Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
October 2013 Volume 32 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October 2013 Volume 32 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Nesprin-1 plays an important role in the proliferation and apoptosis of mesenchymal stem cells

  • Authors:
    • Wengang Yang
    • Hui Zheng
    • Yongyi Wang
    • Feng Lian
    • Zhenglei Hu
    • Song Xue
  • View Affiliations / Copyright

    Affiliations: Department of Cardiovascular Surgery, Renji Hospital, Shanghai Jiaotong University School of Medicine, Shanghai 200127, P.R. China
  • Pages: 805-812
    |
    Published online on: July 16, 2013
       https://doi.org/10.3892/ijmm.2013.1445
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The aim of this study was to investigate the expression of nesprin‑1 protein and its effects on rat bone marrow mesenchymal stem cells (MSCs). MSCs were cultured in DMEM and surface-associated antigens of MSCs were detected by flow cytometry. The protein expression of nesprin‑1 was detected by immunofluorescence and western blot analysis. A lentiviral vector expressing small interfering RNA (siRNA) targeting nesprin-1 was constructed (LV-siNesprin-1) and the MSCs were subsequently transfected with this vector. Another group of MSCs was transfected with the LV-GFP vector and another group of untransfected cells was used as the controls (normal group). The protein expression level of nesprin-1 in the 3 groups of MSCs (LV-siNesprin-1, LV-GFP and normal group) was measured by western blot analysis. Cell proliferation was assessed by MTT assay, and the cell cycle and apoptosis were detected by flow cytometry. DAPI was used to stain the nucleus of the MSCs. The MSCs appeared spindle-shaped with irregular processes and were positive for CD90, CD29 and negative for CD45. Nesprin‑1 protein was found in the nuclear membrane. The protein expression of nesprin‑1 in the LV-siNesprin-1 group was lower than that in the LV-GFP (P=0.03) and normal group (P=0.028); this difference was significant (P<0.05). The cell proliferation of the MSCs transfected with LV-siNesprin-1 was reduced; the apoptotic rate was higher in the LV-siNesprin-1 group compared with the other 2 groups (LV-GFP and normal group) (P=0.032, P=0.025, respectively; P<0.05). The changes in the morphology of the nucleus in the LV-siNesprin-1 group included fusion and fragmentation. In conclusion, the data presented in this study indicate that nesprin‑1 regulates the proliferation and apoptosis of MSCs; our results are consistent with those from previous studies. Thus, nesprin‑1 protein plays an important role in the proliferation and apoptosis of MSCs.

Introduction

Nesprin-1 is a protein isoform of the nesprin protein family that contains spectrin repeats similar to those in mAKAP, which forms homodimers and specifically targets the nuclear envelope through a KASH domain (1–5). Nesprin-1α is also a candidate for a mAKAP nuclear envelope receptor. It has been reported that mutations in the nesprin-1 gene may be responsible for adult cerebella ataxia and mutations of nesprin-1 which interact with lamin A/C may lead to at least 2 distinct human disease phenotypes, myopathic or neurologic, a feature similar to that found in laminopathies. Puckelwartz et al (6) reported Δ/Δ KASH mice expresses nesprin-1 without its carboxyl-terminal KASH domain; these Δ/Δ KASH mice have a normally assembled but dysfunctioning nuclear membrane complex and provide a model for nesprin-1 mutations and developing cardiomyopathy with associated cardiac conduction system disease.

Mesenchymal stem cells (MSCs) are bone marrow-derived cells that retain the capability to differentiate into various types of tissue cells and contribute to the regeneration of a variety of tissues, including bone, cartilage, muscle and adipose tissue (7–9). MSCs, after being transplantated into the ischemic myocardial tissue, secrete a variety of factors including vascular endothelial growth factor (VEGF). The cardioprotective effects of MSCs are known to be mediated not only by their differentiation into cardiomyocyte-like cells, but also by their ability to supply large amounts of angiogenic, anti-apoptotic and mitogenic factors (10–12). These findings suggest the therapeutic potential of MSCs for heart failure.

From the literature, we know that nesprin proteins exist only in multiple tissues (skeletal, cardiac and vascular smooth muscle) and not in stem cells (2). The study of nesprin-1 protein, which is speculated to be localized to the nuclear membrane, may aid in the understanding of the process through which MSCs differentiate into cardiomyocyte-like cells.

Materials and methods

Animals

Clean Sprague-Dawley (SD) rats, weighing 250–300 g, were obtained from the Experimental Animal Center of Shanghai Jiaotong University Medical School, Shanghai, China (production license: scxk (hu)2004-0001; use license no. syxk (hu)2003–2009). The present study was reviewed and approved by the University Institutional Animal Care and Use Committee.

