Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
June-2022 Volume 23 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2022 Volume 23 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Overexpression of long non‑coding RNA NEAT1 enhances cell viability and inhibits apoptosis in recurrent spontaneous abortion by targeting the miR‑125b/BCL‑2 axis

  • Authors:
    • Xiaodan Liu
    • Li Su
    • Bingnv Xu
    • Jing Lei
    • Hongjie Zhang
  • View Affiliations / Copyright

    Affiliations: Department of Obstetrics, Maternal and Child Health Hospital, Liaocheng, Shandong 252000, P.R. China
  • Article Number: 392
    |
    Published online on: April 13, 2022
       https://doi.org/10.3892/etm.2022.11319
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The current study aimed to investigate the function of the long non‑coding RNA nuclear paraspeckle assembly transcript 1 (NEAT1) in the pathogenesis of recurrent spontaneous abortion (RSA) and to examine its potential mechanism. The expression of NEAT1, microRNA (miR)‑125b and Bcl‑2 in the villi of patients with RSAs and women with normal pregnancies was measured by reverse transcription‑quantitative PCR. Cell viability was detected by the MTT assay and cell apoptosis was evaluated by flow cytometry. A dual‑luciferase reporter assay was performed to verify the associations between NEAT1 and miR‑125b. The protein expression of Bcl‑2 was detected by western blot analysis. In the present study, the expression of NEAT1 and Bcl‑2 was reduced and that of miR‑125b was increased in clinical samples of villus tissues from patients with RSAs. In vitro, overexpression of NEAT1 enhanced the viability and suppressed the apoptosis of JEG‑3 cells. It was demonstrated that miR‑125b acts as a molecular sponge of NEAT1 and its expression was negatively regulated by NEAT1. miR‑125b overexpression reduced the viability and promoted the apoptosis of JEG‑3 cells. The expression of BCL‑2, a target gene of miR‑125b, was inversely correlated with that of miR‑125b. Overexpression of miR‑125b and inhibition of BCL‑2 partially reversed the effect of NEAT1 overexpression on the viability and apoptosis of JEG‑3 cells. Collectively, it was demonstrated that the NEAT1/miR‑125b/BCL‑2 axis plays a pivotal role in regulating the viability and apoptosis of JEG‑3 cells. The findings of the present study offer new insights into the pathogenesis of RSA and may provide information on RSA treatment.

Introduction

Recurrent spontaneous abortion (RSA), also known as recurrent pregnancy loss or recurrent miscarriage, is a complication of pregnancy affecting 1-2% of fertile couples (1). It refers to the occurrence of three or more consecutive spontaneous abortions and causes severe physical and mental harm to affected patients (2). Chromosomal abnormalities, pathogenic infections, immune disorders and genetic mutations are factors that contribute to RSA (3,4). Nevertheless, for ~50% of patients with RSAs, the causative factors remain unknown (5). Hence, it is important to investigate the underlying pathogenesis of RSA and identify available targets for its therapy.

Long non-coding RNAs (lncRNAs) are a group of non-coding RNAs with a length >200 nt (6). Previous studies have reported that lncRNAs affect the progression of RSA at the cellular level. For example, downregulation of the lncRNA metastasis associated lung adenocarcinoma transcript 1 inhibited the cell proliferation and migration, and increased apoptosis of human umbilical vein endothelial cells (7). Overexpression of HOX antisense intergenic RNA promoted trophoblast cell invasion and migration (8). Notably, the lncRNA nuclear paraspeckle assembly transcript 1 (NEAT1) was reported to affect cell proliferation and migration in several human cancer types such as endometrial (9), breast (10) and cervical cancer (11). Recently, Wang et al (12) discovered that NEAT1 expression was significantly reduced in the villi of patients experiencing recurrent miscarriages. However, the underlying function of NEAT1 in the pathogenesis of RSA has rarely been investigated.

MicroRNAs (miRNAs/miRs) are a type of conserved non-protein coding RNA (~22 nt) that participate in biological processes including cell differentiation, growth, apoptosis and angiogenesis (13,14). Previous studies have revealed that abnormal expression of miRNAs was associated with increased risk of RSA. For instance, upregulation of miR-27a (15) and miR-34a (16) and downregulation of miR-146a-5p (17) may contribute to RSA. Additionally, elevated miR-125b expression has been observed in decidual and villi tissues of patients with RSAs and has been suggested to be associated with RSA development (16,18). The interactions between lncRNAs and miRNAs, such as lncRNA SNHG7-1/miR-34a (19) and lncRNA H19/miR-106a-5p (20), reportedly affect the development of RSA. Nevertheless, the detailed regulatory mechanisms of miR-125b and its interaction with NEAT1 in the progression of RSA remain unclear.

Herein, the expression levels of NEAT1, miR-125b and BCL-2 in the villus tissues of patients with RSAs was evaluated and the regulatory mechanism of the NEAT1/miR-125b/BCL-2 axis on RSA pathogenesis was investigated in vitro. The present study aimed to elucidate the molecular mechanism underlying RSA and reveal possible targets for RSA treatment.

