7x10-4
ENSRNOG00000009734AKR1B10protein coding0.58 1.1x10-2

[i] lincRNA, long intragenic non-coding RNA; VC, varicocele; MOP, Morinda officinalis polysaccharide; IGF1, insulin-like growth factor; P2RX4, purinergic receptor P2X 4; MS4A1, membrane-spanning 4A1; YIPF7, Yip1 domain family member 7; GUF1, GUF1 homolog, GTPase; EPS8L3, epidermal growth factor receptor kinase substrate 8-like protein 3; OOG1, oogenesin 1; ARL2, ADP-ribosylation factor-like protein 2; ATRX, ATP-dependent helicase ATRX; CYP11A1, cholesterol side-chain cleavage enzyme.

GO and KEGG analyses of DE genes

To elucidate the functions of the DE genes, GO term enrichment and KEGG pathway analyses were performed. The GO functional annotations were classified into three categories: Molecular function, cellular components and biological processes. The top 10 enriched GO terms of DE genes, both upregulated and downregulated (Figs. 4 and 5) and the top 10 enriched KEGG pathways of DE genes, both upregulated and downregulated, (Fig. 6) are shown.

Figure 4

GO analysis of the top 10 DE genes between different groups, as ranked by their enrichment score. Top 10 (A) BP, (B) CC and (C) MF terms between the VC and control groups. Top 10 (D) BP, (E) CC and (F) MF terms between the VC + MOP and VC groups. Top 10 (G) BP, (H) CC and (I) MF terms between the VC + MOP and control groups. DE genes with fold-change >1.2 and P≤0.05 were used. BP, biological process; CC, cellular component; MF, molecular function; GO, Gene Ontology; DE, differentially expressed; Sig, significant; VC, varicocele; MOP, Morinda officinalis polysaccharide.

Figure 5

GO analysis of the top 10 DE genes between different groups, as ranked by fold-enrichment. Top 10 (A) BP, (B) CC and (C) MF between the VC and control groups. Top 10 (D) BP, (E) CC and (F) MF terms between the VC + MOP and VC groups. Top 10 (G) BP, (H) CC and (I) MF terms, respectively, between the VC + MOP and control groups. DE genes with fold-change >1.2 and P≤0.05 were used. BP, biological process; CC, cellular component; MF, molecular function; GO, Gene Ontology; DE, differentially expressed; Sig, significant; VC, varicocele; MOP, Morinda officinalis polysaccharide.

Figure 6

Kyoto Encyclopedia of Genes and Genomes analysis of pathways corresponding to the top 10 differentially expressed genes between groups. (A) VC and control groups, (B) the VC + MOP and VC groups, and (C) the VC + MOP and control groups. Differentially expressed genes with fold-change >1.2 and P≤0.05 were used. VC, varicocele; MOP, Morinda officinalis polysaccharide; DE, differentially expressed; Sig, significant.

Co-expression network of the chosen DE mRNAs and lncRNAs

Correlation coefficients of selected DE mRNAs (protein-coding genes) and lncRNAs (non-protein-coding genes) were calculated to build a co-expression network (Pearson correlation coefficient ≥0.8; P≤0.05; false discovery rate, ≤1; Fig. 7). These DE mRNAs and lncRNAs presented in Fig. 7 were selected according to their function based on the GO term enrichment result, but not the total DE genes. The enriched DE genes were selected based on the GO terms the present study were interested in, such as the ‘response to steroid hormone’, ‘oxidation-reduction process’, ‘positive regulation of MAPK cascade’ and ‘DNA repair’ terms.

Figure 7

Co-expression network of chosen differentially expressed mRNAs and lncRNAs between different groups. (A) VC and control groups, (B) the VC + MOP and VC groups, and (C) the VC + MOP and control groups. Red and blue labels denote lncRNAs (non-protein-coding genes) and mRNAs (protein-coding genes), respectively. Solid lines and dotted lines represent positive and negative associations, respectively. lncRNAs, long non-coding RNA; VC, varicocele; MOP, Morinda officinalis polysaccharide.