Reagents

Except where otherwise specified, all reagents were obtained from Sigma-Aldrich Chemical Co. (St. Louis, MO, USA) and Gibco (Grand Island, NY, USA), including cell culture medium [low-glucose Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS)]. The cardiac-specific antibodies (TNI, α-sarcomeric actin, desmin), FITC-conjugated goat anti-rat antibodies (CD45), PE-conjugated rabbit anti-rat antibodies (CD90), allophycocyanin (APC)-conjugated rabbit anti-rat antibodies (CD29) and FITC-conjugated rabbit anti-rat nesprin-1 antibodies, were purchased from Abcam (Cambridge, UK). The BLOCK-iT™ POLIImiR RNAi Expression Vector kit with EmGFP, pcDNA™ 6.2-GW/EmGFPmiR, Escherichia coli (E. coli) DH5, Lipofectamine® 2000, Opti-MEM, TRIzol reagent and pLenti6.3/V5-DEST were purchased from Invitrogen (Carlsbad, CA, USA). Restriction endonuclease, DNA ligase and the Large Plasmid DNA Extraction kit were purchased from Qiagen (Dusseldorf, Germany). The reagents and instruments for immunohistochemistry, immunofluorescence and western blot analysis were purchased from Gibco, Sigma-Aldrich Chemical Co. and Invitrogen, respectively.

Cell culture

Eight-week-old SD rats (250–300 g) were prepared as donors. The procedures were performed in accordance with the guidelines for animal experimentation of Shanghai Jiaotong University and approved by the institutional ethics committee. Under general anesthesia with ether (approximately 100 μl) bone marrow was aspirated from both the tibia and femur with a 20-gauge needle attached to a 10-ml syringe containing 0.5 ml DMEM with 40 U/ml heparin.

The concentration of the cells in suspension was adjusted to 5×105 mononuclear cells/ml culture medium at 37°C in a humidified atmosphere with 5% CO2; the cells were then seeded on culture plates, without removal of the red blood cells. Since bone marrow-derived MSCs (BMSCs) grow initially in colonies and do not reach confluence over the entire culture dish, the cells were passaged 7 days after seeding, when half the colonies reached 70–80% confluence; the cells were then passaged weekly when the cells reached confluence. For subcultures, adherent BMSCs wer harvested using 0.125% trypsin and plated at a ratio of 1:3.

For flow cytometry, the cells were detached using accutase instead of trypsin, in order to achieve a better preservation of the cell surface molecules. 293T cells were maintained in MEM supplemented with 5% FBS and 50 mg/ml gentamycin. The cells were trypsinized by a 0.05% trypsin-0.5 mM EDTA solution.

Flow cytometry

Flow cytometry was performed using a FACSAria flow cytometer/cell sorter (BD Biosciences, San Jose, CA, USA). Following accutase treatment, the cells were resuspended at a density of 1×105 cells/200 μl phosphate-buffered saline (PBS) and incubated with 2% FCS (PBS-FCS) on ice. The cells were stained with antibody, and incubated with FITC-conjugated CD45 monoclonal antibody, PE-conjugated CD90 monoclonal antibody and APC-conjugated CD29 monoclonal antibody (at concentrations indicated by the manufacturer) for 30 min at 4°C in the dark, and then washed in PBS-FCS. After washing, the cells were analyzed in the cytometer. At least 5,000 events were analyzed for each sample. Negative controls, used to detect the unspecific bindings, included an irrelevant antibody or PBS-FCS alone. The acquired data were analyzed using Summit software (Cytomation, Inc., Fort Collins, CO, USA).

Immunofluorescence microscopy

BMSCs grown on glass coverslips were fixed by a 20-min incubation in 4% formaldehyde (freshly prepared from paraformaldehyde), rinsed in PBS, and stored in 70% ethanol at −20°C. The fixed cells were blocked for 30 min in blocking solution (PBS supplemented with 2% goat serum, 1% BSA, 0.1% gelatin, 0.1% Triton X-100 and 0.05% Tween-10), and incubated overnight with the primary antibody (at the dilution indicated by the manufacturer) at 4°C. After washing, the cells were incubated with the secondary antibody (FITC-conjugated anti-rat IgG for nesprin-1) for 30 min. Finally, the coverslips were washed, mounted in glycerol and examined under an epifluorescence microscope (Olympus, Tokyo, Japan).

Western blot analysis

After washing with PBS, the BMSCs were scraped off the culture dish and transferred to centrifuge tubes. Following centrifugation at 700 × g for 10 min at 4°C, the pellets were lysed in hot Laemmli loading buffer (62.5 mmol/l Tris-HCl, pH 6.8, 2% SDS, 10% glycerol, 0.05% β-mercaptoethanol, 0.05% bromophenol blue). Equal amounts of protein extracts (20 mg/lane) were subjected to SDS-PAGE on a 5% stacking gel and a 10% separating gel, followed by transfer of the proteins onto nitrocellulose membranes (20 min at 10 V). After blocking in PBS containing 0.05% Triton X-100 (TBS) and 5% FCS for 1 h, the blots were incubated overnight with primary antibodies (rabbit anti-rat nesprin-1) at 4°C. After washing, the membranes were incubated with the secondary antibody (HRP-conjugated goat anti rabbit IgG) for 1 h; the bound antibody was detected by ECL. β-actin was used as an internal control.

