Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
May-2021 Volume 21 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2021 Volume 21 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Underlying mechanisms of the effect of minocycline against Candida albicans biofilms

  • Authors:
    • Li Zou
    • Zhao Mei
    • Tao Guan
    • Bo Zhang
    • Qun Deng
  • View Affiliations / Copyright

    Affiliations: Department of Clinical Laboratory, The People's Hospital of China Three Gorges University, Yichang, Hubei 443000, P.R. China, Department of Pharmacy, The People's Hospital of China Three Gorges University, Yichang, Hubei 443000, P.R. China
    Copyright: © Zou et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 413
    |
    Published online on: February 25, 2021
       https://doi.org/10.3892/etm.2021.9857
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Minocycline (MH) is a broad‑spectrum antimicrobial agent and semisynthetic tetracycline derivative, which has been widely used in the clinic due to its efficacy. Having the strongest anti‑microbial effect, MH exceeded the traditional scope of antibiotics and its previously unknown antifungal activity is also gradually being discovered. To preliminarily investigate the inhibitory effect of MH on Candida albicans (C. albicans), changes of cell growth, hyphal formation and transition, biofilm production and signaling pathway gene expression of C. albicans in the presence of MH were assessed in the present study. An XTT reduction assay was performed to quantitatively detect the metabolic activity of biofilms and evaluate the inhibition of MH on this. The results suggested that biofilm formation was clearly inhibited by 67% (P<0.0001) in the presence of 250 µg/ml MH, while mature biofilms were not significantly affected. In addition, MH inhibited the transition from yeast to hypha in a dose‑dependent manner. Furthermore, reverse transcription‑quantitative PCR revealed that several hyphae‑ and adhesion‑specific genes associated with the Ras/cyclic (c)AMP/protein kinase A (PKA) pathway were differentially expressed following MH treatment, including downregulation of ras family GTPase (RAS1), adenylyl cyclase‑associated protein 1 (CAP1), thiamin pyrophosphokinase 1 (TPK1), adenylate cyclase (CDC35), transcription factor (TEC1), agglutinin‑like protein 3 (ALS3) and hyphal wall protein 1 (HWP1) and upregulation of EFG1 (enhanced filamentous growth protein 1 gene) and PDE2 (high‑affinity phosphodiesterase gene). The most obviously changed genes were TPK1, HWP1 and RAS1, downregulated by 0.33‑, 0.48‑ and 0.55‑fold, respectively. It was suggested that MH is associated with alterations in the morphology of C. albicans, such as the repression of hypha and biofilm formation of cells, and MH affected the Ras/cAMP pathway to regulate the expression of cAMP‑associated genes.

Introduction

Candida albicans (C. albicans) is considered the most common opportunistic fungal pathogen in humans due to its widespread distribution in the environment. It has a high propensity to cause invasive infections on mucosal surfaces and is particularly life-threatening in individuals with immunodeficiency and dysbacteriosis, as systemic candidiasis has a high mortality rate in such patients (1,2). Fungi continue to vary and mutate in response to environmental and body stimuli and the antifungal drugs available are simply insufficient for the clinical/pharmacological treatment of patients. In addition, the incidence of C. albicans resistance increased rapidly due to the widespread and long-term usage of limited antifungal drugs, causing additional difficulty in treatment and ultimately leading to refractory fungal infections (3-5).

One of the morphological characteristics that distinguish C. albicans from other organisms is polymorphism and pleomorphism. C. albicans may have three distinct phenotypic characteristics: A yeast-like form at 25˚C, and additional pseudohyphae and hyphae forms at 37˚C, which are commonly referred to as filamentous morphologies (6,7). All three forms may coexist and transform with the change of environmental stimuli. C. albicans biofilms, as an important barrier, are considered significant for pathogenicity and virulence, as well as adhesion and infectivity, which are contributing factors in the process of infecting the host and are able to withstand the stimulation of the external environment and drugs. Therefore, numerous clinical antifungal drugs are mainly resistant to biofilms. The major conventional antifungal drugs currently in clinical use are fluconazole and amphotericin B. Studies have demonstrated that the frequent and excessive use of antifungal drugs led to the notorious resistance of C. albicans to a wide variety of clinical antifungal drugs, including the aforementioned two (8,9).

The contradiction between effective antifungal therapy and finite available clinical antifungal drugs is increasingly prominent. Therefore, novel antifungal agents are urgently required in order overcome the resistance of C. albicans biofilms. Recent scientific studies have re-evaluated tetracycline (TE) derivatives, such as minocycline (MH), TE, doxycycline (DO), tigecycline (TGC), oxytetracycline and demethylchlortetracycline, for their potential antifungal activity as well as old traditional antibiotics combined with antifungal drugs to achieve an outstanding effect against fungal infections (10-13).

MH, a TE derivative, is a traditional antimicrobial agent that inhibits bacterial protein synthesis, which is extensively used in the clinic due to its large spectrum of antibiotic activity. MH has a strong effect on gram-positive bacteria, including Staphylococcus aureus, with the effect on gram-negative bacilli being slightly weaker. When MH is combined with other antifungal agents, such as fluconazole, the antifungal effect of combination treatment is significantly stronger than that of MH used alone (10,11,14,15). Previous studies have reported that MH is able to mediate several biological phenomena and is associated with the capacity of morphological transformation from yeast to hypha in C. albicans (14).

