Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
July-2016 Volume 38 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2016 Volume 38 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Network analysis of genes involved in the enhancement of hyperthermia sensitivity by the knockdown of BAG3 in human oral squamous cell carcinoma cells

  • Authors:
    • Tatsuya Yunoki
    • Yoshiaki Tabuchi
    • Atsushi Hayashi
    • Takashi Kondo
  • View Affiliations / Copyright

    Affiliations: Department of Ophthalmology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194, Japan, Division of Molecular Genetics Research, Life Science Research Center, University of Toyama, Toyama 930-0194, Japan, Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194, Japan
  • Pages: 236-242
    |
    Published online on: May 31, 2016
       https://doi.org/10.3892/ijmm.2016.2621
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

BCL2-associated athanogene 3 (BAG3), a co-chaperone of the heat shock 70 kDa protein (HSPA) family of proteins, is a cytoprotective protein that acts against various stresses, including heat stress. The aim of the present study was to identify gene networks involved in the enhancement of hyperthermia (HT) sensitivity by the knockdown (KD) of BAG3 in human oral squamous cell carcinoma (OSCC) cells. Although a marked elevation in the protein expression of BAG3 was detected in human the OSCC HSC-3 cells exposed to HT at 44˚C for 90 min, its expression was almost completely suppressed in the cells transfected with small interfering RNA against BAG3 (siBAG) under normal and HT conditions. The silencing of BAG3 also enhanced the cell death that was increased in the HSC-3 cells by exposure to HT. Global gene expression analysis revealed many genes that were differentially expressed by >2-fold in the cells exposed to HT and transfected with siBAG. Moreover, Ingenuity® pathways analysis demonstrated two unique gene networks, designated as Pro-cell death and Anti-cell death, which were obtained from upregulated genes and were mainly associated with the biological functions of induction and the prevention of cell death, respectively. Of note, the expression levels of genes in the Pro-cell death and Anti-cell death gene networks were significantly elevated and reduced in the HT + BAG3-KD group compared to those in the HT control group, respectively. These results provide further insight into the molecular mechanisms involved in the enhancement of HT sensitivity by the silencing of BAG3 in human OSCC cells.

Introduction

Hyperthermia (HT) therapy in combination with either chemotherapy, radiotherapy or both are used for patients with cancer in various organs. The anticancer effects of these combination therapies have been verified in many clinical trials (1–4). However, the acquisition of thermotolerance in cancer cells, which is at least partly due to an increase in the levels of heat shock proteins (HSPs), attenuates the therapeutic effects of HT (5,6). HSPs function as molecular chaperones, and their epxression is induced by various stresses, particularly heat. Moreover, it has been recognized that these proteins exert potent cytoprotective effects, which prevent cell death (7,8). HSPs consist of several family members, including DnaJ (Hsp40 homolog (DNAJ), heat shock 70 kDa protein (HSPA), heat shock 27 kDa protein (HSPB), heat shock 60 kDa protein (HSPD) and heat shock 105 kDa/110 kDa protein (HSPH), and among these, HSPA1A plays a major role as a molecular chaperone (9,10).

BCL2-associated athanogene (BAG) family proteins, an ubiquitous family of chaperone regulators, have been found to be associated with the anti-apoptotic protein, BCL2, and also to interact with HSPA proteins, such as HSPA1A and HSPA8 (11,12). Among the BAG proteins, the expression of BAG3 has been reported to be regulated, at least in part, by the activation of heat shock transcription factor 1 as in the cases of HSPs (13,14). Under normal conditions, the expression level of BAG3 is relatively low, whereas a significant elevation in its protein level is observed in cells exposed to stressors, such as heavy metals (15), heat (16–18), oxidative stress (19) and ultrasound (20). It has also been indicated that BAG3 is abundantly expressed in a variety of cancers, and is involved in cellular processes such as cell growth and cell death (11,12,16,21–24). Liu et al (25) previously reported that silencing the BAG3 gene sensitizes leukemic cells to compound-induced cell injury. Recently, we clearly demonstrated that the inhibition of BAG3 improves cell death sensitivity to HT in cancer cells (17,18). However, the detailed molecular mechanisms underling the enhancement of HT sensitivity by BAG3 knockdown (KD) in cancer cells have not yet been elucidated.

In the present study, we examined gene expression patterns in human oral squamous cell carcinoma (OSCC) HSC-3 cells exposed to HT and transfected with small interfering RNA (siRNA) against BAG3 using a global-scale microarray system. In addition, gene network analysis of differentially expressed genes was performed using computational gene expression analysis tools.