Design and cloning of small interfering RNA (siRNA) cassettes

The nesprin-1 DNA and protein sequence was according to the GenBank accession no. NM_001029909.1. The nesprin-1 gene siRNA sequence and the corresponding miRNA oligonucleotide sequence were then designed and synthesized using Ambion design software and the sequences were verified using BLAST software: (5′-CGGGAGTTGTTG ACTATGAAA-3′); the corresponding miRNA oligonucleotide sequence was as follows: nesprin-1 forward, TGCTGTTTCATAGTCAACAACTCCCGGTTTTGGCCACTGACTGACCGGGAGTTTGACTATGAAA; and reverse, CCTGTTTCATAGTCAAACTCCCGGTCAGTCAGTGGCCAAAACCGGGAGTTGTTGACTATGAAAC. The Vector Cloning kit was then used for restructuring; the double-stranded miRNA oligonucleotide was inserted into the miRNA expression vector (Invitrogen), and the cells were transfected with miRNA plasmids infected with E. coli DH5. The oligonucleotides were annealed and cloned into the BglII-HindIII site. The pDONR221 vector was processed with BP recombination reaction, in order to obtain the entry vector containing the siRNA. The sequence of the entry vector with siRNA and the lentiviral expression vector pLenti6/V5-DEST were processed with LR recombination reaction in order to obtain the lentiviral expression vector expressing siRNA targeting nesprin-1 (LV-siNesprin-1).

Transfection

The 293T cells were co-transfected with a plasmid expressing GFP together with a plasmid expressing siRNA specific for GFP (siGFP) at a ratio of 1:5 using FuGENE® transfection reagent (Roche, Indianapolis, IN, USA).

Lentiviral vector production

Recombinant lentiviruses were produced by the transient transfection of 293T cells using the calcium-phosphate method as previously described (13–15). Infectious lentiviruses were harvested at 48 and 72 h post-transfection and filtered through 0.22-μm-pore cellulose acetate filters as previously described (13–15). Recombinant lentiviruses were concentrated by ultracentrifugation (2 h at 50,000 × g) and subsequently purified on a sucrose 20% gradient (2 h at 46,000 × g) as previously described (16). Vector concentrations were analyzed using an immunocapture p24-gag ELISA (Alliance; DuPont/NEN, Boston, MA, USA) as previously described (16); the concentrated suspension of the activity of the viral titer was measured (1×106 TU/ml).

Protein levels were analyzed by western blot analysis (concrete steps as the former) and immunoblotting was carried out according to standard methods with rabbit moclonal antibody against GFP (Abcam) or β-actin (Sigma-Aldrich Chemical Co.). Fluorescence-activated cell-sorter analysis was carried out as previously described (17–19).

MTT cell proliferation assay

The cells were plated on 24-well plates (2×104 cells/well) in the growth medium for the assays. The protocols for MTT assays were as previously described (20). In brief, growth medium containing 0.25 mg/ml MTT was added to each well and the cells were further incubated at 37°C for 20 min, following which the medium was replaced by 0.2 ml DMSO/well. MTT dye conversion was determined by measuring the OD540 nm of the DMSO extracts using DMSO as the blank control.

Detection of cell cycle of MSCs by low cytometry

The cells (5×105) were centrifugated for 5 min at 800 rpm, the supernatant was collected, and they were then washed with cold PBS twice and fixed with 700 ml/l cold ethanol at 4°C overnight. The ethanol was removed by centrifugation prior to detection. The cells were washed with PBS twice, then stained with 1 ml PI (bromide tablets) at 4°C for 30 min in the dark.

Detection of MSC apoptosis by flow cytometry

The cells (5×106) were centrifugated for 5 min at 1,000 rpm, then the culture medium was discarded. They were then washed once with PBS, centrifuged and the supernatant was removed; they were then fixed with 70% cold ethanol at 4°C for 1–2 h. The ethanol was then removed by centrifugation. The cells were resuspended with 3 ml PBS for 5 min, filtered once and centrifuged at 1,500 rpm for 5 min. The PBS was discarded prior to detection. The cells were stained with 1 ml PI and FITC-Annexin V in 4°C for 30 min in the dark.

Morphology of the nucleus following staining of MSCs with 4,6-diamidino-2-phenylindole (DAPI) for 72 h and transfection with LV-siNesprin-1

The cells were passaged when they became nearly confluent. Sterile DAPI solution was added to the culture medium. The MSCs were rinsed 6 times in PBS solution to remove all excess unbound DAPI. The MSCs were cultured in culture medium [DMEM, supplemented with 20% FBS and penicillin (100 U/ml)/streptomycin (100 μg/ml)] at 37°C in a humidified atmosphere with 5% CO2 for 72 h; they were then examined under a microscope.