The RAS/cyclic (c)AMP/protein kinase A (PKA) signaling pathway has an impact on cell growth, differentiation, protein secretion and transport. Hogan and Sundstrom (16) and Phillips and Crowe (17) determined separately that in C. albicans, the Ras signaling pathway mediates the morphological transition and biofilm formation, and contains certain vital hypha-specific genes, including ras family GTPase (RAS1), thiamin pyrophosphokinase 1 (TPK1), enhanced filamentous growth protein 1 (EFG1), TEC1, CAP1 (adenylyl cyclase-associated protein 1), phosphodiesterase 2 (PDE2) and adenylate cyclase (CDC35), as well as certain adhesion-specific genes, including agglutinin-like protein 3 (ALS3) and hyphal wall protein 1 (HWP1). Based on the results of these studies, MH may be a promising and effective antifungal agent. It is able to alleviate the urgent problem of drug resistance and short supply of antifungal drugs, which may provide a major breakthrough in the clinical treatment of fungal infections. However, in order to understand the antifungal activity of MH thorough and systematic evaluation is required and the effect of MH on C. albicans biofilms and the mechanisms underlying this require further investigation. In the present study, it was hypothesized that the antifungal effect of MH on C. albicans is mainly associated with biofilm formation and its regulation is closely associated with the RAS/cAMP/PKA pathway. In the present study, the in vitro antifungal activity of the widely used antimicrobial MH in C. albicans was assessed, and whether its potential antifungal mechanism is associated with the Ras/cAMP signaling pathway was systematically explored to verify the validity of this hypothesis.

Materials and methods

Strains, antibacterial agents and growth conditions

A total of four TE derivatives were examined in the present study: MH, TE, DO and TGC. The TH drug susceptibility test (TE, 30 µg; DO, 30 µg; TGC, 15 µg) was obtained from BioMérieux and MH drug papers (30 µg) from Merck KGaA. MH was dissolved in DMSO. A high concentration of the original solution was prepared, stored at -20˚C away from light and then diluted to the desired final concentration prior to use. The final content of DMSO was <2% and had no effect on cells in the present study.

The reference strain C. albicans ATCC 90028 was a gift obtained from Renmin Hospital of Wuhan University. All clinically isolated yeast strains used in the present study were isolated at the People's Hospital of China Three Gorges University (Yichang, China) and stored in the central laboratory. All strains used in the present study were identified according to the standard morphological criteria (18). Strains were routinely cultured on Sabouraud dextrose agar (SDA) plates at 28˚C for 24-48 h, then streaked out onto Yeast Extract-Peptone-Dextrose (YPD) liquid medium and grown at 30˚C in a shaking incubator for 24-48 h until they reached the logarithmic growth phase and the absorbance was measured at 600 nm. Hyphal inductions were performed at 37˚C in liquid medium, and Spider and RPMI-1640 medium were prepared as previously described (19).

Effect of TE derivatives on the growth of yeast strains (Kirby-Bauer disc diffusion method)

All strains were adjusted to 0.5 McFarland bacterial suspensions and then evenly spread to a Mueller-Hinton agar plate (Thermo Fisher Scientific, Inc.). Once the surface of the plate was dry, sensitivity test papers containing one of the 4 TE antibiotics were applied. All plates were incubated for 24 h at 28˚C and the diameter of the inhibition ring was measured.

Effect of MH on planktonic cells in C. albicans

Antifungal susceptibility testing was performed in 96-well tissue culture plates (Corning, Inc.) according to the protocol of the Clinical and Laboratory Standards Institute (20). In brief, C. albicans ATCC 90028 was prepared with initial cells at 1x105 CFU/ml and cultured in YPD liquid medium for 48 h at 37˚C. To evaluate the effect of MH on the cell growth in C. albicans ATCC 90028, an inoculum concentration of yeast cells at ~1x106 cells/ml was added into liquid RPMI 1640 medium containing MH at concentrations of 0, 125, 250, 500 and 1,000 µg/ml, incubated in 96-well tissue culture plates at 37˚C and shaken at 200 rpm.(2.2 x g). The cells were monitored every 4 h and counted at the predetermined time-points (0, 4, 8, 12, 16, 20, 24, 28 and 32 h) using a Multiskan GO Microplate reader (Thermo Fisher Scientific, Inc.) to measure the absorption/optical density (OD) at 600 nm, and the background optical densities were already subtracted. A total of three independent experiments were performed (21).

Hyphal formation assessment

To further estimate whether the MH affects bud-to-hypha transition, a fixed amount of C. albicans cells (1x106 cells/ml) was cultured in several nutritious hypha transition media. The spider and RPMI 1640 media (Sangon Biotech Co., Ltd.) were supplemented with 20% fetal bovine serum (FBS; Cytiva) in 24-well tissue culture plates containing various concentrations of MH and incubated at 37˚C for 3 h, and hyphal formation was evaluated microscopically to count 200 cells and calculate the percentage of hyphal formation, as previously described (14).

Antifungal activity against mature biofilms

The C. albicans cells in the logarithmic growth phase were collected and centrifuged, RPMI 1640 medium was added to adjust the concentration to 1x106 CFU/ml and 100 µl bacterial liquid was added to the 96-well culture plate for 90 min of adhesion at 37˚C. The medium was gently sucked off with a sample gun, non-adherent planktonic cells were removed, 100 µl fresh RPMI 1640 medium was added and the plate was incubated at 37˚C for 24 h until the mature biofilm was formed (20). The biofilm supernatant was then aspirated, RPMI 1640 with MH was added to for a 24-h incubation, the growth of the biofilm was observed under a microscope and an XTT kit (Sangon Biotech Co., Ltd.) was used to evaluate the formed mature biofilm. Similarly, in order to detect the effect of MH on the formation of biofilms, MH was added to fresh RPMI 1640 after 90 min of adhesion; subsequent methods were described above until biofilm formation to observe the anti-biofilm effect of MH (20,22).

