Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
April-2022 Volume 23 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2022 Volume 23 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Curcumin ameliorates H2O2‑induced inflammatory response in chondrocytes by inducing autophagy activation

  • Authors:
    • Hai-Liang Qi
    • Zheng-Yi Chen
    • Yu-Huan Qin
    • Ya-Zhai Li
  • View Affiliations / Copyright

    Affiliations: Department of Thoracic Surgery, Hebei Provincial Chest Hospital, Shijiazhuang, Hebei 050041, P.R. China, Department of Surgery, Hebei Provincial Gucheng County Hospital, Gucheng, Hebei 253800, P.R. China, Department of Rehabilitation and Physical Medicine, Hebei Provincial Gucheng County Hospital, Gucheng, Hebei 253800, P.R. China, Department of Pharmacy, Hebei Provincial Chest Hospital, Shijiazhuang, Hebei 050041, P.R. China
    Copyright: © Qi et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 272
    |
    Published online on: February 9, 2022
       https://doi.org/10.3892/etm.2022.11198
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Relapsing polychondritis (RP) is a clinical disease characterized by inflammation of cartilage tissue and chondrocytes. The principal curcuminoid curcumin is the most active component in turmeric and has been reported to have a chondroprotective effect, including anti‑inflammatory activity, which is vitally important for mitigating RP symptoms and prognosis. However, the mechanisms underlying these actions have remained to be fully elucidated. In the present study, the chondroprotective mechanisms of curcumin on hydrogen peroxide (H2O2)‑treated primary chondrocytes were examined in vitro. The viability of chondrocytes treated with H2O2 was significantly reduced in a dose‑ and time‑dependent manner. Cotreatment of curcumin with H2O2 significantly decreased growth inhibition. It was observed that curcumin inhibited the expression levels of the inflammatory mediators interleukin (IL)‑1β, IL‑6 and inducible nitric oxide synthase and induced autophagy activation. Curcumin increased the protein levels of the autophagy marker beclin‑1 and light chain 3‑II and decreased the expression levels of P62 in H2O2‑treated chondrocytes. The curcumin‑induced anti‑inflammatory effects were markedly abrogated by the autophagy inhibitor 3‑methyladenine. In conclusion, the present study suggested that curcumin regulates inflammatory factors by activating autophagy in chondrocytes. The protective role of curcumin in chondrocytes was demonstrated, suggesting that it should be explored for the prophylactic treatment of RP in the clinic in the future.

Introduction

Relapsing polychondritis (RP) is a clinical disease, which is characterized by the inflammation of systemic cartilage tissues such as the external auricle, nose, respiratory tract and joints, and a pattern of repeated remission and recurrence (1). However, identifying effective treatment strategies for RP remains a challenge. It is well known that inflammatory response in chondrocytes is one of the most important risk factors in the pathogenesis of RP, which is influenced by oxidative stress (2). H2O2 is a common agent and may lead to DNA damage by inducing oxidative stress. It is necessary to deeply explore the molecular mechanisms underlying the suppression of inflammation in chondrocytes under oxidative stress, which is responsible for cartilage destruction in the progression of RP. Therefore, the suppression of inflammatory responses in chondrocytes may be an effective strategy to delay RP progression.

Curcumin is a promising pharmacologically active natural product, which is extracted from turmeric (Curcuma longa) and has significant anti-inflammatory, anti-oxidant and anti-cancer properties (3). Previous studies have reported on the anti-inflammatory effects of curcumin in various common diseases, including chronic inflammation, cancer, cardiovascular disease and osteoarthritis (4-7). Furthermore, it was suggested that curcumin may exert anti-inflammatory effects in several chronic diseases by activating the nuclear factor E2-related factor 2 (Nrf2) signaling pathway (8). However, the roles of curcumin in chondrocytes and the underlying mechanisms remain elusive.

Previous studies have indicated that the reactivation of autophagy is a promising therapeutic strategy for the suppression of inflammation (9,10). Autophagy, a cellular conservation and self-digestion system, is accurately regulated by a family of autophagy regulators and autophagy-related proteins and homologues. It is controlled by a series of different signaling pathways such as MAPK, phosphoinositide-3 kinase (PI3K) and mTOR (11-13), which coordinate autophagy by regulating autophagosome formation and autophagosome-lysosome fusion. Autophagy mediates the degradation of dysfunctional proteins and damaged organelles for energy recycling to maintain the metabolic regulation and nutrition maintenance of the cell under oxidative stress (14). Recently, pharmacological suppression studies to reduce cell inflammation have repeatedly demonstrated the protective effect of autophagy on cells under abnormal physiological conditions, including external pressure, hypoalimentation, hypoxia and endoplasmic reticulum stress (15,16). In rats with osteoarthritis, β-ecdysterone promoted the autophagic flux of chondrocytes by regulating the PI3K/AKT/mTOR signaling pathway and attenuated the inflammatory response (17). In addition, curcumin was reported to exert a neuroprotective effect by inducing autophagic activities via the PI3K/Akt/mTOR pathway and suppresses inflammatory reactions through the Toll-like receptor 4/p38/MAPK pathway (18). However, whether curcumin mediates the suppression of the inflammatory response by inducing autophagic activities in chondrocytes has remained elusive.