Statistical analysis

Image programmer software was used to analyze the images. Data are presented as the means ± standard deviation (SD). Statistical analyses were performed using paired t-tests where applicable. Statistical analysis was performed using SPSS and GraphPad Prism 5 Demo software. A p-value <0.05, based on a two-tailed test, was considered to indicate a statistically significant difference.

Results

Characterization of MSCs

After discarding the non-adherent cells by the first medium change and washing with PBS 3 times at 24 h of primary culture, approximately 80% of the MSCs had adhered to the culture dishes; the medium was then changed to remove the suspension of hematopoietic stem cells. After 3 days in primary culture, the MSCs adhered to the plastic surface, presenting a small population of single cells. The cells were spindle-shaped with a single nucleus (Fig. 1A). Seven to 10 days after initial plating, the cells resembled long spindle-shaped fibroblast cells and began to form colonies (Fig. 1B and C). After replating, almost 100% of the cells had adhered to the culture dishes, and were polygonal or spindle-shaped, with long processes.

Figure 1

Characterization of mesenchymal stem cells (MSCs) and differentiated cardiomyocyte-like cells in vitro. (A) Morphological observation of rat MSCs after cell culture for 3 days (×100). The cells were spindle-shaped with a single nucleus. (B) Morphological observation of rat MSCs after cell culture for 7 days (×100). (C) Morphological observation of rat MSCs after cell culture for 10 days (×100). The cells had long spindle-shaped fibroblasts and began to form colonies.

The rat MSC surface antigen profiles obtained by flow cytometry (Fig. 2), were positive for CD90, CD29 and negative for CD45. The percentage of CD90 and CD29 was 99.96 and 99.75%, respectively; however, the percentage of CD45 was 1.12%.

Figure 2

Surface-associated antigens (CD29, CD90, CD45) of MSCs were detected by flow cytometry. MSCs were positive for CD90, CD29 and negative for CD45. The percentage of CD90 and CD29 was approximately 99%; the percentage of CD45 was approximately 1%.

Detection of protein expression of nesprin-1 in MSCs by immunofluorescence and western blot analysis

Immunofluorescent staining for nesprin-1 protein verified the presence of rat MSCs (Fig. 3A), with granular green fluorescence distributed around the nuclear membrane of the MSCs. The protein expression of nesprin-1 was detected by western blot analysis (Fig. 3B).

Figure 3

Immunofluorescence and western blot analysis for the identification of the protein expression of nesprin-1. (A) MSCs were found to be positive for nesprin-1 by immunofluorescence (×400). (B) Western blot analysis revealed the protein expression of nesprin-1 in the MSCs.

Transfection of MSCs with LV-siNesprin-1, LV-GFP and the detection of protein expression of nesprin-1 by western blot analysis

The MSCs were successfully transfected with LV-siNesprin-1 or LV-GFP, as shown by green fluorescence (Fig. 4A–C). After the MSCs were transfected with LV-siNesprin-1, the protein expression of nesprin-1 in the LV-siNesprin-1 group was lower than that in the LV-GFP and normal group (Fig. 4D). The protein expression of nesprin-1 in the LV-GFP group was the same as that in the normal group, but was significanlty different from that in the LV-siNesprin-1 group (P=0.03 and P=0.028, respectively; P<0.05) (Fig. 4E). The expression of β-actin did not differ between the 3 groups (P=0.10 and P=0.12, respectively; P>0.05).

Figure 4

Mesenchymal stem cells (MSCs) were transfected with LV-siNesprin-1 or LV-GFP; the protein expression of nesprin-1 was detected by western blot analysis. (A–C) The MSCS were successfully transfected with LV-siNesprin-1 and LV-GFP (green fluorescence); ×200. (D and E) The protein expression of nesprin-1 in the MSCs in the LV-siNesprin-1 group was lower than that in the MSCS in the LV-GFP and normal group. The protein expression of nesprin-1 in the LV-GFP group was the same as that in the normal group. The difference between the LV-siNesprin-1 group and the LV-GFP/normal group was significant (*P=0.03, #P=0.028, respectively; P<0.05).

Detection of cell proliferation by MTT assay

The 3 groups of cells (LV-siNesprin-1, LV-GFP and normal group) were cultured for 24, 48, 72 and 96 h under the same conditions. The proliferation of the cells was then detected by MTT assay at 24, 48, 72 and 96 h. As shown in Fig. 5, the knockdown of nesprin-1 expression led to a decrease in the proliferation of MSCs; however, the proliferation rate of the cells in the LV-GFP group was not altered and was similar to the normal group.

Figure 5

Cell proliferation was detected by MTT assay. (A) Cell proliferation was detected by MTT assay at 24, 48, 72 and 96 h when the 3 groups of cells (LV-siNesprin-1, LV-GFP and normal group) were cultured for 24, 48, 72 and 96 h under the same conditions. The proliferation of the cells in the LV-siNesprin-1 group was reduced compared with the other 2 groups; this difference was statistically significant (*P=0.025; P<0.05). However, the proliferation of the cells in the LV-GFP group was the same as that in the normal group. (B) Transfection with LV-siNesprin-1 inhibited cell proliferation; however, transfection with LV-GFP did not affect cell proliferation.