Gene expression analysis of C. albicans-specific genes

Following MH treatment overnight, C. albicans cells were washed and collected, and a Fungal RNA out kit (Sangon Biotech Co, Ltd.) was used to extract and isolate the total RNA of C. albicans according to the manufacturer's protocol and the standard method. The OD was measured at 260-280 nm using a Nanodrop 2000 Ultraviolet spectrophotometer (Thermo Fisher Scientific, Inc.) to test the nucleic acid concentration and purity of the RNA. The integrity of the RNA was assessed using denatured electrophoresis through a 1% agarose-3-(N-morpholino) propanesulfonic acid gel (Sangon Biotech Co., Ltd.). A reverse transcription kit (Takara Bio, Inc.) was used to reverse-transcribe single-stranded RNA (1 µg) into cDNA. Next, reverse transcription-quantitative PCR (RT-qPCR) was performed using a 7500 real-time PCR system (Thermo Fisher Scientific, Inc.); hyphal-specific and biofilm-associated genes of C. albicans, as well as their transcriptional regulators, were analyzed in the present study, and the primers are listed in Table I. The associated genes were as follows: RAS1, a major transcription factor involved in the MAPK pathway; EFG1, transcription factor in the cAMP/PKA pathway; GAP1, which encodes a general amino acid permease; ALS3 and HWP1, which encode agglutinin-like protein 3 and hyphal wall protein 1, respectively, and are activated by EFG1; CDC35 (coding for adenylyl cyclase); TPK1 (PKA catalytic subunits); PDE2 (high-affinity phosphodiesterase gene); TEC1, a transcription factor; ACT1, a housekeeping gene that has the ability to express stably and consistently in organisms, and was chosen as an endogenous control gene for correcting the loading inaccuracies (23). The final values were calculated by the 2-ΔΔCq method (24).

Table I

PCR primers used for detection of gene expression in Candida albicans.

Table I

PCR primers used for detection of gene expression in Candida albicans.

PrimerSequence (5'-3')
CAP1-F GAACCACCATCAACATCA
CAP1-R CAACCCATCAATATCAAGT
TPK1-F AGAAGTTCAAGATGTGACTTAT
TPK1-R CATCATCAGAACCACCTTGT
CDC35-F TCCATGTCAAATATGCCAACG
CDC35-R CTTCACATCCCAACTTTCAGG
EFG1-F TCCATGTCAAATATGCCAACG
EFG1-R TGGATTCATACCGTATTGGTCATTA
TEC1-F TGGATTCATACCGTATTGGTCATTA
TECI-R TCGGGCAATCCTTTGAATAAA
RAS1-F GTGGTGGTGTTGGTAAATC
RAS1-R TTCTTGTCCAGCAGTATCT
PDE2-F TGCTGTGGGACATTGGAG
PDE2-R GGCGGAAATTATGGAACG
ALS3-F GTGATGCTGGATCTAACGGTATTG
ALS3-R GTCTTAGTTTTGTCGCGGTTAGG
HWP1-F CGGAATCTAGTGCTGTCGTCTCT
HWP1-R CGACACTTGAGTAATTGGCAGATG
ACT 1-F TTGATTTGGCTGGTAGAG
ACT 1-R ATGGCAGAAGATTGAGA

[i] F, forward primer; R, reverse primer; CAP1, adenylate cyclase-associated protein 1; TPK1, thiamin pyrophosphokinase 1; CDC35, adenylate cyclase; EFG1, enhanced filamentous growth protein 1; Tec1, transcription factor; RAS1, ras family GTPase; PDE, 2,3',5'-cyclic-nucleotide phosphodiesterase; ALS3, agglutinin-like protein 3; HWP1, hyphal wall protein 1; ACT 1, actin related gene 1.

The PCR conditions were programmed and divided into three steps according to the experimental conditions and purposes. The first step was initial denaturation at 95˚C for 5 min, where double-stranded DNA templates break hydrogen bonds under thermal action to form single-stranded DNA. The second step was annealing at 55-65˚C, with the continuous gradient temperature set at a heating rate of 0.1˚C/sec to match the appropriate suitable solution curve temperature, the system temperature was lowered and the primer bound to the DNA template to form a local double strand. This step eventually went through 40 cycles of amplification and quantification at 95˚C for 10 sec, 55˚C for 30 sec and 72˚C for 15 sec with a continuous single fluorescence measurement and end. The last step was a final extension maintained at 72˚C for 5-10 min. dNTP was used as raw material and primers started from the 3'end, extending from the 5' to 3' end, to synthesize DNA strands complementary to the template, followed by a cooling step at 42˚C.

Statistical analysis

Values are expressed as the mean fold change ± standard deviation of three independent experiments. Statistical analyses were performed using GraphPad Prism 5.0 (GraphPad Software, Inc.). One-way analysis of variance with Tukey's post hoc test was used to evaluate the statistical significance of differences among the treatment groups. P<0.05 were considered to indicate a statistically significant difference.

Results

Inhibitory effects of TE derivatives on yeasts

The results of the drug sensitivity test are presented in Fig. 1. MH had the most obvious inhibition circle among the four TE derivatives (ME, TE, DO and TGC). By measurement and quantification, the ratio of the inhibition zone diameter ≥14 mm for MH on C. albicans was determined to be 80%, that on C. tropicalis was 96% and that on C. Portuguese was 87%. TE, DO and TGC exhibited no sufficient antifungal activity against C. albicans with the inhibition zone diameter being 6-10 mm, <14 mm in all strains.

Figure 1

Antifungal effects of 4 TE derivatives. MH had a marked antifungal activity against C. albicans and DO had a slight antifungal activity against C. albicans, while TE and TGC had no antifungal activity. TE, tetracycline; MH, minocycline; DO, doxycycline; C. albicans, Candida albicans; TGC, tigecycline.

Effects of MH on C. albicans growth

In the presence of MH at the concentrations of 125, 250, 500 and 1,000 µg/ml, a significant growth inhibition of C. albicans was observed in the treatment group as compared to the control group without MH treatment (Fig. 2). At 250 µg/ml, MH exhibited the most potent inhibitory activity on C. albicans growth among all concentrations used. After 8 h of incubation in liquid culture, the growth curves of C. albicans began to diverge and exhibit visible differences. After 32 h, the growth was significantly restricted in RPMI-1640 medium with MH at 125 µg/ml, leading to a 59.9% reduction (P<0.01), and in the presence 250 µg/ml MH, the maximum inhibition was 68.0% (P<0.01) as compared to the control group. However, with further increases in the concentration of MH, the growth inhibition of planktonic C. albicans decreased.

Figure 2

Effects of different concentrations of MH on fungal cell growth of the Candida albicans strain ATCC 90028. *P<0.05; **P<0.01. OD, optical density; MH, minocycline.