Validation of DE mRNAs and lncRNAs through RT-qPCR

The DE mRNAs and lncRNAs identified by RNA-Seq were validated using RT-qPCR. The results are presented in Table IV and Fig. 8. There were six DE mRNAs and four DE lncRNAs in the VC group vs. the Control group, one DE mRNA and four DE lncRNAs in the VC + MOP group vs. the VC group and four DE mRNAs and two DE lncRNAs in the VC + MOP group vs. the Control group. Varicocele and MOP treatment appeared to have opposing effects on the expression levels of YIPF7, AABR07007833.1, AABR07014649.1 and AABR07069067.1. To be specific, the varicocele increased the expression levels of YIPF7, AABR07007833.1 and AABR07014649.1, and decreased the expression level of AABR07069067.1, while MOP treatment reversed these changes.

Figure 8

Expression levels of DE genes assessed by reverse transcription-quantitative PCR. (A) DE genes between the VC and control groups. (B) DE genes between the VC + MOP and VC groups. (C) DE genes between the VC + MOP and control groups. *P≤0.05 vs. respective control groups. All data are presented as mean ± SD, bars indicate SD and are shown in red, n=3. VC, varicocele; MOP, Morinda officinalis polysaccharide; DE, differentially expressed; AKR1B8, Aldo-keto reductase family 1, member B8; CLSTN2, calsyntenin 2; GPR162, G protein-coupled receptor 162; NILR1, leukocyte immunoglobulin like receptor B2; P2RX4, purinergic receptor P2X 4; TMEM255B, transmembrane protein 225B; WNT9B, Wnt family member 9B; YIPF7, Yip1 domain family member 7.

Table IV

Expression of differentially expressed genes by reverse transcription-quantitative PCR.

Table IV

Expression of differentially expressed genes by reverse transcription-quantitative PCR.

A, VC vs. Control
Gene nameGene typeMean fold-change ± SDP-value
AKR1B8Protein coding 0.47±1.1x10-20.024
NILR1Protein coding 2.98±6.2x10-40.044
P2RX4Protein coding 0.48±4.1x10-20.041
TMEM255BProtein coding 63.34±1.4x10-20.044
WNT9BProtein coding 0.61±1.0x10-30.026
YIPF7Protein coding 2.43±6.3x10-30.031
AABR07007833.1lincRNA 1.51±2.6x10-50.033
AABR07014649.1lincRNA 1.42±1.5x10-30.025
AABR07050146.1lincRNA 0.81±5.1x10-50.035
AABR07069067.1lincRNA 0.47±6.5x10-40.014
B, VC + MOP vs. VC
Gene nameGene typeMean fold-change ± SDP-value
YIPF7Protein coding 0.31±7.3x10-30.025
AABR07007833.1lincRNA 0.44±3.9x10-50.0092
AABR07014649.1lincRNA 0.77±1.0x10-30.0011
AABR07069067.1lincRNA 2.27±7.3x10-40.0047
AABR07004428.1lincRNA 0.52±1.4x10-30.049
C, VC + MOP vs. Control
Gene nameGene typeMean fold-change ± SDP-value
AKR1B8Protein coding 0.50±9.4x10-30.0072
CLSTN2Protein coding 7.82±1.5x10-30.023
GPR162Protein coding 1.49±2.0x10-40.038
WNT9BProtein coding 0.58±1.1x10-30.030
AC125688.1lincRNA 0.54±3.0x10-20.0022
AABR07058711.1lincRNA 1.22±2.2x10-40.040

[i] lincRNA, long intragenic non-coding RNA; VC, varicocele; MOP, Morinda officinalis polysaccharide; AKR1B8, Aldo-keto reductase family 1, member B8; CLSTN2, calsyntenin 2; GPR162, G protein-coupled receptor 162; NILR1, leukocyte immunoglobulin like receptor B2; P2RX4, purinergic receptor P2X 4; TMEM255B, transmembrane protein 225B; WNT9B, Wnt family member 9B; YIPF7, Yip1 domain family member 7.