Materials and methods

Patients and clinical samples

In this retrospective study, villus tissue samples were obtained from patients with RSAs and healthy controls who visited Liaocheng Dongchangfu District Maternal and Child Health Hospital (Liaocheng, China) between March 2018 and February 2019. The RSA group included 20 Chinese women (age range, 25-35 years old; mean age, 29.84±3.44 years old) with a history of three or more spontaneous abortions. The control group included 20 age-matched women (age range, 24-35 years old; mean age, 29.23±3.01 years old) with the request for termination of pregnancy because of unplanned pregnancy. The inclusion criteria for both groups were as follows: i) No chromosomal abnormalities; ii) normal reproductive endocrinology; iii) no diabetes, thyroid dysfunction or other systemic diseases; and iv) no organic deformity of the uterus and genital tract. The villus samples were obtained from cases of induced abortion at 5-10 gestational weeks. All samples were cleaned in sterile saline to remove excess blood, mucus and deciduas, and stored in liquid nitrogen cans. The present study was approved by the Ethics Committee of Liaocheng Dongchangfu Maternal and Child Health Hospital and all participants signed informed consent.

Cell culture and transfection

The human placental choriocarcinoma cell line (JEG-3) was purchased from the Cell Bank of Type Culture Collection (Chinese Academy of Sciences). JEG-3 cells were cultured in Dulbecco's Modified Eagle's Medium (Gibco; Thermo Fisher Scientific, Inc.) containing 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.) at 37˚C in an incubator containing 5% CO2.

Short hairpin RNA NEAT1 (sh-NEAT1) and its negative control (sh-NC), sh-BCL-2, miR-125b mimics (5'-UCCCUGAGACCCUAACUUGUGA-3') and their corresponding negative control (mimics NC, 5'-UUCUCCGAACGUGUCACGUTT-3'), miR-125b inhibitors (5'-UCACAAGUUAGGGUCUCAGGGA-3') and their corresponding negative control (inhibitor NC, 5'-CAGUACUUUUGUGUAGUACAA-3') and pcDNA-NEAT1 and its corresponding negative control (pcDNA-NC) were purchased from Shanghai GenePharma Co., Ltd. JEG-3 cells were seeded into 6-well plates and allowed to grow until the confluence reached 80%. The cells were then transfected with the previously mentioned vectors (all at 20 nM) using Lipofectamine® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) at 37˚C. Subsequently, 48 h after transfection, cells were harvested to perform further experiments.

Reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was isolated from villus tissues and JEG-3 cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. A volume of 2 µl RNA (1 µg/µl) was reverse-transcribed into cDNA at 42˚C for 45 min using a First-Strand cDNA Synthesis kit (Takara Biotechnology Co., Ltd.), and qPCR was carried out using the SYBR Green PCR Kit (Takara Biotechnology Co., Ltd.). The thermocycling conditions for qPCR were as follows: Initial denaturation at 94˚C for 5 min; 40 cycles of 94˚C for 15 sec; 60˚C for 30 sec and 72˚C for 1 min. The expression of NEAT1 and Bcl-2 was normalized to that of GAPDH, and U6 served as the internal control for miR-125b. The data were analyzed using the 2-ΔΔCq method (21). The primer sequences are listed in Table I.

Table I

Primers for RT-qPCR.

Table I

Primers for RT-qPCR.

GeneForward (5'→3')Reverse (5'→3')
NEAT1 CTTCCTCCCTTTAACTTATCCATTCAC CTCTTCCTCCACCATTACCAACAATAC
MiR-125b GTCCCTGAGACCCTAACTTG AGCCTAACCCGTGGATTT
BCL-2 CTGCACCTGACGCCCTTCACC CACATGACCCCACCGAACTCAAAGA
GAPDH GCGAGATCGCACTCATCATCT TCAGTGGTGGACCTGACC
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT

[i] NEAT1, nuclear paraspeckle assembly transcript 1; miR, microRNA; RT-qPCR, reverse transcription-quantitative PCR.

MTT assay

Transfected JEG-3 cells were seeded into 96-well plates at 3x103 cells/well and incubated with 20 µl of 5 mg/ml MTT reagent (Sigma-Aldrich; Merck KGaA) for 4 h at 37˚C. Subsequently, 200 µl of dimethyl sulfoxide (Sigma-Aldrich; Merck KGaA) was added to each well for 10 min at 37˚C to dissolve the formazan crystals. The absorbance of the wells was detected using a microplate reader at 540 nm.

Flow cytometry

Cell apoptosis assay was measured using an Annexin V Apoptosis Detection kit (cat. no. BMS500FI-300; Thermo Fisher Scientific, Inc.). Following 24 h of transfection, JEG-3 cells were washed with ice cold PBS and centrifuged (450 x g for 20 min at 4˚C). The cells were then resuspended in 1x binding buffer and incubated with annexin V-FITC and PI (Thermo Fisher Scientific, Inc.) at 25˚C in the dark for 20 min. Apoptotic cell populations were assessed using a FACScan™ flow cytometer (BD Biosciences) and the data were analyzed using FlowJo software (version 0.9.18, FlowJo LLC).

Dual-luciferase reporter assay (DLR)

The targeting relationships between miR-125b and NEAT1 or BCL-2 were analyzed using StarBase database (version 2.0; http://starbase.sysu.edu.cn). The predicted wild-type (WT) or mutant (MUT) 3'-untranslated regions of NEAT1/BCL-2 containing miR-125b binding sites were inserted into pGL3-basic vectors (Promega Corporation) to produce NEAT1 WT, NEAT1 MUT, BCL-2 WT and BCL-2 MUT plasmids. JEG-3 cells (2,000 cells/well) were cultured in 24-well plates until the confluence reached 80% and transfected with WT or MUT luciferase reporters and miR-125b mimics or miR-NC mixed with Lipofectamine 3000 (Invitrogen; Thermo Fisher Scientific Inc.) according to the manufacturer's protocol. After 24 h at 37˚C, luciferase activity was detected by running a Dual-Luciferase Assay system (Promega Corporation). Renilla luciferase served as an endogenous control.