MH regulates the hyphal formation process of C. albicans

Morphological changes were observed under light microscopy following incubation for 4 h and the quantitative results suggested that MH inhibited hyphal growth induction at all tested concentrations. More specifically, the maximum hypha formation inhibition occurred at the lowest concentration of MH (125 µg/ml) in both RPMI-1640 and Spider media and the degree of hypha inhibition slightly decreased with the increase of the MH concentration (Fig. 3A). The hypha rate of ~200 cells for each sample was determined using light microscopy (Fig. 3B). In drug-free medium, >70% of C. albicans cells converted to the hyphal morphology after 4 h of incubation, with only a small percentage retaining their yeast form. However, following incubation with 125 and 250 µg/ml MH, the hypha formation rate was only 11.75±2.86% with a significant inhibition of hyphae in all media (P<0.001). Following incubation with 500 µg/ml MH, the hypha rates were 46.00±5.29% in RPMI-1640 medium and 23.00±2.64% in Spider medium, both were significantly different from the control group (P<0.001). Following incubation with 1,000 µg/ml MH, the hypha rates were 54.33±4.04% in RPMI-1640 medium and 35.33±2.51% in Spider medium, both were significantly different from the control group (P<0.01).

Figure 3

(A) Effects of MH on hyphal formation in C. albicans. Cells (1x106 cells/ml) were grown in Spider or RPMI 1640 media supplemented with 20% FBS. Photomicrographs of C. albicans ATCC 90028 grown at 37˚C for 4 h. MH had an obvious trend to inhibit filamentous growth as compared with cells incubated in drug-free medium (magnification, x400). (B) The hyphae rate was counted in a minimum of 200 cells from each sample following 4 h of cultivation. The results indicated that MH was able to inhibit hyphae formation at all concentrations, with the effects of 125 and 250 µg/ml MH being most significant. **P<0.01; ***P<0.001 vs. control. MH, minocycline; C. albicans, Candida albicans; FBS, fetal bovine serum.

MH inhibits C. albicans biofilms

An XTT reduction assay was performed to examine the potential of MH to inhibit biofilm formation in vitro. As presented in Fig. 4, the biofilms formed by C. albicans decreased in an MH dose-dependent manner in terms of their density and thickness. More specifically, MH inhibited biofilm formation by 52% at 125 µg/ml (P<0.001 vs. control), and with the increase of the MH concentration, the inhibitory effect became more pronounced. MH inhibited biofilm formation by 67% at 250 µg/ml (P<0.001 vs. control). However, MH had no marked activity against the mature biofilms, which exhibited no obvious/significant changes following treatment with any of the MH concentrations. In conclusion, the tendency of MH to inhibit biofilm formation was confirmed.

Figure 4

(A) Light microscopy images of biofilm formation and mature biofilm. With the increase in the MH concentration, the inhibition of biofilm formation was more obvious. At 250 µg/ml MH, there was a marked decrease in the density of biofilms. By contrast, in the presence of MH, mature biofilms exhibited no changes obvious changes observed by standard light microscopy (magnification, x1,000) (B) Effects of MH on biofilm formation and mature biofilms. MH inhibited C. albicans biofilm formation in vitro. Biofilm inhibition was evaluated using an XTT reduction assay and the results are presented as the percentage of MH-treated biofilms relative to control biofilms that were formed without drug treatment. ****P<0.0001 and ***P<0.001 vs. control. MH, minocycline; C. albicans, Candida albicans.

MH regulates the expression of cAMP pathway genes

The expression levels of 9 genes were monitored by RT-qPCR. Hypha-specific genes from the adhesion process, HWP1 and ALS3, which are downstream components of the cAMP/PKA pathway, are positively regulated by EFG1(25), and they were downregulated by 0.48- and 0.59-fold, respectively, following 250 µg/ml MH treatment. Certain hyphal transcriptional regulation genes from the cAMP/PKA pathway, including RAS1, TPK1, EFG1, CAP1, PDE2 and CDC35, were also examined (Fig. 5). The upregulated genes included EFG1 and PDE2. The expression levels of EFG1 were slightly, though not significantly upregulated by MH treatment in the present study, while the upstream components RAS1, TPK1 and CAP1 were downregulated by 0.55-, 0.33- and 0.62-fold, respectively. CDC35 and TEC1 were downregulated by 0.76- and 0.69-fold, respectively. Taken together, the results suggested that genes downregulated following MH treatment, including HWP1, ALS3, RAS1 and TPK1, were all associated with the AMP pathway and regulated by the Ras/cAMP pathway (16).

Figure 5

Gene expression levels in the C. albicans strain ATCC 90028. Fold change values of the expression of each target gene are shown relative to the values of the control group containing untreated C. albicans. The housekeeping gene ACT1 was used as an internal reference gene. The expression level of each target gene in the MH-free sample was set as 1.**P<0.01; ***P<0.001. C. albicans, Candida albicans; MH, minocycline.

Discussion

The results of the present study demonstrated that the antifungal activity of MH was mediated by regulatory factors in the Ras/cAMP pathway, which was conducive to the reduction of biofilm formation and limiting of hyphae formation and long-term maintenance of C. albicans.

It was indicated that MH had different inhibitory effects on different strains of fungus. It had a strong antifungal activity on yeasts such as C. albicans, C. tropicalis and C. lusitaniae, with the inhibition zones being >14 mm and demonstrating a significant activity against C. albicans. MH had no inhibitory activity against C. pseudosmooth, C. glabrata and C. parapsilosis, while TE, DO and TGC had no significant antifungal properties. The antifungal effect of MH was marked as compared to other TE derivative agents. This may be linked to the morphological transformation and virulence in fungi (26); further research is required in the future to confirm this.