Therefore, the present study aimed to explore the role of curcumin on the inflammatory response of chondrocytes and its correlation with autophagy in a hydrogen peroxide (H2O2)-induced inflammation model in vitro.

Materials and methods

Materials

Dulbecco's Modified Eagle's Medium F-12 (DMEM-F12) and FBS were purchased from Corning Life Sciences. Curcumin (cat. no. HY-N0005, >96.0%) purchased from MedChemExpress was dissolved in DMSO and then diluted with culture medium for cell experiments. H2O2 solution (cat. no. 106097; 34.5-36.5%) was purchased from Merck KGaA. 3-Methyladenine (3-MA; cat. no. HY-19312) was obtained from MedChemExpress and prepared as a 100 mM stock solution in PBS. Protease inhibitors were purchased from MilliporeSigma. An ECL chemiluminescence detection kit (SuperSignal HRP; cat. no. 46640) was from Pierce (Thermo Fisher Scientific, Inc.).

Cell isolation and culture

A total of 20 male Sprague-Dawley rats (weight, 200-220 g) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. All Sprague Dawley rats were reared under specific pathogen-free conditions. Rats were housed under laminar flow in an isolated room with controlled temperature and at a 12-h light/dark cycle. Food and water were available ad libitum. The rats were sacrificed by injecting 100-200 mg/kg pentobarbital sodium at the end of the experiments. Death of rats was confirmed by observation of respiration and heartbeat. Primary chondrocytes were isolated from the bilateral hip joints of 4-week-old male rats. The cartilage of the rat hip joint was cut into 1 mm3 pieces in a sterile manner and then treated with 0.25% (V/V) trypsin/EDTA (cat. no. C0201; Beyotime Institute of Biotechnology) for 1 h and digested with 0.2% (V/V) collagenase II (cat. no. C2-28; Sigma-Aldrich; Merck KGaA) in DMEM-F12 at 37˚C in an atmosphere with 5% CO2 for 6 h. Next, the suspensions were centrifuged at 1,609 x g at room temperature for 5 min and cultured at 37˚C under 5% CO2 in DMEM-F12 with 10% (V/V) FBS, 1% (V/V) penicillin and streptomycin. Primary chondrocytes from the first passage were used for in vitro experiments.

Cell proliferation assay

The effect of curcumin and H2O2 on chondrocytes was assessed with a CCK-8 (cat. no. CK04; Dojindo Laboratories, Inc.) according to the manufacturer's protocol. In brief, after treatment, cells were cultured in 96-well plates with a density of 5x103 cells/well for 24 h. Subsequently, CCK-8 solution was added to each well and the cells were further incubated at 37˚C in the dark for 1 h. The optical density values were detected at wavelengths of 450 nm.

Monodansylcadaverine (MDC) assay

MDC was used to fluorescently label autophagic lysosomes in the cytoplasm. Cells were seeded on sterile glass slides in cell culture media. In the curcumin+H2O2+3-MA group, chondrocytes were pretreated with 20 µM curcumin for ~2 h, followed by incubation with 20 µM H2O2 and 10 mM 3-MA at 37˚C for 24 h. In the rapamycin group, chondrocytes were pretreated with 7.5 µM rapamycin. In the other groups, chondrocytes were pretreated with or without 20 µM curcumin for ~2 h, followed by treatment with or without 20 µM H2O2 at 37˚C for 24 h. Subsequently, chondrocytes were treated with MDC (0.05 mM) at 37˚C for 30 min and were then washed with PBS three times. The samples were immediately analyzed by confocal microscopy (Olympus Corporation). Excitation wavelengths were 360-380 nm and images were captured under a microscope at x200 magnification from 20 separate randomly selected microscopic fields. MDC-specific activity was calculated as the number of cells with morphological features of autophagy as determined by scoring 100 cells from 20 different microscopic fields.

Western blot analysis

To examine the function of curcumin on apoptosis induced by H2O2 on chondrocytes, the total cellular protein was extracted by using a radioimmunoprecipitation assay lysis buffer (main components, pH 7.4; 50 mM Tris, 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, sodium orthovanadate, sodium fluoride, EDTA and leupeptin; cat. no. P0013B; Beyotime Institute of Biotechnology) supplemented with protease inhibitor cocktail (cat. no. 1081; Beyotime Institute of Biotechnology). The concentration of the protein in different groups was measured by a BCA protein assay kit (cat. no. P0009; Beyotime Institute of Biotechnology). Subsequently, 30 µg of protein in each group was separated by 15% SDS-PAGE and electrotransferred to PVDF membranes (cat. no. 162-0177; Bio-Rad Laboratories, Inc.). Following blocking with 5% skimmed milk powder (cat. no. P0216; Beyotime Institute of Biotechnology) in Tris-buffered saline containing 0.1% Tween-20 (TBST) for 90 min at room temperature, membranes were incubated overnight at 4˚C with the following primary antibodies: IL-1β (dilution, 1:1,000; cat. no. ab283818; Abcam), IL-6 (dilution, 1:1,000; cat. no. ab259341; Abcam), inducible nitric oxide synthase (iNOS; dilution, 1:1,000; cat. no. ab178945; Abcam), beclin-1 (dilution, 1:1,000; cat. no. ab207612; Abcam), P62 (dilution, 1:1,000; cat. no. ab109012; Abcam), light chain (LC)3 (dilution, 1:1,000; cat. no. ab192890; Abcam) and β-actin (dilution, 1:1,000; cat. no. ab6276, Abcam). The next day, the blots were washed with TBST five times for 30 min and incubated with secondary antibodies (dilution, 1:20,000; cat. no. ab288151; Abcam) at room temperature for 90 min. Then membranes were washed with TBST five times. An imaging system (Li-Cor Biosciences, Inc.) was used to detect and analyze the density of each band.