Cell cycle of MSCs in the 3 groups (LV-siNesprin-1, LV-GFP and normal group)

The 3 groups of cells (LV-siNesprin-1, LV-GFP and normal group) were cultured for 72 h under the same conditions. The cell cycle was detected by flow cytometry. In the LV-siNesprin-1 group, the cells were mainly in the G0/G1 phase of the cell cycle (Fig. 6).

Figure 6

Cell cycle of mesenchymal stem cell (MSC) in the 3 groups (LV-siNesprin-1, LV-GFP and normal group) analyzed by flow cytometry. The 3 groups of cells (LV-siNesprin-1, LV-GFP and normal group) were cultured for 72 h under the same conditions. Cell cycle was then analyzed by flow cytometry. The differentiation of cells in the LV-siNesprin-1 group was slower than that of cells in the LV-GFP and normal group; the cells were mainly in the G0/G1 phase of the cell cycle, (approximately 68.45±3.75%). In the LV-GFP and normal group, the percentage of cells in this phase was approximately 40.57±2.45 and 42.17±2.05%, respectively. The difference between the LV-siNesprin-1 group and the normal group was statistically significant (P=0.035; P<0.05).

Apoptosis of MSCs in the 3 groups (LV-siNesprin-1, LV-GFP and normal group)

The 3 groups of cells (LV-siNesprin-1, LV-GFP and normal group) were cultured for 72 h under the same conditions. The apoptosis of the cells was detected by flow cytometry. In the LV-siNesprin-1 group, the apoptotic rate of the cells was higher than that of the cells in the LV-GFP and normal group (Fig. 7).

Figure 7

Cell apoptosis of mesenchymal stem cells (MSCs) in the 3 groups (LV-siNesprin-1, LV-GFP and normal group) detected by flow cytometry. The 3 groups of cells (LV-siNesprin-1, LV-GFP and normal group) were cultured for 72 h under the same conditions. The cell cycle was analyzed by flow cytometry. The apoptotic rate of the cells in the LV-siNesprin-1 group was higher than that of cells in the LV-GFP and normal group; the percentage of apoptotic cells in the LV-siNesprin-1 group was approximately 15.12±0.97% at 72 h. The percentage of apoptotic cells in the LV-GFP and normal group was approximately 6.86±1.26 and 5.04±0.80%, respectively. The difference between the LV-siNesprin-1 group and the LV-GFP/normal group was statistically significant (P=0.032, P=0.025, respectively; P<0.05).

Changes in the morphology of the nucleus following transfection of MSCs with LV-siNesprin-1

As shown in Fig. 8, the morphology of the nucleus in the LV-siNesprin-1 group was altered; morphological changes such as fusion and fragmentation were observed.

Figure 8

The morphology of the nucleus in the mesenchymal stem cells (MSCs) was observed 72 h after transfection and staining with DAPI. (A) The morphology of the nucleus in the LV-siNesprin-1 group was altered; morphological changes such as fusion and fragmentation were observed (×200). (B) The morphology of the nucleus in the LV-GFP group was not altered (×200). (C) The morphology of the nucleus in the normal group (×200).

Discussion

Nesprins have been reported to bind to the nuclear membrane. Through interaction with both emerin and lamin A/C, nesprin is localized to the nuclear membrane (2,4,5,21). The structure of the various nesprin isoforms suggests that they also form a protein scaffold that links the nuclear membrane with the nucleus, cytoplasmic organelles and the cell membrane via the actin cytoskeleton. Nesprin (C. elegans ANC-1) mutations may disrupt the positioning of the mitochondria in mononuclear cells (22). These studies suggest a structural role for nesprins in nuclear migration and the positioning of major organelles (23). Nesprin (Drosophila MSP-300) has been shown to be localized to regions of the cell margin involved in exoskeletal attachment and to the Z-lines in sarcomeres. These studies suggest its role in the structural organization of the sarcomere and in signalling from the extracellular environment to the nucleus. Gough et al (24) concluded that the nesprin-1 gene is expressed in a variety of forms that are multifunctional and are capable of functioning at both the Golgi and the nuclear envelope, with the linking of the 2 organelles taking place during muscle cell differentiation.