Western blot analysis

JEG-3 cells were lysed in RIPA buffer (Beyotime Institute of Biotechnology) to obtain total protein. The protein concentration was detected by the BCA Protein Assay Kit (Abcam). A total of 50 µg of protein/lane was separated by 10% SDS-PAGE, and then transferred to PVDF membranes and immersed in 5% skimmed milk for 1 h at 25˚C to block non-specific binding. The membranes were subsequently incubated overnight at 4˚C with primary antibodies against BCL-2 (1:1,000; cat. no. ab32124; Abcam), β-actin (1:1,000, ab5694, Abcam), pro caspase 3 (1:1,000; cat. no. ab32150; Abcam) and cleaved caspase 3 (1:1,000; cat. no. ab32042; Abcam). Following the primary incubation, membranes were incubated with secondary antibody HRP-conjugated anti-rabbit IgG (1:5,000; cat. no. ab205718; Abcam) at 37˚C for 1 h. Protein signals were detected using the ECL Plus reagent (Beyotime Institute of Biotechnology) and the immunoblots were quantified using ImageJ software (version 4.0; Bio-Rad Laboratories, Inc.).

Statistical analysis

All statistical analyses were conducted using SPSS 22.0 software (IBM Corp.). The data are presented as the mean ± standard deviation. Differences between two groups were compared using unpaired Student's t-test and those between multiple groups were compared using one-way analysis of variance followed by Tukey's post hoc test. Variable correlation was evaluated through Pearson's correlation analysis. P<0.05 was considered to indicate a statistically significant difference.

Results

NEAT1 overexpression enhances viability and inhibits apoptosis of JEG-3 cells

In order to examine the role of NEAT1 in the pathogenesis of RSA, NEAT1 expression was detected in the villi of patients with RSAs and women with normal pregnancies. The mRNA expression of NEAT1 in the villi of patients with RSAs was found to be significantly lower than that in the villi of women with normal pregnancies (Fig. 1A). After pcDNA-NEAT1 transfection, NEAT1 mRNA expression was enhanced in JEG-3 cells compared with that in cells transfected with pcDNA-NC, while NEAT1 knockdown caused the opposite effect (Fig. 1B). The MTT assay demonstrated that the cell viability was significantly increased in the pcDNA-NEAT1 group compared with the pcDNA-NC group; while compared to the sh-NC group, cell viability in the sh-NEAT1 was reduced (Fig. 1C). Meanwhile, apoptosis rate was significantly inhibited in the pcDNA-NEAT1 group compared with the pcDNA-NC group, while it was promoted in the sh-NEAT1 group compared with the sh-NC group (Fig. 1D). To validate the observation on apoptosis, western blot analysis was performed to evaluate the expression of cleaved caspase 3/pro-caspase-3 ratio. This ratio was significantly suppressed in JEG-3 cells transfected with pcDNA-NEAT1 compared with those transfected with pcDNA-NC, whereas it was significantly elevated after sh-NEAT1 transfection compared with sh-NC transfection (Fig. 1E). These data demonstrate that NEAT1 overexpression enhances the viability and inhibits the apoptosis of JEG-3 cells.

Figure 1

NEAT1 overexpression promotes cell viability and inhibits apoptosis in JEG-3 cells. (A) NEAT1 expression was detected by RT-qPCR in villi of RSA patients and normal pregnancy villi. **P<0.01 vs. normal pregnancy villi. (B) NEAT1 expression was detected by RT-qPCR in JEG-3 cells transfected with pcDNA-NC, pcDNA-NEAT1, sh-NC or sh-NEAT1. **P<0.01 vs. pcDNA-NC; ##P<0.01 vs. sh-NC. (C) Cell viability was detected by MTT assay in JEG-3 cells transfected with pcDNA-NC, pcDNA-NEAT1, sh-NC or sh-NEAT1. **P<0.01 vs. pcDNA-NC; ##P<0.01 vs. sh-NC. (D) Flow cytometry was used to detect the apoptotic rates of JEG-3 cells transfected with pcDNA-NC, pcDNA-NEAT1, sh-NC or sh-NEAT1. **P<0.01 vs. pcDNA-NC; ##P<0.01 vs. sh-NC. (E) Ratio of protein expression of cleaved caspase3/pro-caspase was detected by western blot analysis in JEG-3 cells transfected with pcDNA-NC, pcDNA-NEAT1, sh-NC or sh-NEAT1. **P<0.01 vs. pcDNA-NC; ##P<0.01 vs. sh-NC. NEAT1, nuclear paraspeckle assembly transcript 1; RT-qPCR, reverse transcription-quantitative PCR; RSA, recurrent spontaneous abortion; NC, negative control; sh, short hairpin.

miR-125b acts as a target of NEAT1

Possible miRNA targets of NEAT1 were studied in order to understand the regulatory mechanism of NEAT1 in RSA development. The present study demonstrated that NEAT1 contained complementary binding sites to miR-125b (Fig. 2A). DLR assay demonstrated that the luciferase activity in the miR-125b mimics/NEAT1 WT group was significantly reduced compared with the mimics NC/NEAT1 WT group (Fig. 2B). In addition, miR-125b mRNA expression was expressed at significantly higher levels in the villi of patients with RSAs compared to those in the villi of women with normal pregnancies (Fig. 2C). Furthermore, the mRNA expression of miR-125b was negatively correlated with that of NEAT1 (Fig. 2D), as NEAT1 mRNA overexpression suppressed miR-125b mRNA expression in JEG-3 cells but NEAT1 silencing upregulated miR-125b, compared with their respective negative controls (Fig. 2E). These results reveal that NEAT1 directly targets and negatively modulates the expression of miR-125b.