Reverse transcription-quantitative (RT-q)PCR analysis

Following the manufacturer's protocol, the total RNA was isolated by an RNA extraction kit (cat. no. 28306; Qiagen GmbH). The quality [criterion, optical density at 260 nm (OD260)/OD280=1.8-2.0] and concentration of RNA in each group were assessed using a NanoDrop 2000 (Thermo Fisher Scientific, Inc.), while any RNA contamination and degradation were detected on 1% agarose gels. Eventually, 1,000 ng of total RNA was reverse transcribed to synthesize cDNA with the PrimeScript™ RT Master Mix (cat. no. RR036A; Takara Biotechnology, Co., Ltd.). Real-time PCR was performed in triplicate by using SYBR green PCR Master Mix (cat. no. 640210; Takara Biotechnology, Co., Ltd.). The amplification was conducted using the following cycling conditions: 5 sec at 95˚C, 20 sec at 63.5˚C and 10 sec at 72˚C for 40 cycles. The amplification efficiency of the qPCR was 95.6% and the relative mRNA expression level of the target gene was determined using the 2-ΔΔCq method (19). The sequences of the forward and reverse primers of target genes are presented in Table I.

Table I

Primer sequences used for real-time PCR.

Table I

Primer sequences used for real-time PCR.

Primer/gene nameSequences (5' to 3')
IL-1β F CAACCAACAAGTGATATTCTCCATG
IL-1β R GATCCACACTCTCCAGCTGCA
IL-6 F ACTTCCATCCAGTTGCCTTCTTGG
IL-6 R TTAAGCCTCCGACTTGTGAAGTGG
iNOS F AGTCAACTACAAGCCCCACG
iNOS R GCAGCTTGTCCAGGGATTCT
GAPDH F GCATCTTCTTGTGCAGTGCC
GAPDH R GATGGTGATGGGTTTCCCGT

[i] F, forward; R, reverse; iNOS, inducible nitric oxide synthase.

ELISA

The concentrations of IL-1β and IL-6 in the culture supernatants from chondrocytes treated with the different stimuli were determined using commercial ELISA kits (cat. nos. KE1002 and KE1003; Proteintech Group, Inc.) following the manufacturer's instructions. The absorbance at 450 nm was detected with a Multiskan Ascant (SPECTRAFluor Plus; Tecan Group, Ltd.).

Statistical analysis

The experiments were performed as at least three independent experiments. The results are presented as the mean ± standard deviation. SPSS 13.0 software (SPSS Inc.) was used to analyze the data. Comparisons among multiple groups were performed using a one-way or two-way ANOVA followed by a Tukey's post-hoc test. P<0.05 was considered to indicate statistical significance.

Results

Effect of various concentrations of curcumin on chondrocyte viability in the presence or absence of H2O2

The effect of curcumin on chondrocyte viability with or without H2O2 was studied at different concentrations for 24, 48 and 72 h by the CCK-8 assay. Curcumin exerted no significant cytotoxic effect at concentrations of up to 20 µM at different time-points (Fig. 1A). The results also indicated that 20 µM H2O2 significantly inhibited the viability of chondrocytes (P<0.05; Fig. 1B), whereas curcumin (<20 µM) markedly increased the viability of chondrocytes in a dose-dependent manner (P<0.01; Fig. 1C). To mimic the oxidative stress of RP in vitro, 20 µM H2O2 was used to treat rat chondrocytes for 24 h. Thus, 20 µM of curcumin and 20 µM of H2O2 were used for the next experiments.

Figure 1

Effects of curcumin on chondrocyte viability with or without H2O2. (A) The cytotoxic effects of curcumin on chondrocytes were examined at various concentrations for 24, 48 and 72 h with a CCK-8 kit. (B) The cytotoxic effects of H2O2 on chondrocytes were examined at various concentrations for 24, 48 and 72 h with a CCK-8 kit. (C) Viability of H2O2-treated (20 µM) chondrocytes after curcumin treatment. *P<0.05, **P<0.01, ***P<0.001 vs. the control group; #P<0.05, ##P<0.01 vs. the H2O2 treatment group. All values are expressed as the mean ± standard deviation (n=3). CCK-8, Cell Counting Kit-8.