Discussion

In our previous study, varicocele induced reproductive dysfunction in male rats via mechanisms such as destruction of the seminiferous epithelium and TJ structure, downregulation of TJ proteins (occludin, claudin-11 and zona occludens protein 1), deregulation of hormone levels and an increase in cytokine (TGF-β3 and TNF-α) levels. MOP repaired varicocele-induced damage and promoted spermatogenesis (the most effective dose was found to be 300 mg/kg) (17). However, the molecular mechanisms underlying the pathophysiology of varicocele and the therapeutic effect of MOP are still unknown. In the present study, mRNA and lncRNA sequencing analyses, combined with validation of DE genes through RT-qPCR, were performed to bridge these data gaps.

According to GO results, the pathophysiology of varicocele may be associated with ‘epidermal growth factor receptor binding’, ‘ligand-gated calcium channel activity’, ‘growth factor receptor binding’, ‘histone kinase activity’ and ‘microtubule motor activity’. Notably, numerous DE genes between the VC and control groups were enriched in cancer-related pathways, such as the ‘p53 signaling pathway’, which is downregulated in breast cancer and melanoma; this warrants further research and validation.

According to the KEGG pathway analysis, ‘cytokine-cytokine receptor interaction’, ‘Wnt signaling pathway’ and ‘p53 signaling pathway’ were all implicated in the varicocele-therapeutic effect of MOP. In our previous study, the levels of TGF-β3 and TNF-α were upregulated in experimental rat left testicular tissue and downregulated following MOP treatment, potentially through the cytokine-cytokine receptor interaction pathway (17). The Wnt signaling pathway plays a notable role in the normal physiology and pathology of the male reproductive system. The Wnt/β-catenin pathway is involved in the annexin 5-mediated stimulation of testosterone synthesis (35), and its dysregulation is linked to the development of granulosa cell tumors in the testis (36). Additionally, the activation of Wnt/β-catenin signaling in Sertoli cells results in germ cell loss and seminiferous tubule degeneration (37). Moreover, the Wnt/β-catenin signaling pathway facilitates the proliferation of spermatogonial stem cells in the testis (38). Thus, proper regulation of Wnt/β-catenin signaling is necessary for adult spermatogenesis, and its disruption may result in infertility (39). The results of the present study provide compelling evidence for the involvement of Wnt/β-catenin signaling in varicocele progression and the therapeutic effect of MOP in varicocele; this evidence is worthy of further research.

The RT-qPCR analysis revealed that one coding gene, YIPF7, and three non-coding genes, AABR07007833.1, AABR07014649.1 and AABR07069067.1, were DE between the VC and Control groups, and between the VC + MOP and VC groups. Varicocele and MOP treatment appeared to have opposing effects on the expression of these genes, implying that these genes may play a role in varicocele pathophysiology and the repair effect of MOP. Specifically, varicocele increased the expression levels of YIPF7, AABR07007833.1 and AABR07014649.1, and decreased the expression level of AABR07069067.1, while MOP treatment reversed these effects. The YIP1 family of proteins are involved in protein transport between the endoplasmic reticulum and Golgi apparatus (40), as well as the regulation of membrane dynamics (41). Decreasing the expression of YIPF7 enhances the intestinal inflammatory response and upregulates the TNF mRNA level (42). The change in YIPF7 expression may be associated with the testicular inflammatory response and the fluctuation of the TNF-α expression level induced by varicocele and MOP. This finding is in accordance with the results of our previous study; thus, we hypothesize that YIPF7 is involved in the process of varicocele development by increasing the TNF-α level in the left testicular tissue, which MOP treatment is able to decrease (17). Due to the lack of extensive research on lncRNA, the functions of AABR07007833.1, AABR07014649.1 and AABR07069067.1 remain elusive. In the present study, according to the co-expression network analysis, these non-coding genes were positively associated with phosphatidylinositol glycan anchor biosynthesis class C insulin-like growth factor 1 (IGF1), P2RX4, TMEM255B and WNT9B, as well as others.