Figure 2

miR-125b acts as a target of NEAT1. (A) The target sites between NEAT1 and miR-125b were predicted by Starbase. (B) Dual-luciferase assay confirmed the association between NEAT1 and miR-125b in JEG-3 cells. **P<0.01 vs. mimics NC. (C) The expression of miR-125b was measured by RT-qPCR in villi of patients with RSAs and normal pregnancy. **P<0.01 vs. villi from patients with normal pregnancy. (D) The correlation between NEAT1 and miR-125b was evaluated by Pearson's correlation analysis. R2=0.575, P<0.001. (E) The expression of miR-125b was measured by RT-qPCR in JEG-3 cells transfected with pcDNA-NC, pcDNA-NEAT1, sh-NC or sh-NEAT1. **P<0.01 vs. pcDNA-NC; ##P<0.01 vs. sh-NC. miR, microRNA; NEAT1, nuclear paraspeckle assembly transcript; NC, negative control; RT-qPCR, reverse transcription-quantitative PCR; RSA, recurrent spontaneous abortion; sh, short hairpin.

miR-125b overexpression suppresses viability and promotes apoptosis of JEG-3 cells

To examine the effect of miR-125b in RSA progression, JEG-3 cells were transfected with miR-125b mimics or inhibitors, which significantly enhanced and reduced the mRNA expression levels of miR-125b, respectively, compared with their respective negative controls (Fig. 3A). The present study demonstrated that miR-125b overexpression suppressed the viability and promoted the apoptosis of JEG-3 cells compared with mimics NC; whereas, compared with inhibitor NC, miR-125b inhibition induced the opposite effect (Fig. 3B and C). Furthermore, western blot analysis demonstrated that cleaved caspase 3/pro-caspase-3 ratio was upregulated by miR-125b overexpression compared with mimics NC and downregulated by miR-125b inhibition compared with inhibitor NC (Fig. 3D).

Figure 3

miR-125b overexpression inhibits cell viability and promotes apoptosis in JEG-3 cells. JEG-3 cells were transfected with mimics NC, miR-125b mimics, inhibitor NC, or miR-125b inhibitor. **P<0.01 vs. mimics NC; ##P<0.01 vs. inhibitor NC. (A) The expression of miR-125b was measured by RT-qPCR. (B) Cell viability was detected by MTT assay. (C) Flow cytometry was used to detect the apoptotic rates. (D) The protein expression of cleaved caspase3 was detected by western blot analysis. miR, microRNA; RT-qPCR, reverse transcription-quantitative PCR; NC, negative control.

MiR-125b directly targets BCL-2

The potential target site between BCL-2 and miR-125b was predicted using Starbase (Fig. 4A). DLR assay revealed that the luciferase activity in the miR-125b mimics/BCL-2 WT group was significantly reduced compared with the mimics NC/BCL-2 WT group (Fig. 4B) in JEG-3 cells. Moreover, the mRNA expression of BCL-2 in the villi of patients with RSAs as markedly lower than that in the villi of normal pregnancies (Fig. 4C) and BCL-2 mRNA expression was negatively correlated with that of miR-125b (Fig. 4D). MiR-125b overexpression significantly downregulated BCL-2 compared with mimics NC; whereas, compared with inhibitor NC, miR-125b inhibition significantly enhanced BCL-2 protein expression in JEG-3 cells (Fig. 4E). These data confirm that miR-125b directly targets BCL-2 and negatively regulates BCL-2 expression.

Figure 4

BCL-2 is a direct target of miR-125b. (A) The target sites between miR-125b and BCL-2 were predicted by Starbase. (B) Dual-luciferase assay confirmed the association between miR-125b and BCL-2 in JEG-3 cells. **P<0.01 vs. mimics NC. (C) The expression of BCL-2 was measured by RT-qPCR in villi of patients with RSAs and normal pregnancy. ***P<0.001 vs. normal pregnancy villi. (D) The correlation between miR-125b and BCL-2 was evaluated by Pearson's correlation analysis. R2=0.655, P<0.001. (E) The protein expression of BCL-2 was detected by western blot in JEG-3 cells transfected with mimics NC, miR-125b mimics, inhibitor NC or miR-125b inhibitor. **P<0.01 vs. mimics NC; ##P<0.01 vs. inhibitor NC. miR, microRNA; NC, negative control; RT-qPCR, reverse transcription-quantitative PCR; RSA, recurrent spontaneous abortion; WT, wild type; MUT, mutant.

NEAT1 overexpression enhances cell viability and inhibits apoptosis by regulating the miR-125b/BCL-2 axis

The transfection efficiency of sh-BCL-2 was detected by RT-qPCR. The mRNA expression of BCL-2 in JEG-3 cells transfected with sh-BCL-2 was significantly decreased compared with sh-NC (Fig. 5A), suggesting that sh-BCL-2 was transfected successfully. Rescue experiments were subsequently conducted to examine the association between NEAT1 and the miR-125b/BCL-2 axis in JEG-3 cells. NEAT1 mRNA overexpression significantly increased the protein expression of BCL-2 compared with pcDNA-NC, but this effect was inhibited by miR-125b overexpression and BCL-2 knockdown in JEG-3 cells (Fig. 5B). Compared with pcDNA-NEAT1, overexpression of miR-125b and silencing of BCL-2 attenuated both the NEAT1-induced increase in viability and decrease in apoptosis in JEG-3 cells (Fig. 5C and D). Meanwhile, the results of the western blot analysis demonstrated that both miR-125b overexpression and BCL-2 suppression reversed the inhibitory effect of NEAT1 overexpression on the protein expression of cleaved caspase 3 (Fig. 5E). Overall, these findings suggest that NEAT1 overexpression enhances the viability and inhibits the apoptosis of JEG-3 cells by regulating the miR-125b/BCL-2 axis.