In addition, several studies have verified that the length and thickness during the growth of filamentous fungi directly affects the pathogenicity of hyphae, with the two being positively correlated (27,28). The yeast form of C. albicans is less pathogenic and has a better adhesion capacity than the hyphae form due to its small and single form, at least in part because the yeast form is more easily eliminated by the defense system of the host than the hyphae form (29). In Spider and RPMI-1640 media, nutrient-rich conditions were added with 20% FBS in order for C. albicans to switch to the hyphae form more rapidly. However, in the present study, MH was able to maintain the yeast form for longer and inhibited the formation of hyphae, while MH clearly affected the hypha growth of C. albicans at the concentrations of 125 and 250 µg/ml. In RPMI-1640 medium and Spider medium, the hypha rate (%) of 125 MH treatment was the most significant, 11.00±3.61 and 9.67±2.51, respectively. These results are consistent with those by Shi et al (10), who reported that when MH was combined with fluconazole, the minimum inhibitory concentration on C. albicans was decreased as compared with that of fluconazole used alone. Although there have been numerous reports on the phenomenon of antifungal agents used alone or combined with antimicrobial agents through C. albicans biofilms (13-15), few have investigated the particular antifungal characteristics of antimicrobial agents in C. albicans. To explore the potential mechanisms, the interference ability of MH to penetrate biofilms was first assessed.

C. albicans biofilms have a complex and intricate three-dimensional network architecture, with the barrier characteristics of C. albicans biofilms mainly reflected in an increased tolerance to traditional antifungal therapy. An XTT reduction assay was performed to demonstrate the suppressive function of MH on biofilms, and it was indicated that MH had a distinct inhibitory effect against C. albicans biofilms. The results suggested that 250 µg/ml MH significantly depressed biofilm formation by 67% (P<0.001). With the increase in concentration, the inhibitory activity of MH tended to be stable and changes showed no significant difference, indicating that the optimal inhibitory effect had been achieved or approached at 250 µg/ml. Of note, it exhibited no activity to impair the maintenance of mature biofilms. In conclusion, MH had a strong antibiofilm effect against C. albicans in vitro, which appears to be attributable to its anti-morphological transition activities.

According to the inhibition of C. albicans filamentous growth and biofilm formation, the transcription levels of genes associated with mycelium growth, adhesion and biofilm formation in C. albicans were determined to further clarify the molecular mechanism of the anti-biofilm effects of MH. The analysis revealed that several important genes were differentially expressed following MH treatment. CAP1, TPK1, CDC35, TECI, RAS1, ALS3 and HWP1 were downregulated, and EFG1 and PDE2 were upregulated following treatment with 250 µg/ml MH. In this assay, MH was applied at 250 µg/ml, since at this concentration had a significant antibiofilm activity. It should be noted that these downregulated genes are all important components of the RAS1/cAMP/PKA signaling pathway; the present hypothesis that a direct interaction between the pathways occurs at the transcriptional level was confirmed. Previous studies have reported that several signaling pathways are linked to morphogenesis and biofilms in C. albicans, with the MAPK and cAMP/PKA signaling pathways being the most prominent (16,30,31). The cAMP/PKA pathway has attracted extensive attention in fungal pathogens such as C. albicans, Trichophyton, Cryptococcus neoformans and Aspergillus fumigatus (32,33), due to its vital function in the specific morphology development of fungal biofilms. The Ras/AMP/PKA pathway is involved in the regulation of various traits of C. albicans and responds to specific environmental stimuli and cell subtype combinations (30).

In the present study, the most significantly downregulated genes were RAS1 and TPK1 (0.55- and 0.33-fold, respectively). RAS1 has a vital role in the morphological switch and biofilm formation of yeast and hypha (34,35). It is a soluble small GTPase that transmits signals to stimulate filamentous growth in the Ras1/cAMP/PKA signaling pathway as a transcription factor (36-38). Despite RAS1 gene mutation and deletion of alleles, which resulted in serious hyphal growth defects, such as deformation and irregularity in response to serum, and inhibition of pseudohyphal development (34), studies have indicated that the addition of sufficient exogenous cAMP or overexpressed components of MAP kinase cascade in the growth media is able to correct the above morphological defects and make mycelium return to normal (35,39). Evidence suggested that the RAS1 gene is an intermediate factor in the anti-fungal regulation of MH, which is involved in signaling pathway regulation through the RAS1 gene to interfere with biofilms (14).

Recent research has demonstrated that the deletion of TPK1 results in hyphal formation defects on solid media in C. tropicalis (40). In GlcNAc-inducing liquid medium, TPK1 was associated with the appearance of germ-tube, with the mRNA levels of TPK1 increasing gradually with cell growth and peaking at the onset of germ-tube emergence (41). Lin and Chen (40) reported that PDE2 tightly regulated the intracellular cAMP level. Deficiency of PDE2 led to the activation of cAMP, which decreased the thickness of the cell wall and cell membrane of the fungus, therefore reducing the virulence of the fungus and making cells more sensitive to antifungal agents. High expression of PDE2 inhibited cAMP synthesis and limited hypha production (42), while all the defects observed in hyphal morphogenesis in vitro were reversible and rectifiable. The present results suggested that the increase in PDE2 mRNA following MH intervention was most significant, which was consistent with the results of previous study (43), which further explained the inhibition of PDE2 on hypha and biofilm growth in C. albicans.

EFG1 is a well-characterized transcription factor and important component of the Ras/cAMP pathway, which may both bidirectionally regulate genes that participate in the essential processes and stages of cellular growth, such as white-opaque transition in morphogenesis, and glycolysis and respiration in cell metabolism (44,45). Furthermore, EFG1 acts upstream of TEC1 and is located in the middle stream of the RAS1/cAMP-PKA signaling pathway, which regulates and controls the upstream and downstream components, including HWP1, TCE1 and ALS3(42). Mutational analysis suggested that deficiency of the EFG1 gene disrupted normal morphological transformation, impeded the growth of mycelium, induced hyphae in a pseudorevertant strain and was dependent on the EFG1 transcription factor that has a regulatory role in the downstream of protein kinase A (46). TEC1, located downstream of EFG1, also regulates the growth of hyphae-specific genes, with the EFG1/efg1 mutants resulting in the overexpression of TEC1(47). Deletion of TEC1 resulted in thinner biofilms and the observed disordered growth of short spores on their surface. In the present study, a slight elevation of EFG1 was observed and the modulating effect of MH on EFG1 was not significant. In the present results, most aberrant genes were downregulated genes, which were all important components of the RAS1/cAMP/PKA signaling pathway, while fewer genes were upregulated. These results suggested that the signaling pathways of MH may be dominated by negative regulation and that the RAS1/cAMP/PKA signaling pathway may have a crucial role in the regulation of hypha and biofilm by MH.