Aldo-keto reductase family 1, member B8 (AKR1B8), leukocyte immunoglobulin-like receptor B2 (NILR1), P2RX4, TMEM255B and WNT9B were also DE between the VC and control groups. TMEM255B, also known as FAM70B, encodes the transmembrane protein 255b, which has been proposed as a prognostic marker for muscle-invasive bladder cancer (43). The expression level of TMEM255B in the VC group was ~63-fold higher compared with that of the control group. Such a large difference in expression levels suggests that TMEM255B could be used as a novel diagnostic maker for varicocele; however, further clinical research is required to confirm this hypothesis. WNT9B takes part in the Wnt/β-catenin signaling pathway, described as aforementioned. P2RX4, also known as P2X4 or P2X4R, encodes the ATP-gated P2RX4 ion channel. According to a previous study, extracellular ATP is a danger molecule for peritubular cells and aggravates inflammatory responses in the testis (44). P2RX4 is involved in pain processing (45-47), and its downregulation has been shown to moderate allergen-induced airway inflammation (48). Although the function of P2RX4 in the male reproductive system is unclear, according to its diverse biological activities under physiological and pathological conditions (44-49), it is hypothesized that changes in P2RX4 expression levels are involved in varicocele pathogenesis via the stimulation of inflammatory responses and disruption of transmembrane ion channel function.

In the present study, RNA sequencing and RT-qPCR were performed on rat testicular tissue to reveal the molecular mechanisms underlying varicocele pathophysiology and the restorative effect of MOP on varicocele-induced damage in male reproductive systems. The results of GO and KEGG pathway enrichment analyses showed that ‘ligand-gated calcium channel activity’, ‘cytokine-cytokine receptor interaction’ and the ‘Wnt signaling pathway’ may all be implicated to underlie this effect. RT-qPCR confirmed that YIPF7 is upregulated in varicocele and downregulated by MOP. Based on its diverse biological activities and intimate connection to TNF-α, YIPF7 is considered a key mediator of varicocele pathogenesis and therapeutic effects of MOP. Furthermore, differential expression of AKR1B8, NILR1, P2RX4, TMEM255B and WNT9B was detected between the VC group and the control group. TMEM255B may be a potential novel diagnostic marker for varicocele; the role of WNT9B and P2RX4 in varicocele is possibly mediated by the activation of Wnt signaling and the regulation of transmembrane ion channels and the inflammatory response, respectively.

In summary, the present study provides a foundation for understanding the molecular basis of varicocele pathophysiology and the varicocele-therapeutic effect of MOP, offers insights into novel strategies for varicocele diagnosis and treatment, and suggests directions for further study.

Acknowledgements

Not applicable.

Funding

Funding: The present study was supported by The Training Program Foundation for the Talents of Health and Family Planning Commission in Fujian Province (grant no. 2018-1-74), The Start-up Foundation of Fujian Medical University (grant no. 2017XQ1005), The Research Foundation for High-Level Talents of Fujian Medical University (grant. no. XRCZX2017033), The Natural Science Foundation of Fujian Province (grant no. 2017J01819) and The Co-construction Science Foundation of National Health and Family Planning Commission-Joint Program for Tackling Key Problems of Health and Education in Fujian Province (grant no. WKJ2016-2-35).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding authors upon reasonable request. The datasets generated and analyzed during the current study are available in the Gene Expression Omnibus repository, https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi (accession no. GSE139447; secure token: sfaxocskhpoxnix).