Figure 5

NEAT1 overexpression promotes cell viability and inhibits apoptosis by regulating miR-125b/BCL-2 axis. (A) The expression of BCL-2 was measured by RT-qPCR in JEG-3 cells transfected with sh-BCL-2 or sh-NC. **P<0.01 vs. sh-NC. (B) The protein expression of BCL-2 was detected by western blot analysis in JEG-3 cells transfected with pcDNA-NC, pcDNA-NEAT1, pcDNA-NEAT1 + miR-125b mimics or pcDNA-NEAT1 + sh-BCL-2. **P<0.01 vs. pcDNA-NC; ##P<0.01 vs. pcDNA-NEAT1. (C) Cell viability was detected by MTT assay in JEG-3 cells transfected with pcDNA-NC, pcDNA-NEAT1, pcDNA-NEAT1 + miR-125b mimics or pcDNA-NEAT1 + sh-BCL-2. **P<0.01 vs. pcDNA-NC; ##P<0.01 vs. pcDNA-NEAT1. (D) Flow cytometry was used to detect the apoptotic rates of JEG-3 cells transfected with pcDNA-NC, pcDNA-NEAT1, pcDNA-NEAT1 + miR-125b mimics, or pcDNA-NEAT1 + sh-BCL-2. **P<0.01 vs. pcDNA-NC; ##P<0.01 vs. pcDNA-NEAT1. (E) Ratio of protein expression of cleaved caspase3/pro-caspase 3 was detected by western blot analysis in JEG-3 cells transfected with pcDNA-NC, pcDNA-NEAT1, pcDNA-NEAT1 + miR-125b mimics or pcDNA-NEAT1 + sh-BCL-2. **P<0.01 vs. pcDNA-NC; #P<0.05, ##P<0.01 vs. pcDNA-NEAT1. NEAT1, nuclear paraspeckle assembly transcript 1; miR, microRNA; RT-qPCR, reverse transcription-quantitative PCR; sh, short hairpin; NC, negative control.

Discussion

RSA is a common complication during pregnancy which has a complex etiology (5). Normal trophoblast cells play a critical role in fetal growth, but failure in trophoblast transformation or impaired trophoblast function can lead to RSA (22). In the present study, NEAT1 (an RSA-associated lncRNA) was identified as a potential target for RSA therapy. The present study demonstrated that NEAT1 expression was decreased in the villi of patients with RSAs and NEAT1 overexpression enhanced the viability and inhibited the apoptosis of JEG-3 cells by interacting with the miR-125b/BCL-2 axis.

Numerous lncRNAs such as MALAT1(7), HOTAIR (8) and TCL6(23) have been reported to be abnormally expressed in RSA. In the present study, NEAT1 expression was downregulated in the villi of RSA patients. Similarly, a recent study demonstrated that NEAT1 expression was reduced in the villi of patients experiencing recurrent miscarriages (12). These data therefore suggest that altered NEAT1 expression may be associated with RSA pathogenesis. In addition, NEAT1 is a critical lncRNA that regulates cell processes, such as apoptosis and proliferation in human cancers (24-26). Wang et al (25) reported that NEAT1 overexpression increased the viability of endometrial cancer cells and Yuan et al (26) revealed that NEAT1 knockdown decreased the viability and enhanced the apoptosis of cervical cancer cells. Herein, it was demonstrated that NEAT1 overexpression enhanced the viability and suppressed the apoptosis of JEG-3 cells. In functional studies, there are some similarities between trophoblasts and cancer cells that may be related to their migration and invasion capabilities (27). The results of the present study corroborate those in previous studies suggesting that NEAT1 overexpression may protect patients against RSA by enhancing cell viability and inhibiting apoptosis.

Increasing evidence has demonstrated that miR-125b expression is increased in decidual (16) and villus tissues (18) of patients with RSAs. In the current study, the level of miR-125b was also discovered to be upregulated in the villi of patients with RSAs, suggesting that dysregulation of miR-125b expression may be associated with increased risk of RSA. Meanwhile, accumulating data have implicated the significant role of miR-125b in regulating cellular processes. For instance, miR-125b overexpression induced the apoptosis of trophoblast cells (28). In another study, increased miR-125b expression reduced cell viability and impaired the invasion and migration capacities of extra-villous trophoblastic cells (29). In the current study, miR-125b overexpression reduced the viability and promoted the apoptosis of JEG-3 cells. Notably, lncRNAs act as sponges of miRNAs and compete for complementary binding with miRNAs, thereby inhibiting their function (30). Previous studies have reported that NEAT1 regulated cell motility by targeting miR-361-5p (31), miR-101-3p (32) and miR-37(33). In this research, miR-125b was identified as a direct target of NEAT1 and was also negatively regulated by NEAT1. Therefore, it was hypothesized that miR-125b may interact with NEAT1 to modulate RSA progression. Rescue experiments confirmed that upregulation of miR-125b reversed the enhancing effect of NEAT1 overexpression on cell viability, and the inhibitory effect on apoptosis further validated this assumption.