Curcumin inhibits H2O2-induced chondrocyte inflammation

To explore the effects of curcumin on H2O2-induced chondrocyte inflammation, chondrocytes were pretreated with curcumin for 2 h at 10 and 20 µM and were exposed to H2O2 for another 24 h. Subsequently, it was examined whether curcumin affects H2O2-induced IL-1β, IL-6 and iNOS mRNA levels. RT-qPCR analyses indicated that curcumin treatment inhibited IL-1β, IL-6 and iNOS mRNA expression levels as compared to the levels found in cells treated only with H2O2 (P<0.05; Fig. 2A-C). In addition, western blot analysis also indicated that curcumin treatment inhibited the H2O2-induced increases in the protein levels of inflammatory indicators, including IL-1β, IL-6 and iNOS (P<0.05; Fig. 2D and E). Furthermore, the production of IL-1β and IL-6 in the culture supernatant was detected by an ELISA kit and the results suggested that curcumin treatment markedly inhibited the H2O2-induced secretion of IL-1β and IL-6 (P<0.05; Fig. 2F). In conclusion, curcumin inhibited H2O2-induced chondrocyte inflammation at the RNA and protein levels.

Figure 2

Curcumin inhibits the expression of H2O2-induced inflammatory mediators in chondrocytes. Chondrocytes were pretreated with curcumin (10 or 20 µM) for 2 h followed by H2O2 (20 µM) for 24 h. Protein and RNA samples were harvested. (A) IL-6, (B) IL-1β and (C) iNOS mRNA expression was measured by reverse transcription-quantitative PCR. GAPDH was used as an internal control. (D and E) IL-1β, IL-6 and iNOS protein expression was determined using western blot analysis. (D) Representative western blot and (E) quantified protein levels. (F) The production of IL-1β and IL-6 was also detected by ELISA. Values are expressed as the mean ± standard deviation (n=3). One-way ANOVA followed by Tukey's post-hoc test was used for statistical analysis. **P<0.01, ***P<0.001, ****P<0.0001 vs. H2O2-untreated group; #P<0.05, ##P<0.01, ###P<0.001, ####P<0.0001 vs. H2O2-treated group. iNOS, inducible nitric oxide synthase.

Curcumin treatment promotes autophagy of chondrocytes

MDC staining and western blot analysis were used to examine whether curcumin is able to induce autophagy in chondrocytes. In early endosome compartments, no MDC accumulates may be observed, but certain accumulates are present in mature autophagic vacuoles (AVs), such as autophagolysosomes (20). AVs stained by MDC appear as distinct dot-like structures distributed within the cytoplasm or localized in the perinuclear regions and were detected under a fluorescence microscope by scanning the cells. As presented in Fig. 3A, there was an increase in the number of MDC-labeled positive vesicles at 24 h after curcumin treatment. The effects of curcumin were inhibited by H2O2. This observation was further confirmed by examining the expression levels of the autophagy-related markers LC3-I/II using western blot analysis. The expression of LC3II was significantly increased, while the expression of P62 was significantly reduced after curcumin treatment compared to the group without treatment, but there was no significant effect in inducing LC3II expression in the H2O2 group (P<0.01; Fig. 3C-F). Therefore, curcumin promoted autophagy of chondrocytes.

Figure 3

Curcumin activates autophagy within chondrocytes. (A and B) Curcumin-induced autophagy was detected by MDC staining. (A) Representative image of staining (arrows indicate autophagic vacuoles; scale bar, 20 µm) and (B) quantified MDC activity at 24 h. (C-F) The levels of beclin-1, P62 and LC3-I/II were assessed using western blot analysis. (C) Representative western blot and quantified expression of (D) beclin-1, (E) P62 and (F) LC3-I/II. Values are expressed as the mean ± standard deviation (n=3). **P<0.01, ***P<0.001 vs. control group; ##P<0.01, ###P<0.001 vs. H2O2 treatment group. LC3, light chain 3; MDC, monodansylcadaverine.

Autophagy inhibition abrogates the anti-inflammatory and protective effects of curcumin in inflammatory chondrocytes

To study the role of autophagy in the anti-inflammatory and chondroprotective effects of curcumin, chondrocytes were treated with the inhibitor of autophagy 3-MA. Under stimulation with H2O2, inhibition of autophagy abolished the curcumin-mediated downregulation of the mRNA and protein levels of IL-1β, IL-6 and iNOS (P<0.05; Fig. 4). These findings indicated that autophagy is a pivotal factor in the curcumin-mediated suppression of inflammation in chondrocytes.

Figure 4

Autophagy inhibition abrogates the anti-inflammatory and chondroprotective effects of curcumin in inflammatory chondrocytes. Chondrocytes were pretreated with or without curcumin (20 µM) for 2 h, followed by treatment with or without H2O2 (20 µM) for 24 h. Chondrocytes were then treated with 3-MA (50 nM), curcumin (20 µM) or 3-MA+curcumin. (A) IL-1β, (B) IL-6 and (C) iNOS mRNA expression was measured by reverse transcription-quantitative PCR. GAPDH was used as an internal control. (D and E) IL-1β, IL-6 and iNOS protein expression was determined using western blot analysis. (D) Representative western blot and (E) quantified protein levels. (F) The production of IL-1β and IL-6 was detected by ELISA. Values are expressed as the mean ± standard deviation (n=3). One-way ANOVA followed by Tukey's post-hoc test was used for statistical analysis. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 vs. H2O2 treatment group; ##P<0.01, ###P<0.001 vs. curcumin + H2O2 treatment group. iNOS, inducible nitric oxide synthase; 3-MA, 3-methyladenine.