Authors' contributions

LZ performed the experiments and the statistical analysis, and drafted the manuscript. WW and XZ conceived the study and participated in its design and coordination. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The study was approved by The Animal Approval Committee of Fujian Medical University (approval no. SYXK-2012-0001).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Leslie SW, Sajjad H and Siref LE: Varicocele. In: StatPearls. StatPearls Publishing, Treasure Island, FL, 2021.

2 

Wang NN, Dallas K, Li S, Baker L and Eisenberg ML: The association between varicocoeles and vascular disease: An analysis of U.S. Claims data. Andrology. 6:99–103. 2018.PubMed/NCBI View Article : Google Scholar

3 

Reesink DJ, Huisman PM, Wiltink J, Kruger AE and Lock TMT: Sneeze and pop: A ruptured varicocele; analysis of literature, guided by a well-documented case-report. BMC Urol. 19(14)2019.PubMed/NCBI View Article : Google Scholar

4 

Sigalos JT and Pastuszak AW: Chronic orchialgia: Epidemiology, diagnosis and evaluation. Transl Androl Urol. 6 (Suppl 1):S37–S43. 2017.PubMed/NCBI View Article : Google Scholar

5 

Afshar A, Aliaghaei A, Nazarian H, Abbaszadeh HA, Naserzadeh P, Fathabadi FF, Abdi S, Raee P, Aghajanpour F, Norouzian M and Abdollahifar MA: Curcumin-loaded iron particle improvement of spermatogenesis in azoospermic mouse induced by long-term scrotal hyperthermia. Reprod Sci. 28:371–380. 2021.PubMed/NCBI View Article : Google Scholar

6 

Jarow JP: Effects of varicocele on male fertility. Hum Reprod Update. 7:59–64. 2001.PubMed/NCBI View Article : Google Scholar

7 

Mehta A and Goldstein M: Microsurgical varicocelectomy: A review. Asian J Androl. 15:56–60. 2013.PubMed/NCBI View Article : Google Scholar

8 

Ahlberg NE, Bartley O and Chidekel N: Right and left gonadal veins. An anatomical and statistical study. Acta Radiol Diagn (Stockh). 4:593–601. 1966.PubMed/NCBI View Article : Google Scholar

9 

Bach PV, Najari BB and Goldstein M: Varicocele-a case for early intervention. F1000Res. 5(1792)2016.PubMed/NCBI View Article : Google Scholar

10 

Chiba K, Ramasamy R, Lamb DJ and Lipshultz LI: The varicocele: Diagnostic dilemmas, therapeutic challenges and future perspectives. Asian J Androl. 18:276–281. 2016.PubMed/NCBI View Article : Google Scholar

11 

Fretz PC and Sandlow JI: Varicocele: Current concepts in pathophysiology, diagnosis, and treatment. Urol Clin North Am. 29:921–937. 2002.PubMed/NCBI View Article : Google Scholar

12 

Luo DY, Yang G, Liu JJ, Yang YR and Dong Q: Effects of varicocele on testosterone, apoptosis and expression of StAR mRNA in rat Leydig cells. Asian J Androl. 13:287–291. 2011.PubMed/NCBI View Article : Google Scholar

13 

Saypol DC, Howards SS, Turner TT and Miller ED Jr: Influence of surgically induced varicocele on testicular blood flow, temperature, and histology in adult rats and dogs. J Clin Invest. 68:39–45. 1981.PubMed/NCBI View Article : Google Scholar

14 

Pastuszak AW and Wang R: Varicocele and testicular function. Asian J Androl. 17:659–667. 2015.PubMed/NCBI View Article : Google Scholar

15 

Ozbek E, Yurekli M, Soylu A, Davarci M and Balbay MD: The role of adrenomedullin in varicocele and impotence. BJU Int. 86:694–698. 2000.PubMed/NCBI View Article : Google Scholar