During early pregnancy, both fetal and maternal tissues experience cell death caused by apoptosis and susceptivity to RSA is associated with the balance of cell death and proliferation (34). BCL-2, an anti-apoptotic protein, plays a key role in regulating endometrial cell turnover (35). A recent study reported that BCL-2 expression was reduced in trophoblastic tissues of patients with RSAs (36). Similarly, a reduction in BCL-2 expression was discovered in the villi of patients with RSAs, suggesting that low BCL-2 expression may be associated with RSA. Previous studies have demonstrated that overexpression of BCL-2 can enhance cell viability and suppress apoptosis and miRNAs such as miR-34a (37) and miR-195-5p (38) regulated this effect by targeting BCL-2. In the current study, BCL-2 was identified as a downstream target gene of miR-125b. Based on previous data showing that NEAT1 overexpression attenuated the malignant behavior of RSA by regulating miR-125b, it was hypothesized that BCL-2 may be involved in RSA pathogenesis by modulating the NEAT1/miR-125b axis. Transfection of sh-BCL-2 significantly reversed the enhancing effect of pcDNA-NEAT1 on cell viability and the suppressive effect on apoptosis in JEG-3 cells. In conclusion, NEAT1 overexpression enhanced the viability and inhibited the apoptosis of JEG-3 cells by interacting with the miR-125b/BCL-2 axis.

There are several limitations in the present study. First, the effects of the NEAT1/miR-125b/BCL-2 axis on biological processes such as cell migration and invasion, in addition to cell viability and apoptosis, need to be investigated in RSA. Second, the interactions between this regulatory axis and relevant downstream signaling pathways remain unclear. Third, the present study only focused on elucidating the mechanism behind the NEAT1/miR-125b/BCL-2 axis at the cellular level and in vivo experiments will be required to supplement the present results. Further studies are required in order to address these issues.

In summary, the present study revealed that NEAT1 expression was reduced in the villi of patients with RSAs and that NEAT1 overexpression regulated the viability and apoptosis of JEG-3 cells by targeting the miR-125b/BCL-2 axis. These findings offer new insights into the etiology of RSA and may aid in identifying potential targets for RSA treatment.

Acknowledgements

Not applicable.

Funding

Funding: No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

XL and HZ are mainly responsible for the design of articles, data analysis, methodology, project management and modification of important contents and drafting of manuscripts. LS, BX and JL are responsible for resource integration, experimental data analysis, software, visualization, investigation and literature query, manuscript modification and editing. All authors have been involved in writing, editing, reading and approving the current version. All authors confirmed the authenticity of all the raw data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The present study was approved by the Ethics Committee of Liaocheng Dongchangfu Maternal and Child Health Hospital (Liaocheng, China; approval ID: 2020-02) and all participants undersigned the informed consents.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Rai R and Regan L: Recurrent miscarriage. Lancet. 368:601–611. 2006.PubMed/NCBI View Article : Google Scholar

2 

Li X, Yin M, Gu J, Hou Y, Tian F and Sun F: Metabolomic profiling of plasma samples from women with recurrent spontaneous abortion. Med Sci Monit. 24:4038–4045. 2018.PubMed/NCBI View Article : Google Scholar

3 

Krieg SA, Fan X, Hong Y, Sang QX, Giaccia A, Westphal LM, Lathi RB, Krieg AJ and Nayak NR: Global alteration in gene expression profiles of deciduas from women with idiopathic recurrent pregnancy loss. Mol Hum Reprod. 18:442–450. 2012.PubMed/NCBI View Article : Google Scholar

4 

Pereza N, Ostojić S, Kapović M and Peterlin B: Systematic review and meta-analysis of genetic association studies in idiopathic recurrent spontaneous abortion. Fertil Steril. 107:150–159.e2. 2017.PubMed/NCBI View Article : Google Scholar

5 

Christiansen OB, Steffensen R, Nielsen HS and Varming K: Multifactorial etiology of recurrent miscarriage and its scientific and clinical implications. Gynecol Obstet Invest. 66:257–267. 2008.PubMed/NCBI View Article : Google Scholar

6 

Pauli A, Rinn JL and Schier AF: Non-coding RNAs as regulators of embryogenesis. Nat Rev Genet. 12:136–149. 2011.PubMed/NCBI View Article : Google Scholar

7 

Wang Y, Liu HZ, Liu Y, Wang HJ, Pang WW and Zhang JJ: Downregulated MALAT1 relates to recurrent pregnancy loss via sponging miRNAs. Kaohsiung J Med Sci. 34:503–510. 2018.PubMed/NCBI View Article : Google Scholar

8 

Zhang Y, Jin F, Li XC, Shen FJ, Ma XL, Wu F, Zhang SM, Zeng WH, Liu XR, Fan JX, et al: The YY1-HOTAIR-MMP2 signaling axis controls trophoblast invasion at the maternal-fetal interface. Mol Ther. 25:2394–2403. 2017.PubMed/NCBI View Article : Google Scholar

9 

Wang W, Ge L, Xu XJ, Yang T, Yuan Y, Ma XL and Zhang XH: LncRNA NEAT1 promotes endometrial cancer cell proliferation, migration and invasion by regulating the miR-144-3p/EZH2 axis. Radiol Oncol. 53:434–442. 2019.PubMed/NCBI View Article : Google Scholar

10 

Xiong Y, Liu Z, Li Z, Wang S, Shen N, Xin Y and Huang T: Long non-coding RNA nuclear paraspeckle assembly transcript 1 interacts with microRNA-107 to modulate breast cancer growth and metastasis by targeting carnitine palmitoyltransferase-1. Int J Oncol. 55:1125–1136. 2019.PubMed/NCBI View Article : Google Scholar