Discussion

The present study reported the following: i) Treatment of chondrocytes with 20 µM H2O2 results in viability inhibition and inflammation; ii) H2O2-induced chondrocyte inflammation was decreased by pretreatment with curcumin in a time-dependent manner; iii) curcumin's anti-inflammatory effects were mediated by the induction of chondrocyte autophagy; and iv) autophagy inhibitor 3-MA abolished the curcumin-mediated downregulation of inflammation factors.

The present results implied that autophagy is necessary to suppress chondrocyte inflammation. Curcumin is known for its underlying anti-inflammatory and antioxidant activity. Curcumin suppresses IL-1β secretion and prevents inflammation through inhibition of the NLR family pyrin domain containing 3 inflammasome (21). More importantly, curcumin is able to inhibit oxidative stress by regulating the Nrf2/heme oxygenase-1 signaling pathway to prevent aflatoxin B1-induced hepatotoxicity (4). In Saos-2 cells, curcumin ameliorated apoptosis by inhibiting oxidative stress and it attenuated palmitic acid-induced cell apoptosis by inhibiting endoplasmic reticulum stress (22-24). Further, related mechanistic studies suggested that curcumin is able to modulate autophagy (25). These data are consistent with the present results.

Various previous studies have reported that autophagy is constitutively active in chondrocytes (26,27). Appropriate autophagy has a housekeeping role in preventing diseases such as cancer, cardiomyopathy, diabetes, liver diseases and autoimmune diseases, as well as neurodegeneration and infections (28-34). It is a well-conserved mechanism and has been confirmed to be important in various physical events. Beclin-1 and LC3 are major regulators and markers of the autophagy pathway among the human autophagy genes (35). The nucleation of autophagic vesicles relies on beclin-1, which may consequently lead to the formation of a complex with type III phosphatidylinositol. LC3-I is converted to LC3-II, which is then attached to the membrane of the autophagosome during autophagy activation. The BH3 domain of beclin-1 interacts with Bcl-2 and lead to inhibition of beclin-1-induced autophagy activation. Sequestosome 1 (SQSTM1/p62) is an important autophagy receptor protein. It is able to bind and deliver polyubiquitinated proteins to the autophagy pathway for degradation. It is important that SQSTM1/p62 is able to induce NF-κB signaling pathway activation by recruiting TNF receptor-associated factors (TRAFs) to TRAF binding sites in CD40(36), but its effect may be inhibited after the silencing of p62(37). Of note, p62 and certain other proteins that activate the NF-κB signaling pathway may also be degraded in the selective autophagy pathway (38). There is a complex regulatory relationship between p62-mediated autophagy and NF-κB signaling pathway activation (39). A study reported that p62 is able to improve the expression of antioxidant genes by binding to kelch-like ECH-associated protein 1, leading to activation of the Nrf2 signaling pathway (40). In short, p62-mediated induction of Nrf2 reduces inflammatory responses by inhibiting the activation of the NF-κB signaling pathway during autophagy (41). In the present study, it was observed that curcumin raised the LC3-II/LC3-I ratio and decreased p62 expression in chondrocytes. This effect was reconciled with accelerated autophagy and mitigated inflammatory responses.

RP is a clinical disease characterized by a pattern of repeated remission and recurrence of systemic inflammation, in some cases followed by destruction, affecting the cartilage of the ears, nose, larynx, joints and tracheobronchial tree (42,43). Previous studies have revealed that inflammation, oxidative stress and matrix degradation are important factors associated with RP (2). It has been indicated that cell inflammation may be effectively inhibited by moderate autophagy activity (44). In the present study, an increase in autophagic activity induced by curcumin treatment was observed. In chondrocytes, autophagy is likely to be a self-protective process induced by curcumin in response to H2O2 stimulation. To confirm this, it was demonstrated that when chondrocytes were pretreated with curcumin and then cotreated with H2O2 and 3-MA, chondrocyte inflammation clearly increased and autophagy was decreased.

In conclusion, the present study suggested that autophagy is vital for chondrocyte inflammation, whereas the self-activation of autophagy is a protective mechanism against inflammation under curcumin treatment. This suggested that the anti-inflammatory effects of curcumin are mediated, at least in part, by the autophagy signaling pathway. The present study provided a theoretical basis for the treatment of RP in the clinic.

Acknowledgements

Not applicable.