16 

Kim IT, Park HJ, Nam JH, Park YM, Won JH, Choi J, Choe BK and Lee KT: In-vitro and in-vivo anti-inflammatory and antinociceptive effects of the methanol extract of the roots of Morinda officinalis. J Pharm Pharmacol. 57:607–615. 2005.PubMed/NCBI View Article : Google Scholar

17 

Zhang L, Zhao X, Wang F, Lin Q and Wang W: Effects of morinda officinalis polysaccharide on experimental varicocele rats. Evid Based Complement Alternat Med. 2016(5365291)2016.PubMed/NCBI View Article : Google Scholar

18 

Marinov GK: On the design and prospects of direct RNA sequencing. Brief Funct Genomics. 16:326–335. 2017.PubMed/NCBI View Article : Google Scholar

19 

Li X, Wu Z, Fu X and Han W: lncRNAs: Insights into their function and mechanics in underlying disorders. Mutat Res Rev Mutat Res. 762:1–21. 2014.PubMed/NCBI View Article : Google Scholar

20 

Kazimierczyk M, Kasprowicz MK, Kasprzyk ME and Wrzesinski J: Human long noncoding RNA interactome: Detection, characterization and function. Int J Mol Sci. 21(1027)2020.PubMed/NCBI View Article : Google Scholar

21 

Li L, Zhuang Y, Zhao X and Li X: Long non-coding RNA in neuronal development and neurological disorders. Front Genet. 9(744)2018.PubMed/NCBI View Article : Google Scholar

22 

Hu Y, Lin J, Fang H, Fang J, Li C, Chen W, Liu S, Ondrejka S, Gong Z, Reu F, et al: Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma. Leukemia. 32:2250–2262. 2018.PubMed/NCBI View Article : Google Scholar

23 

Mirza AH, Kaur S and Pociot F: Long non-coding RNAs as novel players in β cell function and type 1 diabetes. Hum Genomics. 11(17)2017.PubMed/NCBI View Article : Google Scholar

24 

Zhang Y, Hou YM, Gao F, Xiao JW, Li CC and Tang Y: lncRNA GAS5 regulates myocardial infarction by targeting the miR-525-5p/CALM2 axis. J Cell Biochem. 120:18678–18688. 2019.PubMed/NCBI View Article : Google Scholar

25 

Morlando M and Fatica A: Alteration of epigenetic regulation by long noncoding RNAs in cancer. Int J Mol Sci. 19(570)2018.PubMed/NCBI View Article : Google Scholar

26 

Yang Y, Junjie P, Sanjun C and Ma Y: Long non-coding RNAs in colorectal cancer: Progression and future directions. J Cancer. 8:3212–3225. 2017.PubMed/NCBI View Article : Google Scholar

27 

Loewen G, Jayawickramarajah J, Zhuo Y and Shan B: Functions of lncRNA HOTAIR in lung cancer. J Hematol Oncol. 7(90)2014.PubMed/NCBI View Article : Google Scholar

28 

Wang X, Ruan Y, Wang X, Zhao W, Jiang Q, Jiang C, Zhao Y, Xu Y, Sun F, Zhu Y, et al: Long intragenic non-coding RNA lincRNA-p21 suppresses development of human prostate cancer. Cell Prolif. 50(e12318)2017.PubMed/NCBI View Article : Google Scholar

29 

Dong H, Zhang Q, Li Y, Li L, Lan W, He J, Li H, Xiong Y and Qin W: Extraction, characterization and antioxidant activities of polysaccharides of Chuanminshen violaceum. Int J Biol Macromol. 86:224–232. 2016.PubMed/NCBI View Article : Google Scholar

30 

Xu SY, Liu JP, Huang X, Du LP, Shi FL, Dong R, Huang XT, Zheng K, Liu Y and Cheong KL: Ultrasonic-microwave assisted extraction, characterization and biological activity of pectin from jackfruit peel. Lwt. 90:577–582. 2018.