11 

Wang L and Zhu H: Long non-coding nuclear paraspeckle assembly transcript 1 acts as prognosis biomarker and increases cell growth and invasion in cervical cancer by sequestering microRNA-101. Mol Med Rep. 17:2771–2777. 2018.PubMed/NCBI View Article : Google Scholar

12 

Wang Y, Liu HZ, Liu Y, Wang HJ, Pang WW and Zhang JJ: Disordered p53-MALAT1 pathway is associated with recurrent miscarriage. Kaohsiung J Med Sci. 35:87–94. 2019.PubMed/NCBI View Article : Google Scholar

13 

Bartel DP: MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 116:281–297. 2004.PubMed/NCBI View Article : Google Scholar

14 

Urbich C, Kuehbacher A and Dimmeler S: Role of microRNAs in vascular diseases, inflammation, and angiogenesis. Cardiovasc Res. 79:581–588. 2008.PubMed/NCBI View Article : Google Scholar

15 

Wang CY, Wang SG, Wang JL, Zhou LY, Liu HJ and Wang YF: Effect of miRNA-27a and leptin polymorphisms on risk of recurrent spontaneous abortion. Med Sci Monit. 22:3514–3522. 2016.PubMed/NCBI View Article : Google Scholar

16 

Li D and Li J: Association of miR-34a-3p/5p, miR-141-3p/5p, and miR-24 in decidual natural killer cells with unexplained recurrent spontaneous abortion. Med Sci Monit. 22:922–929. 2016.PubMed/NCBI View Article : Google Scholar

17 

Zhao L, Li J and Huang S: Patients with unexplained recurrent spontaneous abortion show decreased levels of microrna-146a-5p in the deciduae. Ann Clin Lab Sci. 48:177–182. 2018.PubMed/NCBI

18 

Dong F, Zhang Y, Xia F, Yang Y, Xiong S, Jin L and Zhang J: Genome-wide miRNA profiling of villus and decidua of recurrent spontaneous abortion patients. Reproduction. 148:33–41. 2014.PubMed/NCBI View Article : Google Scholar

19 

Xiang H, Yan H, Sun B, Feng F and Chen P: Decreased expression of long non-coding RNA SNHG7 cause recurrent spontaneous abortion through suppression proliferation and invasion of trophoblast cells via miR-34a. Am J Transl Res. 11:463–472. 2019.PubMed/NCBI

20 

Zeng H, He D, Xie H, Zhao Y, Peng Z, Deng H, Hu J, Jiang B and Liu N: H19 regulates angiogenic capacity of extravillous trophoblasts by H19/miR-106a-5p/VEGFA axis. Arch Gynecol Obstet. 301:671–679. 2020.PubMed/NCBI View Article : Google Scholar

21 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

22 

Brosens I, Pijnenborg R, Vercruysse L and Romero R: The ‘Great Obstetrical Syndromes’ are associated with disorders of deep placentation. Am J Obstet Gynecol. 204:193–201. 2011.PubMed/NCBI View Article : Google Scholar

23 

Liu LP and Gong YB: LncRNA-TCL6 promotes early abortion and inhibits placenta implantation via the EGFR pathway. Eur Rev Med Pharmacol Sci. 22:7105–7112. 2018.PubMed/NCBI View Article : Google Scholar

24 

Luo Z, Yi ZJ, Ou ZL, Han T, Wan T, Tang YC, Wang ZC and Huang FZ: RELA/NEAT1/miR-302a-3p/RELA feedback loop modulates pancreatic ductal adenocarcinoma cell proliferation and migration. J Cell Physiol. 234:3583–3597. 2019.PubMed/NCBI View Article : Google Scholar

25 

Wang J, Zhao X, Guo Z, Ma X, Song Y and Guo Y: Regulation of NEAT1/miR-214-3p on the growth, migration and invasion of endometrial carcinoma cells. Arch Gynecol Obstet. 295:1469–1475. 2017.PubMed/NCBI View Article : Google Scholar

26 

Yuan LY, Zhou M, Lv H, Qin X, Zhou J, Mao X, Li X, Xu Y, Liu Y and Xing H: Involvement of NEAT1/miR-133a axis in promoting cervical cancer progression via targeting SOX4. J Cell Physiol. 234:18985–18993. 2019.PubMed/NCBI View Article : Google Scholar

27 

Piechowski J: Trophoblastic-like transdifferentiation: A key to oncogenesis. Crit Rev Oncol Hematol. 101:1–11. 2016.PubMed/NCBI View Article : Google Scholar

28 

Gu Y, Zhao S, Wan J, Meng J, Zuo C, Wang S, Zhou Y, Li H and Wang X: Hsa-miRNA-125b may induce apoptosis of HTR8/SVneo cells by targeting MCL1. Reprod Biol. 19:368–373. 2019.PubMed/NCBI View Article : Google Scholar

29 

Tang J, Wang D, Lu J and Zhou X: MiR-125b participates in the occurrence of preeclampsia by regulating the migration and invasion of extravillous trophoblastic cells through STAT3 signaling pathway. J Recept Signal Transduct Res. 41:202–208. 2021.PubMed/NCBI View Article : Google Scholar

30 

Du Z, Sun T, Hacisuleyman E, Fei T, Wang X, Brown M, Rinn JL, Lee MG, Chen Y, Kantoff PW and Liu XS: Integrative analyses reveal a long noncoding RNA-mediated sponge regulatory network in prostate cancer. Nat Commun. 7(10982)2016.PubMed/NCBI View Article : Google Scholar