Nesprins are widely expressed in a variety of tissues; the high expression of both nesprin-1 and -2 has been observed in skeletal, cardiac and vascular smooth muscls. Zhang et al (2) suggested that nesprins have a specific function in muscle cell differentiation. However, the high expression of nesprin-1 has also been found in peripheral blood leukocytes and spleen, and nesprin-2 in the pancreas and testes. Nesprins are highly expressed in muscles with both nesprin-1 and -2 muscle-specific isoforms (2,21,25). In vitro, during the differentiation of C2C12 myoblasts into myotubes, nesprin changes its localization from the nuclear membrane to the cytoplasm/sarcomere, indicating its specific roles during muscle differentiation (2,4). In the sarcomere of skeletal muscle cells, different nesprin-1 and -2 epitopes are associated with the Z-line, the A/I junction, the sarcoplasmic reticulum and the mitochondrial membrane, indicating that nesprins may play the role of maintaining sarcomeric structure (4,25). In addition, sarcomeric proteins have been identified as potential interacting partners for nesprins, including the ryanodine receptor and mAKAP (25,26). mAKAP is targeted to the nuclear membrane by nesprin-1 and they interact through their closely related spectrin repeats (26). Potentially, nesprins may be involved in maintaining and/or targeting protein complexes common to both the nuclear membrane and the sarcoplasmic reticulum (25). Cardiomyocyte nuclei have been found to be elongated in Δ/Δ KASH mouse hearts. These findings reflect what has been reported on lamin A/C gene mutations and reinforce the importance of an intact nuclear membrane complex for normal heart function (6). It has been shown that Δ/Δ KASH mice (lacking the carboxy-terminus of nesprin-1) develop cardiomyopathy with associated cardiac conduction system disease. Older mutant animals have been shown to have elongated P wave duration, elevated atrial and ventricular effective refractory periods, indicating conduction system defects in the myocardium. It has been found that cardiomyocyte nuclei are elongated with reduced heterochromatin in Δ/Δ KASH mouse hearts (6).

The abovementioned data indicate that nesprin seems to play a key role in adult cell mitosis, RNA transport and the stability of the nuclear membrane. Yet, little is known about the role of the nesprin-1 protein, particularly nesprin-1 in stem cells (MSCs). In the present study, we aimed to elucidate the function of nesprin-1 protein in BMSCs by designing a nesprin-1 siRNA lentiviral vector. Following the transfection of the MSCs with LV-siNesprin-1, we found that the protein expression of nesprin-1 in the LV-siNesprin-1 group was lower than that in the LV-GFP and normal group; the proliferation of the MSCs in the LV-siNesprin-1 group was also reduced. However, the apoptotic rate was increased in the LV-siNesprin-1 group compared with the LV-GFP and normal group. As shown by morphological analysis using a microscope, in the LV-siNesprin-1 group, morphological changes were observed in the nucleus, such as fusion and fragmentation. Thus, nesprin-1 mediates cell differentiation and regulates the proliferation and apoptosis of MSCs.

MSCs were first described in 1968 by Friedenstein et al (27). These cells can be expanded and induced, either in vitro or in vivo, and terminally differentiate into osteoblasts, chondrocytes, adipocytes, tenocytes, myotubes, neuronal cells and hematopoietic cells with strong self-renewal ability and genetic stability in vitro. Several research groups have reported that MSCs are able to proliferate and potentially differentiate in vitro (28–30). However, the ratio of MSCs in bone marrow cells is very low, approximately 0.001–0.01%; hence, the separation and amplification of MSCs is of vital significance. Wakitani et al (31) described a method of isolating MSCs from rat bone marrow with Ficoll density gradient separation and adherent culture. Currently, the International Society for Cellular Therapy proposed 3 minimal criteria for defining MSCs (32): i) MSCs must be plastic-adherent if maintained in standard culture conditions; ii) MSCs must express CD105, CD73 and CD90, but must not express haematopoietic markers, such as CD45, CD34, CD14 or CD11b; and iii) MSCs must be capable of differentiating into fibroblasts, osteoblasts, adipocytes and chondroblasts under the corresponding lineage, particularly in in vitro conditions. In this study, we detected the MSC surface antigens, CD90 and CD29, by flow cytometry, with the percentage of CD90 and CD29 as high as 98%, and the percentage of CD45 approximately 1%.

Xu et al (33) reported that the ability of human MSCs to proliferate remained strong between passages 2 and 6, then the apoptosis of MSCs began to accelerate. In the process of MSC proliferation and differentiation, the upregulation of the protein expression of nesprin-1 may maintain the stability of the MSC nuclear membrane and reduce the apoptosis of the MSCs; this may provide a theoretical basis and gain more seed cells for the improvement of therapeutic modalities for heart disease.

Acknowledgements

This study was supported by a grant from the Municipal Committee of Science and Technology of Shanghai, China (no. 064119636).