Funding

Funding: This work was supported by the National Natural Science Foundation of China (grant no. 82103181) and the Scientific Research Foundation of Hebei Administration of Traditional Chinese Medicine (grant no. 2022383).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

YZL was responsible for the conception and design of the study. HLQ and ZYC were involved in data acquisition. YHQ was involved in the development of the study methodology, analysis and interpretation of the data. HLQ, ZYC, YHQ and YZL were involved in the writing, reviewing and revision of the article, and analyzed the relevant literature. HLQ and YZL confirmed the authenticity of the raw data. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

All experiments were approved by the Laboratory Animal Care and Use Committee of Hebei Medical University (approval ID: HebMU 20200026; Shijiazhuang, China) and were conducted in accordance with National Institutes of Health guidelines.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Norooznezhad F, Rodriguez-Merchan EC, Asadi S and Norooznezhad AH: Curcumin: Hopeful treatment of hemophilic arthropathy via inhibition of inflammation and angiogenesis. Expert Rev Hematol. 13:5–11. 2020.PubMed/NCBI View Article : Google Scholar

2 

de Montmollin N, Dusser D, Lorut C, Dion J, Costedoat-Chalumeau N, Mouthon L, Chassagnon G, Revel MP and Puéchal X: Tracheobronchial involvement of relapsing polychondritis. Autoimmun Rev. 8(102353)2019.PubMed/NCBI View Article : Google Scholar

3 

D'Cruz DP and Ferrada MA: Relapsing polychondritis and large-vessel vasculitis. J Rheumatol. 47:1732–1733. 2020.PubMed/NCBI View Article : Google Scholar

4 

Yin H, Guo Q, Li X, Tang T, Li C, Wang H, Sun Y, Feng Q, Ma C, Gao C, et al: Curcumin suppresses IL-1β secretion and prevents inflammation through inhibition of the NLRP3 inflammasome. J Immunol. 200:2835–2846. 2018.PubMed/NCBI View Article : Google Scholar

5 

Burge K, Gunasekaran A, Eckert J and Chaaban H: Curcumin and intestinal inflammatory diseases: Molecular mechanisms of protection. Int J Mol Sci. 20(1912)2019.PubMed/NCBI View Article : Google Scholar

6 

Deguchi A: Curcumin targets in inflammation and cancer. Endocr Metab Immune Disord Drug Targets. 15:88–96. 2015.PubMed/NCBI View Article : Google Scholar

7 

Yavarpour-Bali H, Ghasemi-Kasman M and Pirzadeh M: Curcumin-loaded nanoparticles: A novel therapeutic strategy in treatment of central nervous system disorders. Int J Nanomedicine. 14:4449–4460. 2019.PubMed/NCBI View Article : Google Scholar

8 

Kunnumakkara AB, Bordoloi D, Padmavathi G, Monisha J, Roy NK, Prasad S and Aggarwal BB: Curcumin, the golden nutraceutical: Multitargeting for multiple chronic diseases. Br J Pharmacol. 174:1325–1348. 2017.PubMed/NCBI View Article : Google Scholar

9 

Cao Y, Chen J, Ren G, Zhang Y, Tan X and Yang L: Punicalagin prevents inflammation in LPS-induced RAW264.7 macrophages by inhibiting FoxO3a/Autophagy signaling pathway. Nutrients. 11(2794)2019.PubMed/NCBI View Article : Google Scholar

10 

Matsuzawa-Ishimoto Y, Hwang S and Cadwell K: Autophagy and inflammation. Annu Rev Immunol. 36:73–101. 2018.PubMed/NCBI View Article : Google Scholar

11 

Ho J, Yu J, Wong SH, Zhang L, Liu X, Wong WT, Leung CC, Choi G, Wang MH, Gin T, et al: Autophagy in sepsis: Degradation into exhaustion? Autophagy. 12:1073–1082. 2016.PubMed/NCBI View Article : Google Scholar

12 

Pozuelo-Rubio M: 14-3-3 proteins are regulators of autophagy. Cells. 1:754–773. 2012.PubMed/NCBI View Article : Google Scholar

13 

Martinet W, Agostinis P, Vanhoecke B, Dewaele M and De Meyer GR: Autophagy in disease: A double-edged sword with therapeutic potential. Clin Sci (Lond). 116:697–712. 2009.PubMed/NCBI View Article : Google Scholar

14 

Kuma A, Komatsu M and Mizushima N: Autophagy-monitoring and autophagy-deficient mice. Autophagy. 13:1619–1628. 2017.PubMed/NCBI View Article : Google Scholar

15 

Renga G, Oikonomou V, Stincardini C, Pariano M, Borghi M, Costantini C, Bartoli A, Garaci E, Goldstein AL and Romani L: Thymosin β4 limits inflammation through autophagy. Expert Opin Biol Ther. 18 (Suppl 1):S171–S175. 2018.PubMed/NCBI View Article : Google Scholar

16 

Cui SN, Chen ZY, Yang XB, Chen L, Yang YY, Pan SW, Wang YX, Xu JQ, Zhou T, Xiao HR, et al: Trichostatin A modulates the macrophage phenotype by enhancing autophagy to reduce inflammation during polymicrobial sepsis. Int Immunopharmacol. 77(105973)2019.PubMed/NCBI View Article : Google Scholar

17 

Tang Y, Mo Y, Xin D, Zeng L, Yue Z and Xu C: β-ecdysterone alleviates osteoarthritis by activating autophagy in chondrocytes through regulating PI3K/AKT/mTOR signal pathway. Am J Transl Res. 12:7174–7186. 2020.PubMed/NCBI