31 

Yu X, Liu X, Wang R and Wang L: Long non-coding RNA NEAT1 promotes the progression of hemangioma via the miR-361-5p/VEGFA pathway. Biochem Biophys Res Commun. 512:825–831. 2019.PubMed/NCBI View Article : Google Scholar

32 

Liu C, Feng Z, Chen T, Lv J, Liu P, Jia L, Zhu J, Chen F, Yang C and Deng Z: Downregulation of NEAT1 reverses the radioactive iodine resistance of papillary thyroid carcinoma cell via miR-101-3p/FN1/PI3K-AKT signaling pathway. Cell Cycle. 18:167–203. 2019.PubMed/NCBI View Article : Google Scholar

33 

Zhou ZW, Zheng LJ, Ren X, Li AP and Zhou WS: LncRNA NEAT1 facilitates survival and angiogenesis in oxygen-glucose deprivation (OGD)-induced brain microvascular endothelial cells (BMECs) via targeting miR-377 and upregulating SIRT1, VEGFA, and BCL-XL. Brain Res. 1707:90–98. 2019.PubMed/NCBI View Article : Google Scholar

34 

Michita RT, Zambra FMB, Fraga LR, Sanseverino MT, Schuler-Faccini L, Chies JAB and Vianna P: The role of FAS, FAS-L, BAX, and BCL-2 gene polymorphisms in determining susceptibility to unexplained recurrent pregnancy loss. J Assist Reprod Genet. 36:995–1002. 2019.PubMed/NCBI View Article : Google Scholar

35 

Lea RG, al-Sharekh N, Tulppala M and Critchley HO: The immunolocalization of bcl-2 at the maternal-fetal interface in healthy and failing pregnancies. Hum Reprod. 12:153–158. 1997.PubMed/NCBI View Article : Google Scholar

36 

Elsalam SA, Mansor AE, Sarhan MH, Shalaby AM, Gobran MA and Alabiad MA: Evaluation of apoptosis, proliferation, and adhesion molecule expression in trophoblastic tissue of women with recurrent spontaneous abortion and infected with toxoplasma gondii. Int J Gynecol Pathol. 40:124–133. 2021.PubMed/NCBI View Article : Google Scholar

37 

Su G, Sun G, Liu H, Shu L and Liang Z: Downregulation of miR-34a promotes endothelial cell growth and suppresses apoptosis in atherosclerosis by regulating Bcl-2. Heart Vessels. 33:1185–1194. 2018.PubMed/NCBI View Article : Google Scholar

38 

Jin J, Wang C, Ouyang Y and Zhang D: Elevated miR-195-5p expression in deep vein thrombosis and mechanism of action in the regulation of vascular endothelial cell physiology. Exp Ther Med. 18:4617–4624. 2019.PubMed/NCBI View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liu X, Su L, Xu B, Lei J and Zhang H: Overexpression of long non‑coding RNA NEAT1 enhances cell viability and inhibits apoptosis in recurrent spontaneous abortion by targeting the miR‑125b/BCL‑2 axis. Exp Ther Med 23: 392, 2022.
APA
Liu, X., Su, L., Xu, B., Lei, J., & Zhang, H. (2022). Overexpression of long non‑coding RNA NEAT1 enhances cell viability and inhibits apoptosis in recurrent spontaneous abortion by targeting the miR‑125b/BCL‑2 axis. Experimental and Therapeutic Medicine, 23, 392. https://doi.org/10.3892/etm.2022.11319
MLA
Liu, X., Su, L., Xu, B., Lei, J., Zhang, H."Overexpression of long non‑coding RNA NEAT1 enhances cell viability and inhibits apoptosis in recurrent spontaneous abortion by targeting the miR‑125b/BCL‑2 axis". Experimental and Therapeutic Medicine 23.6 (2022): 392.
Chicago
Liu, X., Su, L., Xu, B., Lei, J., Zhang, H."Overexpression of long non‑coding RNA NEAT1 enhances cell viability and inhibits apoptosis in recurrent spontaneous abortion by targeting the miR‑125b/BCL‑2 axis". Experimental and Therapeutic Medicine 23, no. 6 (2022): 392. https://doi.org/10.3892/etm.2022.11319
Copy and paste a formatted citation
x
Spandidos Publications style
Liu X, Su L, Xu B, Lei J and Zhang H: Overexpression of long non‑coding RNA NEAT1 enhances cell viability and inhibits apoptosis in recurrent spontaneous abortion by targeting the miR‑125b/BCL‑2 axis. Exp Ther Med 23: 392, 2022.
APA
Liu, X., Su, L., Xu, B., Lei, J., & Zhang, H. (2022). Overexpression of long non‑coding RNA NEAT1 enhances cell viability and inhibits apoptosis in recurrent spontaneous abortion by targeting the miR‑125b/BCL‑2 axis. Experimental and Therapeutic Medicine, 23, 392. https://doi.org/10.3892/etm.2022.11319
MLA
Liu, X., Su, L., Xu, B., Lei, J., Zhang, H."Overexpression of long non‑coding RNA NEAT1 enhances cell viability and inhibits apoptosis in recurrent spontaneous abortion by targeting the miR‑125b/BCL‑2 axis". Experimental and Therapeutic Medicine 23.6 (2022): 392.
Chicago
Liu, X., Su, L., Xu, B., Lei, J., Zhang, H."Overexpression of long non‑coding RNA NEAT1 enhances cell viability and inhibits apoptosis in recurrent spontaneous abortion by targeting the miR‑125b/BCL‑2 axis". Experimental and Therapeutic Medicine 23, no. 6 (2022): 392. https://doi.org/10.3892/etm.2022.11319
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team