Materials and methods

Cell culture and exposure to HT

Human OSCC HSC-3 cells were obtained from the Human Science Research Resources Bank, Japan Health Sciences Foundation (Tokyo, Japan). The HSC-3 cells were cultured in E-MEM (Wako Pure Chemical Industries, Ltd., Osaka, Japan) supplemented with 10% fetal bovine serum (FBS) at 37°C in humidified air with 5% CO2 and 95% air. Exposure to HT was were performed by immersing plastic culture vessels containing the attached cells in a water bath at 44°C for 90 min. Following exposure to HT, the cells were incubated for 6–24 h at 37°C, as previously described (26).

siRNA transfection

A siRNA (siBAG; GGUGGAUUCUAAA CCUGUU) targeting BAG3 for BAG3-KD was designed by Nippon EGT Co., Ltd. (Toyama, Japan). Luciferase siRNA (siLuc; CGUACGCGGAAUACUUCGA) was used as a negative control siRNA. The cells were incubated in Opti-MEM® I Reduced Serum Medium containing 20 nM siRNA and Lipofectamine™ RNAiMAX (both from Life Technologies Japan, Ltd., Tokyo, Japan) at 37°C. Six hours following transfection, the medium was exchanged for E-MEM supplemented with 10% FBS, and the cells were then maintained at 37°C for 42 h, as previously described (18).

Measurements of cell growth and cell death

The number of cells was counted using a hematocytometer. When the cell death was evaluated, the cells were treated with 0.2% trypan blue solution (NanoEnTek Inc., Seoul, Korea) at room temperature for 5 min. The number of dead cells (stained) and viable cells (unstained) was counted using an EVE™ automatic cell counter (NanoEnTek Inc.).

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blot analysis

The cells were dissolved in lysis buffer (150 mM NaCl, 1% Nonidet P-40 and 50 mM Tris-HCl, pH 8.0) containing a protease inhibitor cocktail (Nacalai Tesque Inc., Kyoto, Japan). SDS-PAGE and western blot analysis were carried out as previously described (27,28). The primary antibodies used were as follows: a rabbit monoclonal anti-BAG3 antibody (GTX62327; GeneTex Inc., Irvine, CA, USA) and a mouse monoclonal anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) antibody (MAB374; Millipore Co., Temecula, CA, USA). Immunoreactive proteins were visualized using a luminescent image analyzer (LAS-4000 mini; GE Healthcare, Tokyo, Japan) using an enhanced chemiluminescence detection system. GAPDH served as a loading control.

RNA isolation

Total RNA was extracted from cells using a NucleoSpin® RNA isolation kit (Macherey-Nagel GmbH & Co., Düren, Germany) along with on-column DNase I treatment. The RNA quality was analyzed using a Bioanalyzer 2100 (Agilent Technologies, Inc., Santa Clara, CA, USA). RNA samples with RNA integrity number (RIN) values >9.5 were considered acceptable.

Quantitative (real-time) polymerase chain reaction (qPCR)

qPCR was performed on a Real-Time PCR system Mx3005P (Agilent Technologies, Inc.) using SYBR® Premix Ex Taq™ II (Takara Bio, Inc., Shiga, Japan) according to the manufacturer's instructions. Reverse transcriptase reaction was carried out with total RNA using a random 6 mers and an oligo dT primer (PrimeScript RT reagent kit; Takara Bio, Inc.). The reaction was carried out using the specific primers: human BAG3 forward and reverse, CGACCAGGCTACATTCCCAT and TCTGGCT GAGTGGTTTCTGG, respectively; human GAPDH forward and reverse, AAGGCTGGGGCTCATTTGCA and ATGACC TTGCCCACAGCCTT, respectively. The temperature cycling conditions for each primer consisted of 10 min at 95°C followed by 40 cycles for 10 sec at 95°C and 40 sec at 60°C. The mRNA expression level of BAG3 was normalized with respect to the mRNA expression level of GAPDH, as described in a previous study of ours (18).

Microarray gene expression analysis

Microarray gene expression analysis was performed using a GeneChip® system with a Human Genome U133-plus 2.0 array, which was spotted with 54,675 probe sets (Affymetrix, Inc., Santa Clara, CA, USA) according to the manufacturer's instructions. In brief, 500 ng of total RNA was used to synthesize cRNA with a GeneChip® 3′ IVT Express kit (Affymetrix, Inc.). Fragmentated biotin-labeled cRNA was hybridized to the array at 45°C for 16 h. After the staining with streptavidin-phycoerythrin, the array was scanned using a probe array scanner. The obtained hybridization intensity data were analyzed using GeneSpring® GX software (Agilent Technologies, Inc.) to extract the significant genes. To examine gene ontology, including biological processes, cellular components, molecular functions and gene networks, the obtained data were analyzed using Ingenuity® pathway analysis tools (Ingenuity Systems, Inc., Mountain View, CA, USA), as previously described (29,30).