18 

Huang L, Chen C, Zhang X, Li X, Chen Z, Yang C, Liang X, Zhu G and Xu Z: Neuroprotective effect of curcumin against cerebral ischemia-reperfusion via mediating autophagy and inflammation. J Mol Neurosci. 64:129–139. 2018.PubMed/NCBI View Article : Google Scholar

19 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

20 

Munafó DB and Colombo MI: A novel assay to study autophagy: Regulation of autophagosome vacuole size by amino acid deprivation. J Cell Sci. 114:3619–3629. 2001.PubMed/NCBI View Article : Google Scholar

21 

Muhammad I, Wang X, Li S, Li R and Zhang X: Curcumin confers hepatoprotection against AFB1-induced toxicity via activating autophagy and ameliorating inflammation involving Nrf2/HO-1 signaling pathway. Mol Biol Rep. 45:1775–1785. 2018.PubMed/NCBI View Article : Google Scholar

22 

Shakibaei M, Mobasheri A and Buhrmann C: Curcumin synergizes with resveratrol to stimulate the MAPK signaling pathway in human articular chondrocytes in vitro. Genes Nutr. 6:171–179. 2011.PubMed/NCBI View Article : Google Scholar

23 

Mobasheri A, Henrotin Y, Biesalski HK and Shakibaei M: Scientific evidence and rationale for the development of curcumin and resveratrol as nutraceutricals for joint health. Int J Mol Sci. 13:4202–4232. 2012.PubMed/NCBI View Article : Google Scholar

24 

Csaki C, Mobasheri A and Shakibaei M: Synergistic chondroprotective effects of curcumin and resveratrol in human articular chondrocytes: Inhibition of IL-1beta-induced NF-kappaB-mediated inflammation and apoptosis. Arthritis Res Ther. 11(R165)2009.PubMed/NCBI View Article : Google Scholar

25 

Chen T, Zhou R, Chen Y, Fu W, Wei X, Ma G, Hu W and Lu C: Curcumin ameliorates IL-1β-induced apoptosis by activating autophagy and inhibiting the NF-κB signaling pathway in rat primary articular chondrocytes. Cell Biol Int. 45:976–988. 2021.PubMed/NCBI View Article : Google Scholar

26 

Caramés B, Taniguchi N, Otsuki S, Blanco FJ and Lotz M: Autophagy is a protective mechanism in normal cartilage, and its aging-related loss is linked with cell death and osteoarthritis. Arthritis Rheum. 62:791–801. 2010.PubMed/NCBI View Article : Google Scholar

27 

Settembre C, Arteaga-Solis E, McKee MD, de Pablo R, Al Awqati Q, Ballabio A and Karsenty G: Proteoglycan desulfation determines the efficiency of chondrocyte autophagy and the extent of FGF signaling during endochondral ossification. Genes Dev. 22:2645–2650. 2008.PubMed/NCBI View Article : Google Scholar

28 

Patergnani S, Missiroli S, Morciano G, Perrone M, Mantovani CM, Anania G, Fiorica F, Pinton P and Giorgi C: Understanding the role of autophagy in cancer formation and progression is a real opportunity to treat and cure human cancers. Cancers (Basel). 13(5622)2021.PubMed/NCBI View Article : Google Scholar

29 

Ikeda S, Zablocki D and Sadoshima J: The role of autophagy in death of cardiomyocytes. J Mol Cell Cardiol. 165:1–8. 2021.PubMed/NCBI View Article : Google Scholar

30 

Farber E, Hanut A, Tadmor H, Ruth A, Nakhoul F and Nakhoul N: Autophagy and diabetic nephropathy. Harefuah. 160:740–745. 2021.PubMed/NCBI(In Hebrew).

31 

Zhou JC, Wang JL, Ren HZ and Shi XL: Autophagy plays a double-edged sword role in liver diseases. J Physiol Biochem. Oct 18, 2021. (Epub ahead of print). doi: 10.1007/s13105-021-00844-7.

32 

Wu MY, Wang EJ, Feng D, Li M, Ye RD and Lu JH: Pharmacological insights into autophagy modulation in autoimmune diseases. Acta Pharm Sin B. 11:3364–3378. 2021.PubMed/NCBI View Article : Google Scholar

33 

Sriram N and Sah MK: Regulatory insights into progression of cancer and Alzheimer's disorder from autophagy perspective. Mol Biol Rep. 48:8227–8232. 2021.PubMed/NCBI View Article : Google Scholar

34 

Leonardi L, Sibéril S, Alifano M, Cremer I and Joubert PE: Autophagy modulation by viral infections influences tumor development. Front Oncol. 11(743780)2021.PubMed/NCBI View Article : Google Scholar

35 

He C and Klionsky DJ: Regulation mechanisms and signaling pathways of autophagy. Annu Rev Genet. 43:67–93. 2009.PubMed/NCBI View Article : Google Scholar

36 

Ravanan P, Srikumar IF and Talwar P: Autophagy: The spotlight for cellular stress responses. Life Sci. 188:53–67. 2017.PubMed/NCBI View Article : Google Scholar