31 

Turner TT: The study of varicocele through the use of animal models. Hum Reprod Update. 7:78–84. 2001.PubMed/NCBI View Article : Google Scholar

32 

Pertea M, Kim D, Pertea GM, Leek JT and Salzberg SL: Transcript-level expression analysis of RNA-seq experiments with HISAT, StringTie and Ballgown. Nat Protoc. 11:1650–1667. 2016.PubMed/NCBI View Article : Google Scholar

33 

Kim D, Langmead B and Salzberg SL: HISAT: A fast spliced aligner with low memory requirements. Nat Methods. 12:357–360. 2015.PubMed/NCBI View Article : Google Scholar

34 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

35 

Zhang T, Zheng T, Wang C, Zhang W, Jia D, Wang R and Qiao B: Effects of Wnt/β-catenin signaling pathway and star D7 on testosterone synthesis. Acta Endocrinol (Buchar). 14:155–162. 2018.PubMed/NCBI View Article : Google Scholar

36 

Boyer A, Paquet M, Lague MN, Hermo L and Boerboom D: Dysregulation of WNT/CTNNB1 and PI3K/AKT signaling in testicular stromal cells causes granulosa cell tumor of the testis. Carcinogenesis. 30:869–878. 2009.PubMed/NCBI View Article : Google Scholar

37 

Boyer A, Hermo L, Paquet M, Robaire B and Boerboom D: Seminiferous tubule degeneration and infertility in mice with sustained activation of WNT/CTNNB1 signaling in sertoli cells. Biol Reprod. 79:475–485. 2008.PubMed/NCBI View Article : Google Scholar

38 

Takase HM and Nusse R: Paracrine Wnt/β-catenin signaling mediates proliferation of undifferentiated spermatogonia in the adult mouse testis. Proc Natl Acad Sci USA. 113:E1489–E1497. 2016.PubMed/NCBI View Article : Google Scholar

39 

Kerr GE, Young JC, Horvay K, Abud HE and Loveland KL: Regulated Wnt/beta-catenin signaling sustains adult spermatogenesis in mice. Biol Reprod. 90(3)2014.PubMed/NCBI View Article : Google Scholar

40 

Tanimoto K, Suzuki K, Jokitalo E, Sakai N, Sakaguchi T, Tamura D, Fujii G, Aoki K, Takada S, Ishida R, et al: Characterization of YIPF3 and YIPF4, cis-golgi localizing yip domain family proteins. Cell Struct Funct. 36:171–185. 2011.PubMed/NCBI View Article : Google Scholar

41 

Kranjc T, Dempsey E, Cagney G, Nakamura N, Shields DC and Simpson JC: Functional characterisation of the YIPF protein family in mammalian cells. Histochem Cell Biol. 147:439–451. 2017.PubMed/NCBI View Article : Google Scholar

42 

Kim SW, Jung YS, Ahn JB, Shin ES, Jang HW, Lee HJ, Kim T, Kim DY, Bang D, Kim WH and Cheon JH: Identification of genetic susceptibility loci for intestinal Behcet's disease. Sci Rep. 7(39850)2017.PubMed/NCBI View Article : Google Scholar

43 

Kang HW, Yoon HY, Ha YS, Kim WT, Kim YJ, Yun SJ, Lee SC and Kim WJ: FAM70B as a novel prognostic marker for cancer progression and cancer-specific death in muscle-invasive bladder cancer. Korean J Urol. 53:598–606. 2012.PubMed/NCBI View Article : Google Scholar

44 

Walenta L, Fleck D, Fröhlich T, von Eysmondt H, Arnold GJ, Spehr J, Schwarzer JU, Köhn FM, Spehr M and Mayerhofer A: ATP-mediated events in peritubular cells contribute to sterile testicular inflammation. Sci Rep. 8(1431)2018.PubMed/NCBI View Article : Google Scholar