Statistical analysis

Data are shown as the means ± SD. The Student's t-test was used for statistical analysis and P-values <0.05 were considered to indicate statistically significant differences.

Results

Effects of BAG3-KD on the growth and death of HSC-3 cells exposed to HT

Although the mRNA expression level of BAG3 was relatively low in the HSC-3 cells transfected with siLuc (control), in the cells subjected to both siLuc transfection and HT exposure at 44°C (HT control), a significantly increased expression level of BAG3 was observed. A significant decrease in the mRNA expression level of BAG3 was detected in the cells transfected with siBAG under both the control (siLuc) and HT conditions (Fig. 1A). The results of western blot analysis clearly demonstrated that the protein expression level of BAG3 was significantly increased in the cells exposed to HT. Transfection of the cells with siBAG almost completely inhibited the protein expression level of BAG3 under either condition (Fig. 1B). We then evaluated whether BAG3-KD affected the growth and death of HSC-3 cells exposed to HT. At the normal temperature, transfection of the cells with siBAG significantly suppressed the cell number compared to the control group. HT markedly decreased cell growth, and a further decrease in the number of cells was observed in the cells subjected to both siBAG transfection and exposure to HT to those exposed to HT alone (Fig. 2A). HT significantly enhanced cell death. Moreover, a significant increase in cell death was observed in the cells subjected to both siBAG transfection and exposure to HT compared to those exposed to HT alone. These results indicate that the silencing of BAG3 enhances the sensitivity of human OSCC HSC-3 cells to HT (Fig. 2B).

Figure 1

Effects of BCL2-associated athanogene 3 (BAG3)-knockdown (KD) on the mRNA and protein expression levels of BAG3 in HSC-3 cells exposed to hyperthermia (HT). HSC-3 cells transfected with luciferase siRNA (siLuc) or BAG3 siRNA (siBAG) were incubated at 37°C or 44°C for 90 min (HT exposure). Six hours later, the cells were harvested. (A) qPCR was performed with specific primers for BAG3 or glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The mRNA level of BAG3 was normalized to the expression level of GAPDH. Data are presented as the means ± SD (n=4); *P<0.05 vs. the control (siLuc transfection only); #P<0.05 vs. the HT-exposed group. (B) Western blot analysis was performed using specific primary antibodies for BAG3 and GAPDH. GAPDH served as a loading control.

Figure 2

Effects of BCL2-associated athanogene 3 (BAG3)-knockdown (KD) on the growth and cell of HSC-3 cells exposed to hyperthermia (HT). HSC-3 cells transfected with luciferase siRNA (siLuc) or BAG3 siRNA (siBAG) were incubated at 37°C or 44°C for 90 min (HT exposure). (A) The cell number and (B) cell death were evaluated 24 h after HT exposure. Data are presented as the means ± SD (n=4); *P<0.05 vs. the control (siLuc transfection only); #P<0.05 vs. the HT-exposed group.

Global gene expression analysis

To identify genes involved in the enhancement of HT sensitivity by BAG3-KD, global-scale gene expression analysis was carried out using a GeneChip® system with a Human Genome U133-plus 2.0 array, which was spotted with 54,675 probe sets. Complete lists of probe sets from all samples are available on the Gene Expression Omnibus, a public database (accession number, GSE75127). GeneSpring software was used to analyze gene expression in the HSC-3 cells subjected to both HT exposure and siLuc (HT control) or siBAG transfection (HT + BAG3-KD), and revealed that many genes were differentially regulated by a factor of ≥2.0. The Venn diagram in Fig. 3 summarizes the numbers of specifically and commonly expressed genes in each group. The total numbers of genes that were found to be differentially expressed were 913 (331 up- and 582 downregulated genes) and 1,892 (679 up- and 1,213 downregulated genes) in the HT control and HT + BAG3-KD groups, respectively. The numbers of commonly up- and downregulated genes were 204 and 303, respectively (Fig. 3A and B).