37 

Chang CP, Su YC, Hu CW and Lei HY: TLR2-dependent selective autophagy regulates NF-κB lysosomal degradation in hepatoma-derived M2 macrophage differentiation. Cell Death Differ. 20:515–523. 2013.PubMed/NCBI View Article : Google Scholar

38 

Qing G, Yan P, Qu Z, Liu H and Xiao G: Hsp90 regulates processing of NF-kappa B2 p100 involving protection of NF-kappa B2 p100 involving protection of NF-kappa B-inducing kinase (NIK) from autophagy-mediated degradation. Cell Res. 17:520–530. 2007.PubMed/NCBI View Article : Google Scholar

39 

Moscat J and Diaz-Meco MT: p62 at the crossroads of autophagy, apoptosis, and cancer. Cell. 137:1001–004. 2009.PubMed/NCBI View Article : Google Scholar

40 

Komatsu M, Kurokawa H, Waguri S, Taguchi K, Kobayashi A, Ichimura Y, Sou YS, Ueno I, Sakamoto A, Tong KI, et al: The selective autophagy substrate p62 activates the stress responsive transcription factor Nrf2 through inactivation of Keap1. Nat Cell Biol. 12:213–223. 2010.PubMed/NCBI View Article : Google Scholar

41 

Song C, Mitter SK, Qi X, Beli E, Rao HV, Ding J, Ip CS, Gu H, Akin D, Dunn WA Jr, et al: Oxidative stress-mediated NFκB phosphorylation upregulates p62/SQSTM1 and promotes retinal pigmented epithelial cell survival through increased autophagy. PLoS One. 12(e0171940)2017.PubMed/NCBI View Article : Google Scholar

42 

Puéchal X, Terrier B, Mouthon L, Costedoat-Chalumeau N, Guillevin L and Le Jeunne C: Relapsing polychondritis. Joint Bone Spine. 81:118–124. 2014.PubMed/NCBI View Article : Google Scholar

43 

Vitale A, Sota J, Rigante D, Lopalco G, Molinaro F, Messina M, Iannone F and Cantarini L: Relapsing polychondritis: An update on pathogenesis, clinical features, diagnostic tools, and therapeutic perspectives. Curr Rheumatol Rep. 18(3)2016.PubMed/NCBI View Article : Google Scholar

44 

Qin Y, Zheng B, Yang GS, Yang HJ, Zhou J, Yang Z, Zhang XH, Zhao HY, Shi JH and Wen JK: Salvia miltiorrhiza-derived Sal-miR-58 induces autophagy and attenuates inflammation in vascular smooth muscle cells. Mol Ther Nucleic Acids. 21:492–511. 2020.PubMed/NCBI View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Qi H, Chen Z, Qin Y and Li Y: Curcumin ameliorates H<sub>2</sub>O<sub>2</sub>‑induced inflammatory response in chondrocytes by inducing autophagy activation. Exp Ther Med 23: 272, 2022.
APA
Qi, H., Chen, Z., Qin, Y., & Li, Y. (2022). Curcumin ameliorates H<sub>2</sub>O<sub>2</sub>‑induced inflammatory response in chondrocytes by inducing autophagy activation. Experimental and Therapeutic Medicine, 23, 272. https://doi.org/10.3892/etm.2022.11198
MLA
Qi, H., Chen, Z., Qin, Y., Li, Y."Curcumin ameliorates H<sub>2</sub>O<sub>2</sub>‑induced inflammatory response in chondrocytes by inducing autophagy activation". Experimental and Therapeutic Medicine 23.4 (2022): 272.
Chicago
Qi, H., Chen, Z., Qin, Y., Li, Y."Curcumin ameliorates H<sub>2</sub>O<sub>2</sub>‑induced inflammatory response in chondrocytes by inducing autophagy activation". Experimental and Therapeutic Medicine 23, no. 4 (2022): 272. https://doi.org/10.3892/etm.2022.11198
Copy and paste a formatted citation
x
Spandidos Publications style
Qi H, Chen Z, Qin Y and Li Y: Curcumin ameliorates H<sub>2</sub>O<sub>2</sub>‑induced inflammatory response in chondrocytes by inducing autophagy activation. Exp Ther Med 23: 272, 2022.
APA
Qi, H., Chen, Z., Qin, Y., & Li, Y. (2022). Curcumin ameliorates H<sub>2</sub>O<sub>2</sub>‑induced inflammatory response in chondrocytes by inducing autophagy activation. Experimental and Therapeutic Medicine, 23, 272. https://doi.org/10.3892/etm.2022.11198
MLA
Qi, H., Chen, Z., Qin, Y., Li, Y."Curcumin ameliorates H<sub>2</sub>O<sub>2</sub>‑induced inflammatory response in chondrocytes by inducing autophagy activation". Experimental and Therapeutic Medicine 23.4 (2022): 272.
Chicago
Qi, H., Chen, Z., Qin, Y., Li, Y."Curcumin ameliorates H<sub>2</sub>O<sub>2</sub>‑induced inflammatory response in chondrocytes by inducing autophagy activation". Experimental and Therapeutic Medicine 23, no. 4 (2022): 272. https://doi.org/10.3892/etm.2022.11198
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team