References

1 

Lammerding J, Schulze PC, Takahashi T, et al: Lamin A/C deficiency causes defective nuclear mechanics and mechanotransduction. J Clin Invest. 113:370–378. 2004. View Article : Google Scholar : PubMed/NCBI

2 

Zhang Q, Skepper JN, Yang F, et al: Nesprins: a novel family of spectrin-repeat-containing proteins that localize to the nuclear membrane in multiple tissues. J Cell Sci. 114:4485–4498. 2001.PubMed/NCBI

3 

Apel ED, Lewis RM, Grady RM and Sanes JR: Syne-1, a dystrophin- and Klarsicht-related protein associated with synaptic nuclei at the neuromuscular junction. J Biol Chem. 275:31986–31995. 2000. View Article : Google Scholar : PubMed/NCBI

4 

Zhang Q, Ragnauth CD, Skepper JN, et al: Nesprin-2 is a multi-isomeric protein that binds lamin and emerin at the nuclear envelope and forms a subcellular network in skeletal muscle. J Cell Sci. 118:673–687. 2005. View Article : Google Scholar : PubMed/NCBI

5 

Mislow JM, Kim MS, Davis DB and McNally EM: Myne-1, a spectrin repeat transmembrane protein of the myocyte inner nuclear membrane, interacts with lamin A/C. J Cell Sci. 115:61–70. 2002.PubMed/NCBI

6 

Puckelwartz MJ, Kessler EJ, Kim G, et al: Nesprin-1 mutations in human and murine cardiomyopathy. J Mol Cell Cardiol. 48:600–608. 2010. View Article : Google Scholar : PubMed/NCBI

7 

Pittenger MF, Mackay AM, Beck SC, et al: Multilineage potential of adult human mesenchymal stem cells. Science. 284:143–147. 1999. View Article : Google Scholar : PubMed/NCBI

8 

Minguell JJ, Erices A and Conget P: Mesenchymal stem cells. Exp Biol Med (Maywood). 226:507–520. 2001.PubMed/NCBI

9 

Devine SM: Mesenchymal stem cells: will they have a role in the clinic? J Cell Biochem Suppl. 38:73–79. 2002. View Article : Google Scholar : PubMed/NCBI

10 

Nagaya N, Fujii T, Iwase T, et al: Intravenous administration of mesenchymal stem cells improves cardiac function in rats with acute myocardial infarction through angiogenesis and myogenesis. Am J Physiol Heart Circ Physiol. 287:H2670–H2676. 2004. View Article : Google Scholar

11 

Miyahara Y, Nagaya N, Kataoka M, et al: Monolayered mesenchymal stem cells repair scarred myocardium after myocardial infarction. Nat Med. 12:459–465. 2006. View Article : Google Scholar : PubMed/NCBI

12 

Nagaya N, Kangawa K, Itoh T, et al: Transplantation of mesenchymal stem cells improves cardiac function in a rat model of dilated cardiomyopathy. Circulation. 112:1128–1135. 2005. View Article : Google Scholar : PubMed/NCBI

13 

Naldini L, Blömer U, Gallay P, et al: In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science. 272:263–267. 1996. View Article : Google Scholar : PubMed/NCBI

14 

Dull T, Zufferey R, Kelly M, et al: A third-generation lentivirus vector with a conditional packaging system. J Virol. 72:8463–8471. 1998.PubMed/NCBI

15 

Guenechea G, Gan OI, Inamitsu T, et al: Transduction of human CD34+ CD38− bone marrow and cord blood-derived SCID-repopulating cells with third-generation lentiviral vectors. Mol Ther. 1:566–573. 2000.

16 

Naldini L, Blömer U, Gage FH, Trono D and Verma IM: Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector. Proc Natl Acad Sci USA. 93:11382–11388. 1996. View Article : Google Scholar : PubMed/NCBI

17 

Kafri T, Blömer U, Peterson DA, Gage FH and Verma IM: Sustained expression of genes delivered directly into liver and muscle by lentiviral vectors. Nat Genet. 17:314–317. 1997. View Article : Google Scholar : PubMed/NCBI

18 

Vermes I, Haanen C, Steffens-Nakken H and Reutelingsperger C: A novel assay for apoptosis. Flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled Annexin V. J Immunol Methods. 184:39–51. 1995. View Article : Google Scholar

19 

Koopman G, Reutelingsperger CP, Kuijten GA, Keehnen RM, Pals ST and van Oers MH: Annexin V for flow cytometric detection of phosphatidylserine expression on B cells undergoing apoptosis. Blood. 84:1415–1420. 1994.PubMed/NCBI

20 

Park C, Moon DO, Choi IW, et al: Curcumin induces apoptosis and inhibits prostaglandin E2 production in synovial fibroblasts of patients with rheumatoid arthritis. Int J Mol Med. 20:365–372. 2007.PubMed/NCBI

21 

Mislow JM, Holaska JM, Kim MS, et al: Nesprin-1alpha self-associates and binds directly to emerin and lamin A in vitro. FEBS Lett. 525:135–140. 2002. View Article : Google Scholar : PubMed/NCBI

22 

Starr DA and Han M: Role of ANC-1 in tethering nuclei to the actin cytoskeleton. Science. 298:406–409. 2002. View Article : Google Scholar : PubMed/NCBI

23 

Starr DA and Han M: ANChors away: an actin based mechanism of nuclear positioning. J Cell Sci. 116:211–216. 2003. View Article : Google Scholar : PubMed/NCBI