Figure 3

Venn diagram of genes that were differentially expressed in BCL2-associated athanogene 3 (BAG3)-knockdown (KD) HSC-3 cells under hyperthermia (HT) exposure conditions. HSC-3 cells transfected with luciferase siRNA (siLuc) or BAG3 siRNA (siBAG) were incubated at 37°C or 44°C for 90 min (HT exposure). Six hours following exposure to HT, total RNA was extracted. Gene expression analysis was carried out using a GeneChip microarray system and GeneSpring software. (A) The numbers of upregulated and (B) downregulated genes are shown. HT control indicates cells subjected to both HT exposure and transfection with siLuc; HT + BAG3-KD indicates both exposure to HT and transfection with siBAG.

Identification of biological functions and gene networks

In order to identify the biological functions and gene networks in differentially expressed genes involved in the enhancement of HT sensitivity by BAG3-KD, functional category and gene network analyses were conducted by use of the Ingenuity Pathways Knowledge Base. We identified many functionally annotated genes, and the top 3 biological functions in each group are summarized in Table I. In the upregulated genes, biological functions including cell death and survival, and/or cell growth and proliferation were observed in all 3 groups: i) the HT control only; ii) the HT + BAG3-KD only; and iii) the commonly regulated groups. On the other hand, these 2 biological functions were observed only in the downregulated genes of the HT + BAG3-KD only group. In addition, we identified 2 unique gene networks, and these are designated as Pro-cell death and Anti-cell death, that were obtained from the upregulated genes (Fig. 4). The Pro-cell death gene network included several transcription factors, such as activating transcription factor 2 (ATF2), CCAAT/enhancer binding protein β (CEBPB), DNA damage inducible transcript 3 (DDIT3), SMAD family member 2 (SMAD2) and sequestosome 1 (SQSTM1), as well as BCL2/adenovirus E1B 19 kDa interacting protein 3 (BNIP3), and was associated with the biological function of the induction of cell death (Fig. 4A). The Anti-cell death gene network contained several HSPs, such as DNAJB1, HSPA1A, HSPA5, HSPB1, HSPD1, and HSPH1, as well as BAG3 and clusterin (CLU), and was associated with the biological function of the prevention of cell death (Fig. 4B). The expression levels of genes in the Pro-cell death and Anti-cell death gene networks were significantly elevated and reduced in the HT + BAG3-KD group compared to those in the HT control group, respectively (Fig. 4A and B). As expected, the mRNA expression level of BAG3 was markedly decreased in the HT + BAG3-KD group as detected by the microarray system (Fig. 4B).

Figure 4

Gene networks, (A) Pro-cell death and (B) Anti-cell death. Upregulated genes in HSC-3 cells subjected to both hyperthermia (HT) and transfection with small interfering RNA against BAG3 (siBAG) were analyzed using the Ingenuity pathway analysis tools. Logarithmic scales of the expression levels of genes are shown. The network is represented graphically with nodes (genes) and edges (the biological associations between the nodes). HT control indicates exposure to HT and transfection with luciferase siRNA; HT + BAG3-KD indicates exposure to HT and transfection with siBAG.

Table I

Top three biological functions in differentially expressed genes.

Table I

Top three biological functions in differentially expressed genes.

NameP-valueNumber of molecules
Upregulated
 HT control only (75)a
  Cell growth and proliferation 5.02E-05–4.19E-0236
  Post-translational modification 1.20E-04–3.51E-026
  Protein folding 1.20E-04–2.12E-024
  HT + BAG3-KD only (263)a
  Cell growth and proliferation 1.47E-05–2.73E-02123
  Cell death and survival 3.35E-05–2.73E-02121
  Cellular development 1.93E-04–2.73E-0292
  Commonly regulated (133)a
  Cell death and survival 2.03E-17–2.70E-0382
  Cell growth and proliferation 4.39E-14–2.70E-0384
  Cell cycle 1.26E-12–2.70E-0339
Downregulated
  HT control only (62)a
  Cell cycle 7.27E-04–4.99E-0217
  Gene expression 3.52E-03–4.63E-026
  Protein synthesis 4.88E-04–1.57E-023
  HT + BAG3-KD only (432)a
  Cellular development 2.20E-06–2.64E-02123
  Cell growth and proliferation 2.20E-06–2.70E-02121
  Cell death and survival 1.28E-05–2.70E-0292
  Commonly regulated (108)a
  RNA post-transcriptional modification 4.19E-05–3.58E-029
  Cell cycle 2.90E-04–4.74E-0232
  Cell morphology 2.90E-04–3.58E-0226

a Numbers of functionally annotated genes. HT, hyperthermia; BAG3, BCL2-associated athanogene 3; KD, knockdown.