However, the present study had certain limitations. For instance, due to the limited resources and funding available, no resistant strain analysis was performed and the effects of MH on drug-resistant strains of C. albicans were not analyzed. In addition, animal studies are required to verify the drug toxicity and feasible doses of MH. Further experiments, such as western blot analysis to detect changes in the protein levels, may be performed, or changes in electrolytes in the biofilm, such as ionic calcium, may be assessed in order to investigate the mechanism of action of MH. Validation using clinical samples is also required. However, despite these limitations, the results of the present study may provide novel insight that may lead to the development of clinical medication and treatment.

In conclusion, the present study demonstrated that MH exhibits a strong anti-biofilm effect against C. albicans selectively, and the predominant mechanisms are associated with the Ras/cAMP pathway. Therefore, the hypothesis of the present study, that the antifungal effect of MH on C. albicans is mainly associated with biofilm formation and its regulation is closely associated with the RAS/cAMP/PKA pathway was validated. These results indicated that MH may be an effective antifungal agent for C. albicans infections. However, clinical application is not yet possible, as more prospective studies using strains and animal models are required, and treatment strategies for drug-resistant C. albicans infection require to be developed to further verify the clinical applicability of MH. This is the direction of our future research.

Acknowledgements

Not applicable.

Funding

This work was supported by grants from the Health Committee Union Foundation of Hubei Province (grant no. WJ2019H512) and the Youth Science Foundation of Three Gorges University (grant no. KJ2018A007).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

LZ and QD designed the experiments and drafted the manuscript. ZM performed the experiments and analyzed the data. TG and BZ performed the RT-qPCR experiments. QD reviewed the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Gow NA, van de Veerdonk FL, Brown AJ and Netea MG: Candida albicans morphogenesis and host defence: Discriminating invasion from colonization. Nat Rev Microbiol. 10:112–122. 2011.PubMed/NCBI View Article : Google Scholar

2 

Ferreira AV, Prado CG, Carvalho RR, Dias KS and Dias AL: Candida albicans and non-C. albicans Candida species: Comparison of biofilm production and metabolic activity in biofilms, and putative virulence properties ofisolates from hospital environments and infections. Mycopathologia. 175:265–272. 2013.PubMed/NCBI View Article : Google Scholar

3 

Chandra J, Mukherjee PK, Leidich SD, Faddoul FF, Hoyer LL, Douglas LJ and Ghannoum MA: Antifungal resistance of candidal biofilms formed on denture acrylic in vitro. J Dent Res. 80:903–908. 2001.PubMed/NCBI View Article : Google Scholar

4 

Karagoz E, Ugan RA, Duzgun E, Cadirci E, Keles S, Uyanik MH, Yavan I and Turhan V: Comparative study of the effects of intravitreal anidulafungin, voriconazole, and amphotericin B in an experimental Candida endophthalmitis model. Curr Eye Res. 42:225–232. 2017.PubMed/NCBI View Article : Google Scholar

5 

Pfaller MA, Rhomberg PR, Messer SA, Jones RN and Castanheira M: Isavuconazole, micafungin, and 8 comparator antifungal agents' susceptibility profiles for common and uncommon opportunistic fungi collected in 2013: Temporal analysis of antifungal drug resistance using CLSI species-specific clinical breakpoints and proposed epidemiological cutoff values. Diagn Microbiol Infect Dis. 82:303–313. 2015.PubMed/NCBI View Article : Google Scholar

6 

Noble SM, Gianetti BA and Witchley JN: Candida albicans cell-type switching and functional plasticity in the mammalian host. Nat Rev Microbiol. 15:96–108. 2017.PubMed/NCBI View Article : Google Scholar

7 

Sudbery PE: Growth of Candida hyphae. Nat Rev Microbiol. 9:737–748. 2011.PubMed/NCBI View Article : Google Scholar

8 

Li DD, Xu Y, Zhang DZ, Quan H, Mylonakis E, Hu DD, Li MB, Zhao LX, Zhu LH, Wang Y and Jiang YY: Fluconazole assists berberine to kill fluconazole-resistant Candida albicans. Antimicrob Agents Chemother. 57:6016–6027. 2013.PubMed/NCBI View Article : Google Scholar

9 

Nett JE, Sanchez H, Cain MT, Ross KM and Andes DR: Interface of Candida albicans biofilm matrix-associated drug resistance and cell wall integrity regulation. Eukaryot Cell. 10:1660–1669. 2011.PubMed/NCBI View Article : Google Scholar

10 

Shi W, Chen ZZ, Chen X, Cao L, Liu P and Sun S: The combination of minocycline and fluconazole causes synergistic growth inhibition against Candida albicans: An in vitro interaction of antifungal and antibacterial agents. FEMS Yeast Res. 10:885–893. 2010.PubMed/NCBI View Article : Google Scholar

11 

de Oliveira LF, Jorge AC and Santos SF: In vitro minocycline activity on superinfecting microorganisms isolated from chronic periodontitis patients. Braz Oral Res. 20:202–206. 2006.PubMed/NCBI View Article : Google Scholar

12 

Raad I, Darouiche R, Hachem R, Sacilowski M and Bodey GP: Antibiotics and prevention ofmicrobial colonization of catheters. Antimicrob Agents Chemother. 39:2397–2400. 1995.PubMed/NCBI View Article : Google Scholar