45 

Jurga AM, Piotrowska A, Makuch W, Przewlocka B and Mika J: Blockade of P2X4 receptors inhibits neuropathic pain-related behavior by preventing MMP-9 activation and, consequently, pronociceptive interleukin release in a rat model. Front Pharmacol. 8(48)2017.PubMed/NCBI View Article : Google Scholar

46 

Tsuda M, Masuda T, Tozaki-Saitoh H and Inoue K: P2X4 receptors and neuropathic pain. Front Cell Neurosci. 7(191)2013.PubMed/NCBI View Article : Google Scholar

47 

Lalisse S, Hua J, Lenoir M, Linck N, Rassendren F and Ulmann L: Sensory neuronal P2RX4 receptors controls BDNF signaling in inflammatory pain. Sci Rep. 8(964)2018.PubMed/NCBI View Article : Google Scholar

48 

Zech A, Wiesler B, Ayata CK, Schlaich T, Dürk T, Hoßfeld M, Ehrat N, Cicko S and Idzko M: P2rx4 deficiency in mice alleviates allergen-induced airway inflammation. Oncotarget. 7:80288–80297. 2016.PubMed/NCBI View Article : Google Scholar

49 

Sadovnick AD, Gu BJ, Traboulsee AL, Bernales CQ, Encarnacion M, Yee IM, Criscuoli MG, Huang X, Ou A, Milligan CJ, et al: Purinergic receptors P2RX4 and P2RX7 in familial multiple sclerosis. Hum Mutat. 38:736–744. 2017.PubMed/NCBI View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhang L, Zhao X and Wang W: lncRNA and mRNA sequencing of the left testis in experimental varicocele rats treated with <em>Morinda officinalis</em> polysaccharide. Exp Ther Med 22: 1136, 2021.
APA
Zhang, L., Zhao, X., & Wang, W. (2021). lncRNA and mRNA sequencing of the left testis in experimental varicocele rats treated with <em>Morinda officinalis</em> polysaccharide. Experimental and Therapeutic Medicine, 22, 1136. https://doi.org/10.3892/etm.2021.10570
MLA
Zhang, L., Zhao, X., Wang, W."lncRNA and mRNA sequencing of the left testis in experimental varicocele rats treated with <em>Morinda officinalis</em> polysaccharide". Experimental and Therapeutic Medicine 22.4 (2021): 1136.
Chicago
Zhang, L., Zhao, X., Wang, W."lncRNA and mRNA sequencing of the left testis in experimental varicocele rats treated with <em>Morinda officinalis</em> polysaccharide". Experimental and Therapeutic Medicine 22, no. 4 (2021): 1136. https://doi.org/10.3892/etm.2021.10570
Copy and paste a formatted citation
x
Spandidos Publications style
Zhang L, Zhao X and Wang W: lncRNA and mRNA sequencing of the left testis in experimental varicocele rats treated with <em>Morinda officinalis</em> polysaccharide. Exp Ther Med 22: 1136, 2021.
APA
Zhang, L., Zhao, X., & Wang, W. (2021). lncRNA and mRNA sequencing of the left testis in experimental varicocele rats treated with <em>Morinda officinalis</em> polysaccharide. Experimental and Therapeutic Medicine, 22, 1136. https://doi.org/10.3892/etm.2021.10570
MLA
Zhang, L., Zhao, X., Wang, W."lncRNA and mRNA sequencing of the left testis in experimental varicocele rats treated with <em>Morinda officinalis</em> polysaccharide". Experimental and Therapeutic Medicine 22.4 (2021): 1136.
Chicago
Zhang, L., Zhao, X., Wang, W."lncRNA and mRNA sequencing of the left testis in experimental varicocele rats treated with <em>Morinda officinalis</em> polysaccharide". Experimental and Therapeutic Medicine 22, no. 4 (2021): 1136. https://doi.org/10.3892/etm.2021.10570
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team