Discussion

BAG3, a co-chaperone of the HSPA family of proteins, is well known as a cytoprotective protein that acts against various stresses, including heat stress (11,12,16,21–25). In the present study, the almost complete silencing of BAG3 significantly enhanced sensitivity of human OSCC HSC-3 cells to HT. This finding is compatible with those of our previous studies (17,18). In addition, using global-scale microarray and bioinformatics analyses, we herein identified genes and gene networks involved in the enhancement of HT sensitivity in BAG3-KD OSCC cells.

Our functional category analysis demonstrated that biological functions including cell death and survival, and cell growth and proliferation were observed in the upregulated genes in the cells from the HT + BAG3-KD group (Table I). Of note, we also successfully identified 2 unique gene networks, designated as Pro-cell death and Anti-cell death (Fig. 4). The Pro-cell death gene network consisted of 14 genes and was principally associated with the biological function of the induction of cell death. A marked induction of genes in this network was observed in the HT + BAG3-KD group compared to the HT control group (Fig. 4A). This network included 3 basic-region leucine zipper (bZIP) transcription factors, ATF2 (31), CEBPB (32) and DDIT3 (33), which have been reported to induce cell death. Homo- or hetero-dimeric protein complexes of the bZIP protein function as repressors and activators of transcription (34); associations have been identified between DDIT3 and both ATF2 and CEBPB (34–36). The activation of these bZIP transcription factors has also been reported to be regulated by kinases, such as glycogen synthase kinase 3β (GSK3β) (37), ribosomal protein S6 kinase, 90 kDa, polypeptide 2 (RPS6KA2) (38) and mitogen-activated protein kinase 12 (MAPK12) (39). Moreover, absent in melanoma 2 (AIM2) (40), BNIP3 (41), DEAD box polypeptide 58 (DDX58) (42), GTP cyclohydrolase 1 (GCH1) (43), ISG15 ubiquitin-like modifier (ISG15) (44), microtubule-associated protein 1 light chain 3 beta (MAP1LC3B) (45), SMAD2 (46), and SQSTM1 (47) have been reported to exert cell-damaging effects.

On the other hand, the expression levels of genes in the Anti-cell death gene network were significantly decreased in the HT + BAG3-KD group compared to those in the HT control group (Fig. 4B). This gene network consisted of 9 chaperone genes, 7 HSPs, CLU and BAG3. It is well known that HSPs protect cells both by protein chaperoning and refolding and by directly interfering with the cell death pathway (7,8). HSPs such as DNAJB1 (48), HSPA1A (48,49), HSPA2 (50), HSPA5 (51), HSPB1 (52), HSPD1 (49) and HSPH1 (53) were found to be associated with the prevention of cell death. Of note, BAG3 silencing markedly decreased the expression levels of CLU, DNAJB1, HSPA5, HSPB1, HSPD1 and HSPH1 in HSC-3 cells induced by HT exposure (Fig. 4B). CLU is a secreted or cytosolic chaperone that is expressed under certain stress conditions such as heat shock (54), and secretory human CLU has been reported to decrease the rate of cell death of human breast cancer cells (55). In addition, protein-protein interactions have been reported between BAG3 and DNAJB1 (12), HSPA5 (56) and HSPB1 (12) under in vitro experimental conditions.

Taken together, our results suggest that an increase in gene expression in the Pro-cell death gene network, and the decrease in gene expression in the Anti-cell death gene network may be closely associated with the enhancement of HT-induced cell death by BAG3-KD in OSCC cells. However, the interaction between gene expression and the enhancement of the HT effects remains a subject for further study. In clinical fields, HT combined with radiotherapy and/or chemotherapy has been used as a possible treatment modality for various types of cancer (1–4). However, the thermotolerance resulting from the elevation of HSP expression and other cytoprotective proteins in some cancer cells remains a disadvantage, diminishing the effects of HT (5,6). The functional silencing of BAG3, a co-chaperone of the HSPA family of proteins, may effectively enhance the sensitivity of cancer cells to HT. Therefore, the targeting of BAG3 in combination with HT may become a promising therapeutic approach for the treatment of cancer (17,18).