13 

Gao Y, Li H, Liu S, Zhang X and Sun S: Synergistic effect of fluconazole and doxycycline against Candida albicans biofilms resulting from calcium fluctuation and downregulation of fluconazole-inducible efflux pump gene overexpression. J Med Microbiol. 63:956–961. 2014.PubMed/NCBI View Article : Google Scholar

14 

Kurakado S, Takatori K and Sugita T: Minocycline inhibits Candida albicans budded-to-hyphal-form transition and biofilm formation. Jpn J Infect Dis. 70:490–494. 2017.PubMed/NCBI View Article : Google Scholar

15 

Li H, Liu P, Liu W, Gao Y and Sun S: In vitro interactions between fluconazole and minocycline against mixed cultures of Candida albicans and Staphylococcus aureus. J Microbiol Immunol Infect. 48:655–661. 2015.PubMed/NCBI View Article : Google Scholar

16 

Hogan DA and Sundstrom P: The Ras/cAMP/PKA signaling pathway and virulence in Candida albicans. Future Microbiol. 4:1263–1270. 2009.PubMed/NCBI View Article : Google Scholar

17 

Phillips AJ, Crowe JD and Ramsdale M: Ras pathway signaling accelerates programmed cell death in the pathogenic fungus Candida albicans. Proc Natl Acad Sci USA. 103:726–731. 2006.PubMed/NCBI View Article : Google Scholar

18 

Li DD, Zhao LX, Mylonakis E, Hu GH, Zou Y, Huang TK, Yan L, Wang Y and Jiang YY: In vitro and in vivo activities of pterostilbene against Candida albicans biofilms. Antimicrob Agents Chemother. 58:2344–2355. 2014.PubMed/NCBI View Article : Google Scholar

19 

Gimeno CJ, Ljungdahl PO, Styles CA and Fink GR: Unipolar cell divisions in the yeast S. cerevisiae lead to filamentous growth: Regulation by starvation and RAS. Cell. 68:1077–1090. 1992.PubMed/NCBI View Article : Google Scholar

20 

Zhong H, Hu DD, Hu GH, Su J, Bi S, Zhang ZE, Wang Z, Zhang RL, Xu Z, Jiang YY and Wang Y: Activity of sanguinarine against Candida albicans biofilms. Antimicrob Agents Chemother. 61:02259–16. 2017.PubMed/NCBI View Article : Google Scholar

21 

Ma C, Du F, Yan L, He G, He J, Wang C, Rao G, Jiang Y and Xu G: Potent activities of roemerine against Candida albicans and the underlying mechanisms. Molecules. 20:17913–17928. 2015.PubMed/NCBI View Article : Google Scholar

22 

Ku TS, Palanisamy S K and Lee SA: Susceptibility of Candida albicans biofilms to azithromycin, tigecycline and vancomycin and the interaction between tigecycline and antifungals. Int J Antimicrob Agents. 36:441–446. 2010.PubMed/NCBI View Article : Google Scholar

23 

Cao S, Zhang X, Ye N, Fan X, Mou S, Xu D, Liang C, Wang Y and Wang W: Evaluation of putative internal reference genes for gene expression normalization in Nannochloropsis sp. by quantitative real-time RT-PCR. Biochem Biophys Res Commun. 424:118–123. 2012.PubMed/NCBI View Article : Google Scholar

24 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

25 

Langford ML, Hargarten JC, Patefield KD, Marta E, Blankenship JR, Fanning S, Nickerson KW and Atkina AL: Candida albicans Czf1 and Efg1 coordinate the response to farnesol during quorum sensing, white-opaque thermal dimorphism, and cell death. Eukaryot Cell. 12:1281–1292. 2013.PubMed/NCBI View Article : Google Scholar

26 

Ramírez-Zavala B, Weyler M, Gildor T, Schmauch C, Kornitzer D, Arkowitz R and Morschhäuser J: Activation of the Cph1-dependent MAP kinase signaling pathway induces white-opaque switching in Candida albicans. PLoS Pathog. 9(e1003696)2013.PubMed/NCBI View Article : Google Scholar

27 

Berman J and Sudbery PE: Candida albicans: A molecular revolution built on lessons from budding yeast. Nat Rev Genet. 3:918–930. 2002.PubMed/NCBI View Article : Google Scholar

28 

Biswas S, Dijck PV and Datta A: Environmental sensing and signal transduction pathways regulating morphopathogenic determinants of Candida albicans. Microbiol Mol Biol Rev. 71:348–376. 2007.PubMed/NCBI View Article : Google Scholar

29 

Huh WK and Kang SO: Molecular cloning and functional expression of alternative oxidase from Candida albicans. J Bacteriol. 181:4098–4102. 1999.PubMed/NCBI View Article : Google Scholar

30 

Huang G, Huang Q, Wei Y, Wang Y and Du H: Multiple roles and diverse regulation of the Ras/cAMP/protein kinase A pathway in Candida albicans. Mol Microbiol. 111:6–16. 2019.PubMed/NCBI View Article : Google Scholar

31 

Stoldt VR, Sonneborn A, Leuker CE and Ernst JF: Efg1p, an essential regulator of morphogenesis of the human pathogen Candida albicans, is a member of a conserved class of bHLH proteins regulating morphogenetic processes in fungi. EMBO J. 16:1982–1991. 1997.PubMed/NCBI View Article : Google Scholar

32 

Fuller KK and Rhodes JC: Protein kinase A and fungal virulence: A sinister side to a conserved nutrient sensing pathway. Virulence. 3:109–121. 2012.PubMed/NCBI View Article : Google Scholar

33 

Cloutier M, Castilla R, Bolduc N, Zelada A, Martineau P, Bouillon M, Magee BB, Passeron S, Giasson L and Cantoreb ML: The two isoforms of the cAMP-dependent protein kinase catalytic subunit are involved in the control of dimorphism in the human fungal pathogen Candida albicans. Fungal Genet Biol. 38:133–141. 2003.PubMed/NCBI View Article : Google Scholar