24 

Gough LL, Fan J, Chu S, Winnick S and Beck KA: Golgi localization of Syne-1. Mol Biol Cell. 14:2410–2424. 2003. View Article : Google Scholar : PubMed/NCBI

25 

Zhang Q, Ragnauth C, Greener MJ, Shanahan CM and Roberts RG: The nesprins are giant actin-binding proteins, orthologous to Drosophila melanogaster muscle protein MSP-300. Genomics. 80:473–481. 2002. View Article : Google Scholar : PubMed/NCBI

26 

Pare GC, Easlick JL, Mislow JM, McNally EM and Kapiloff MS: Nesprin-1alpha contributes to the targeting of mAKAP to the cardiac myocyte nuclear envelope. Exp Cell Res. 303:388–399. 2005. View Article : Google Scholar : PubMed/NCBI

27 

Friedenstein AJ, Petrakova KV, Kurolesova AI and Frolova GP: Heterotopic of bone marrow. Analysis of precursor cells for osteogenic and hematopoietic tissues. Transplantation. 6:230–247. 1968.PubMed/NCBI

28 

Dennis JE and Charbord P: Origin and differentiation of human and murine stroma. Stem Cells. 20:205–214. 2002. View Article : Google Scholar : PubMed/NCBI

29 

Campagnoli C, Roberts IA, Kumar S, Bennett PR, Bellantuono I and Fisk NM: Identification of mesenchymal stem/progenitor cells in human first-trimester fetal blood, liver, and bone marrow. Blood. 98:2396–2402. 2001. View Article : Google Scholar : PubMed/NCBI

30 

Martin DR, Cox NR, Hathcock TL, Niemeyer GP and Baker HJ: Isolation and characterization of multipotential mesenchymal stem cells from feline bone marrow. Exp Hematol. 30:879–886. 2002. View Article : Google Scholar : PubMed/NCBI

31 

Wakitani S, Saito T and Caplan AI: Myogenic cells derived from rat bone marrow mesenchymal stem cells exposed to 5-azacytidine. Muscle Nerve. 18:1417–1426. 1995. View Article : Google Scholar : PubMed/NCBI

32 

Dominici M, Le Blanc K, Mueller I, et al: Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy. 8:315–317. 2006. View Article : Google Scholar

33 

Xu W, Zhang X, Qian H, et al: Mesenchymal stem cells from adult human bone marrow differentiate into a cardiomyocyte phenotype in vitro. Exp Biol Med (Maywood). 229:623–631. 2004.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yang W, Zheng H, Wang Y, Lian F, Hu Z and Xue S: Nesprin-1 plays an important role in the proliferation and apoptosis of mesenchymal stem cells. Int J Mol Med 32: 805-812, 2013.
APA
Yang, W., Zheng, H., Wang, Y., Lian, F., Hu, Z., & Xue, S. (2013). Nesprin-1 plays an important role in the proliferation and apoptosis of mesenchymal stem cells. International Journal of Molecular Medicine, 32, 805-812. https://doi.org/10.3892/ijmm.2013.1445
MLA
Yang, W., Zheng, H., Wang, Y., Lian, F., Hu, Z., Xue, S."Nesprin-1 plays an important role in the proliferation and apoptosis of mesenchymal stem cells". International Journal of Molecular Medicine 32.4 (2013): 805-812.
Chicago
Yang, W., Zheng, H., Wang, Y., Lian, F., Hu, Z., Xue, S."Nesprin-1 plays an important role in the proliferation and apoptosis of mesenchymal stem cells". International Journal of Molecular Medicine 32, no. 4 (2013): 805-812. https://doi.org/10.3892/ijmm.2013.1445
Copy and paste a formatted citation
x
Spandidos Publications style
Yang W, Zheng H, Wang Y, Lian F, Hu Z and Xue S: Nesprin-1 plays an important role in the proliferation and apoptosis of mesenchymal stem cells. Int J Mol Med 32: 805-812, 2013.
APA
Yang, W., Zheng, H., Wang, Y., Lian, F., Hu, Z., & Xue, S. (2013). Nesprin-1 plays an important role in the proliferation and apoptosis of mesenchymal stem cells. International Journal of Molecular Medicine, 32, 805-812. https://doi.org/10.3892/ijmm.2013.1445
MLA
Yang, W., Zheng, H., Wang, Y., Lian, F., Hu, Z., Xue, S."Nesprin-1 plays an important role in the proliferation and apoptosis of mesenchymal stem cells". International Journal of Molecular Medicine 32.4 (2013): 805-812.
Chicago
Yang, W., Zheng, H., Wang, Y., Lian, F., Hu, Z., Xue, S."Nesprin-1 plays an important role in the proliferation and apoptosis of mesenchymal stem cells". International Journal of Molecular Medicine 32, no. 4 (2013): 805-812. https://doi.org/10.3892/ijmm.2013.1445
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team