Abbreviations:

AIM2

absent in melanoma 2

ATF2

activating transcription factor 2

BAG

BCL2-associated athanogene

BNIP3

BCL2/adenovirus E1B 19 kDa interacting protein 3

bZIP

basic-region leucine zipper

CEBPB

CCAAT/enhancer binding protein β

CLU

clusterin

DDIT3

DNA damage inducible transcript 3

DDX58

DEAD box polypeptide 58

DNAJ

DnaJ (Hsp40) homolog

FBS

fetal bovine serum

GAPDH

glyceraldehyde 3-phosphate dehydrogenase

GCH1

GTP cyclohydrolase 1

GSK3B

glycogen synthase kinase 3β

HSPA

heat shock 70 kDa protein

HSPB

heat shock 27 kDa protein

HSPD

heat shock 60 kDa protein

HSPH

heat shock 105 kDa/110 kDa protein

HSPs

heat shock proteins

HT

hyperthermia

ISG15

ISG15 ubiquitin-like modifier

KD

knockdown

MAP1LC3B

microtubule-associated protein 1 light chain 3 beta

MAPK12

mitogen-activated protein kinase 12

OSCC

oral squamous cell carcinoma

qPCR

quantitative polymerase chain reaction

RPS6KA2

ribosomal protein S6 kinase, 90 kDa, polypeptide 2

SDS-PAGE

sodium dodecyl sulfate-polyacrylamide gel electrophoresis

siRNA

small interfering RNA

SMAD2

SMAD family member 2

SQSTM1

sequestosome 1

Acknowledgments

The present study was supported in part by a Grant-in-Aid for Challenging Exploratory Research (23650303) and a Grant-in-Aid for Scientific Research B (24310046) from Japan Society for the Promotion of Science, and by research grants from the University of Toyama.

References

1 

van der Zee J, González González D, van Rhoon GC, van Dijk JD, van Putten WL and Hart AA: Comparison of radiotherapy alone with radiotherapy plus hyperthermia in locally advanced pelvic tumours: a prospective, randomised, multicentre trial. Dutch Deep Hyperthermia Group. Lancet. 355:1119–1125. 2000. View Article : Google Scholar : PubMed/NCBI

2 

Harima Y, Nagata K, Harima K, Ostapenko VV, Tanaka Y and Sawada S: A randomized clinical trial of radiation therapy versus thermoradiotherapy in stage IIIB cervical carcinoma. Int J Hyperthermia. 17:97–105. 2001. View Article : Google Scholar : PubMed/NCBI

3 

Westermann A, Mella O, Van Der Zee J, Jones EL, Van Der Steen-Banasik E, Koper P, Uitterhoeve AL, De Wit R, Van Der Velden J, Burger C, et al: Long-term survival data of triple modality treatment of stage IIB-III-IVA cervical cancer with the combination of radiotherapy, chemotherapy and hyperthermia - an update. Int J Hyperthermia. 28:549–553. 2012. View Article : Google Scholar : PubMed/NCBI

4 

Cihoric N, Tsikkinis A, van Rhoon G, Crezee H, Aebersold DM, Bodis S, Beck M, Nadobny J, Budach V, Wust P, et al: Hyperthermia-related clinical trials on cancer treatment within the http://ClinicalTrials.govurisimpleClinicalTrials.gov registry. Int J Hyperthermia. 31:609–614. 2015. View Article : Google Scholar : PubMed/NCBI

5 

Li GC, Mivechi NF and Weitzel G: Heat shock proteins, thermotolerance, and their relevance to clinical hyperthermia. Int J Hyperthermia. 11:459–488. 1995. View Article : Google Scholar : PubMed/NCBI

6 

Nollen EA, Brunsting JF, Roelofsen H, Weber LA and Kampinga HH: In vivo chaperone activity of heat shock protein 70 and thermotolerance. Mol Cell Biol. 19:2069–2079. 1999. View Article : Google Scholar : PubMed/NCBI

7 

Beere HM: 'The stress of dying': the role of heat shock proteins in the regulation of apoptosis. J Cell Sci. 117:2641–2651. 2004. View Article : Google Scholar : PubMed/NCBI

8 

Lanneau D, Wettstein G, Bonniaud P and Garrido C: Heat shock proteins: cell protection through protein triage. Scientific World Journal. 10:1543–1552. 2010. View Article : Google Scholar : PubMed/NCBI

9 

Ohtsuka K and Hata M: Molecular chaperone function of mammalian Hsp70 and Hsp40 - a review. Int J Hyperthermia. 16:231–245. 2000. View Article : Google Scholar : PubMed/NCBI

10 

Vos MJ, Hageman J, Carra S and Kampinga HH: Structural and functional diversities between members of the human HSPB, HSPH, HSPA, and DNAJ chaperone families. Biochemistry. 47:7001–7011. 2008. View Article : Google Scholar : PubMed/NCBI

11 

Kabbage M and Dickman MB: The BAG proteins: a ubiquitous family of chaperone regulators. Cell Mol Life Sci. 65:1390–1402. 2008. View Article : Google Scholar : PubMed/NCBI