34 

Feng Q, Summers E, Guo B and Fink G: Ras signaling is required for serum-induced hyphal differentiation in Candida albicans. J Bacteriol. 181:6339–6346. 1999.PubMed/NCBI View Article : Google Scholar

35 

Leberer E, Harcus D, Dignard D, Johnson L, Ushinsky S, Thomas DY and Schröppel K: Ras links cellular morphogenesis to virulence by regulation of the MAP kinase and cAMP signalling pathways in the pathogenic fungus Candida albicans. Mol microbiol. 42:673–687. 2001.PubMed/NCBI View Article : Google Scholar

36 

Cullen PJ and Sprague GJ Jr: The regulation of filamentous growth in yeast. Genetics. 190:23–49. 2012.PubMed/NCBI View Article : Google Scholar

37 

Lu Y, Su C and Liu H: Candida albicans hyphal initiation and elongation. Trends Microbiol. 22:707–714. 2014.PubMed/NCBI View Article : Google Scholar

38 

Davis-Hanna A, Piispanen AE, Stateva LI and Hogan DA: Farnesol and dodecanol effects on the Candida albicans Ras1-cAMP signalling pathway and the regulation of morphogenesis. Mol Microbiol. 67:47–62. 2008.PubMed/NCBI View Article : Google Scholar

39 

Zhu Y, Fang HM, Wang YM, Zeng GS, Zheng XD and Wang Y: Ras1 and Ras2 play antagonistic roles in regulating cellular cAMP level, stationary-phase entry and stress response in Candida albicans. Mol Microbiol. 74:862–875. 2009.PubMed/NCBI View Article : Google Scholar

40 

Lin CJ, Wu CY, Yu SJ and Chen YL: Protein kinase A governs growth and virulence in Candida tropicalis. Virulence. 9:331–347. 2018.PubMed/NCBI View Article : Google Scholar

41 

Souto G, Giacometti R, Silberstein S, Giasson L, Cantore ML and Passeron S: Expression of TPK1 and TPK2 genes encoding PKA catalytic subunits during growth and morphogenesis in Candida albicans. Yeast. 23:591–603. 2006.PubMed/NCBI View Article : Google Scholar

42 

Lin CJ and Chen YL: Conserved and divergent functions of the cAMP/PKA signaling pathway in Candida albicans and Candida tropicalis. J Fungi (Basel). 4(68)2018.PubMed/NCBI View Article : Google Scholar

43 

Bahn YS, Staab J and Sundstrom P: Increased high-affinity phosphodiesterase PDE2 gene expression in germ tubes counteracts CAP1-dependent synthesis of cyclic AMP, limits hypha production and promotes virulence of Candida albicans. Mol Microbiol. 50:391–409. 2003.PubMed/NCBI View Article : Google Scholar

44 

Nobile CJ, Fox EP, Nett JE, Sorrells TR, Mitrovich QM, Hernday AD, Tuch BB, Andes DR and Johnson AD: A recently evolved transcriptional network controls biofilm development in Candida albicans. Cell. 148:126–138. 2012.PubMed/NCBI View Article : Google Scholar

45 

Tebarth B, Doedt T, Krishnamurthy S, Weide M, Monterola F, Dominguez A and Ernst JF: Adaptation of the Efg1p morphogenetic pathway in Candida albicans by negative autoregulation and PKA-dependent repression of the EFG1 gene. J Mol Biol. 329:949–962. 2003.PubMed/NCBI View Article : Google Scholar

46 

Parrino SM, Si H, Naseem S, Groudan K, Gardin J and Konopka JB: cAMP-independent signal pathways stimulate hyphal morphogenesis in Candida albicans. Mol Microbiol. 103:764–779. 2017.PubMed/NCBI View Article : Google Scholar

47 

Lopes da Rosa J and Kaufman PD: Chromatin-mediated Candida albicans virulence. Biochim Biophys Acta. 1819:349–355. 2012.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zou L, Mei Z, Guan T, Zhang B and Deng Q: Underlying mechanisms of the effect of minocycline against <em>Candida albicans</em> biofilms. Exp Ther Med 21: 413, 2021.
APA
Zou, L., Mei, Z., Guan, T., Zhang, B., & Deng, Q. (2021). Underlying mechanisms of the effect of minocycline against <em>Candida albicans</em> biofilms. Experimental and Therapeutic Medicine, 21, 413. https://doi.org/10.3892/etm.2021.9857
MLA
Zou, L., Mei, Z., Guan, T., Zhang, B., Deng, Q."Underlying mechanisms of the effect of minocycline against <em>Candida albicans</em> biofilms". Experimental and Therapeutic Medicine 21.5 (2021): 413.
Chicago
Zou, L., Mei, Z., Guan, T., Zhang, B., Deng, Q."Underlying mechanisms of the effect of minocycline against <em>Candida albicans</em> biofilms". Experimental and Therapeutic Medicine 21, no. 5 (2021): 413. https://doi.org/10.3892/etm.2021.9857
Copy and paste a formatted citation
x
Spandidos Publications style
Zou L, Mei Z, Guan T, Zhang B and Deng Q: Underlying mechanisms of the effect of minocycline against <em>Candida albicans</em> biofilms. Exp Ther Med 21: 413, 2021.
APA
Zou, L., Mei, Z., Guan, T., Zhang, B., & Deng, Q. (2021). Underlying mechanisms of the effect of minocycline against <em>Candida albicans</em> biofilms. Experimental and Therapeutic Medicine, 21, 413. https://doi.org/10.3892/etm.2021.9857
MLA
Zou, L., Mei, Z., Guan, T., Zhang, B., Deng, Q."Underlying mechanisms of the effect of minocycline against <em>Candida albicans</em> biofilms". Experimental and Therapeutic Medicine 21.5 (2021): 413.
Chicago
Zou, L., Mei, Z., Guan, T., Zhang, B., Deng, Q."Underlying mechanisms of the effect of minocycline against <em>Candida albicans</em> biofilms". Experimental and Therapeutic Medicine 21, no. 5 (2021): 413. https://doi.org/10.3892/etm.2021.9857
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team