12 

Taipale M, Tucker G, Peng J, Krykbaeva I, Lin ZY, Larsen B, Choi H, Berger B, Gingras AC and Lindquist S: A quantitative chaperone interaction network reveals the architecture of cellular protein homeostasis pathways. Cell. 158:434–448. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Franceschelli S, Rosati A, Lerose R, De Nicola S, Turco MC and Pascale M: Bag3 gene expression is regulated by heat shock factor 1. J Cell Physiol. 215:575–577. 2008. View Article : Google Scholar : PubMed/NCBI

14 

Du ZX, Zhang HY, Meng X, Gao YY, Zou RL, Liu BQ, Guan Y and Wang HQ: Proteasome inhibitor MG132 induces BAG3 expression through activation of heat shock factor 1. J Cell Physiol. 218:631–637. 2009. View Article : Google Scholar

15 

Pagliuca MG, Lerose R, Cigliano S and Leone A: Regulation by heavy metals and temperature of the human BAG-3 gene, a modulator of Hsp70 activity. FEBS Lett. 541:11–15. 2003. View Article : Google Scholar : PubMed/NCBI

16 

Liao Q, Ozawa F, Friess H, Zimmermann A, Takayama S, Reed JC, Kleeff J and Büchler MW: The anti-apoptotic protein BAG-3 is overexpressed in pancreatic cancer and induced by heat stress in pancreatic cancer cell lines. FEBS Lett. 503:151–157. 2001. View Article : Google Scholar : PubMed/NCBI

17 

Yunoki T, Kariya A, Kondo T, Hayashi A and Tabuchi Y: The combination of silencing BAG3 and inhibition of the JNK pathway enhances hyperthermia sensitivity in human oral squamous cell carcinoma cells. Cancer Lett. 335:52–57. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Yunoki T, Tabuchi Y, Hayashi A and Kondo T: BAG3 protects against hyperthermic stress by modulating NF-κB and ERK activities in human retinoblastoma cells. Graefes Arch Clin Exp Ophthalmol. 253:399–407. 2015. View Article : Google Scholar

19 

Bonelli P, Petrella A, Rosati A, Romano MF, Lerose R, Pagliuca MG, Amelio T, Festa M, Martire G, Venuta S, et al: BAG3 protein regulates stress-induced apoptosis in normal and neoplastic leukocytes. Leukemia. 18:358–360. 2004. View Article : Google Scholar

20 

Tabuchi Y, Ando H, Takasaki I, Feril LB Jr, Zhao QL, Ogawa R, Kudo N, Tachibana K and Kondo T: Identification of genes responsive to low intensity pulsed ultrasound in a human leukemia cell line Molt-4. Cancer Lett. 246:149–156. 2007. View Article : Google Scholar

21 

Chiappetta G, Ammirante M, Basile A, Rosati A, Festa M, Monaco M, Vuttariello E, Pasquinelli R, Arra C, Zerilli M, et al: The antiapoptotic protein BAG3 is expressed in thyroid carcinomas and modulates apoptosis mediated by tumor necrosis factor-related apoptosis-inducing ligand. J Clin Endocrinol Metab. 92:1159–1163. 2007. View Article : Google Scholar

22 

Festa M, Del Valle L, Khalili K, Franco R, Scognamiglio G, Graziano V, De Laurenzi V, Turco MC and Rosati A: BAG3 protein is overexpressed in human glioblastoma and is a potential target for therapy. Am J Pathol. 178:2504–2512. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Rosati A, Graziano V, De Laurenzi V, Pascale M and Turco MC: BAG3: a multifaceted protein that regulates major cell pathways. Cell Death Dis. 2:e1412011. View Article : Google Scholar : PubMed/NCBI

24 

Nymoen DA, Hetland Falkenthal TE, Holth A, Ow GS, Ivshina AV, Tropé CG, Kuznetsov VA, Staff AC and Davidson B: Expression and clinical role of chemoresponse-associated genes in ovarian serous carcinoma. Gynecol Oncol. 139:30–39. 2015. View Article : Google Scholar : PubMed/NCBI

25 

Liu P, Xu B, Li J and Lu H: BAG3 gene silencing sensitizes leukemic cells to bortezomib-induced apoptosis. FEBS Lett. 583:401–406. 2009. View Article : Google Scholar

26 

Kariya A, Furusawa Y, Yunoki T, Kondo T and Tabuchi Y: A microRNA-27a mimic sensitizes human oral squamous cell carcinoma HSC-4 cells to hyperthermia through downregulation of Hsp110 and Hsp90. Int J Mol Med. 34:334–340. 2014.PubMed/NCBI

27 

Laemmli UK: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227:680–685. 1970. View Article : Google Scholar : PubMed/NCBI

28 

Towbin H, Staehelin T and Gordon J: Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci USA. 76:4350–4354. 1979. View Article : Google Scholar : PubMed/NCBI

29 

Tabuchi Y, Takasaki I, Doi T, Ishii Y, Sakai H and Kondo T: Genetic networks responsive to sodium butyrate in colonic epithelial cells. FEBS Lett. 580:3035–3041. 2006. View Article : Google Scholar : PubMed/NCBI

30 

Tabuchi Y, Yunoki T, Hoshi N, Suzuki N and Kondo T: Genes and gene networks involved in sodium fluoride-elicited cell death accompanying endoplasmic reticulum stress in oral epithelial cells. Into J Mol Sci. 15:8959–8978. 2014. View Article : Google Scholar

31 

Baan B, van Dam H, van der Zon GC, Maassen JA and Ouwens DM: The role of c-Jun N-terminal kinase, p38, and extracellular signal-regulated kinase in insulin-induced Thr69 and Thr71 phosphorylation of activating transcription factor 2. Mol Endocrinol. 20:1786–1795. 2006. View Article : Google Scholar : PubMed/NCBI

32 

Pan HC, Yang CN, Hung YW, Lee WJ, Tien HR, Shen CC, Sheehan J, Chou CT and Sheu ML: Reciprocal modulation of C/EBP-α and C/EBP-β by IL-13 in activated microglia prevents neuronal death. Eur J Immunol. 43:2854–2865. 2013. View Article : Google Scholar : PubMed/NCBI

33 

Zinszner H, Kuroda M, Wang X, Batchvarova N, Lightfoot RT, Remotti H, Stevens JL and Ron D: CHOP is implicated in programmed cell death in response to impaired function of the endoplasmic reticulum. Genes Dev. 12:982–995. 1998. View Article : Google Scholar : PubMed/NCBI

34 

Newman JR and Keating AE: Comprehensive identification of human bZIP interactions with coiled-coil arrays. Science. 300:2097–2101. 2003. View Article : Google Scholar : PubMed/NCBI

35 

Reinke AW, Baek J, Ashenberg O and Keating AE: Networks of bZIP protein-protein interactions diversified over a billion years of evolution. Science. 340:730–734. 2013. View Article : Google Scholar : PubMed/NCBI

36 

Behrends C, Sowa ME, Gygi SP and Harper JW: Network organization of the human autophagy system. Nature. 466:68–76. 2010. View Article : Google Scholar : PubMed/NCBI

37 

Tang QQ, Grønborg M, Huang H, Kim JW, Otto TC, Pandey A and Lane MD: Sequential phosphorylation of CCAAT enhancer-binding protein beta by MAPK and glycogen synthase kinase 3beta is required for adipogenesis. Proc Natl Acad Sci USA. 102:9766–9771. 2005. View Article : Google Scholar : PubMed/NCBI

38 

Lee S, Shuman JD, Guszczynski T, Sakchaisri K, Sebastian T, Copeland TD, Miller M, Cohen MS, Taunton J, Smart RC, et al: RSK-mediated phosphorylation in the C/EBPβ leucine zipper regulates DNA binding, dimerization, and growth arrest activity. Mol Cell Biol. 30:2621–2635. 2010. View Article : Google Scholar : PubMed/NCBI

39 

Tibbles LA and Woodgett JR: The stress-activated protein kinase pathways. Cell Mol Life Sci. 55:1230–1254. 1999. View Article : Google Scholar : PubMed/NCBI

40 

Beamer WG, Shultz KL, Coombs HF III, DeMambro VE, Reinholdt LG, Ackert-Bicknell CL, Canalis E, Rosen CJ and Donahue LR: BMD regulation on mouse distal chromosome 1, candidate genes, and response to ovariectomy or dietary fat. J Bone Miner Res. 26:88–99. 2011. View Article : Google Scholar

41 

Wang EY, Gang H, Aviv Y, Dhingra R, Margulets V and Kirshenbaum LA: p53 mediates autophagy and cell death by a mechanism contingent on Bnip3. Hypertension. 62:70–77. 2013. View Article : Google Scholar : PubMed/NCBI

42 

Hiscott J, Lin R, Nakhaei P and Paz S: MasterCARD: a priceless link to innate immunity. Trends Mol Med. 12:53–56. 2006. View Article : Google Scholar : PubMed/NCBI

43 

Pickert G, Lim HY, Weigert A, Häussler A, Myrczek T, Waldner M, Labocha S, Ferreirós N, Geisslinger G, Lötsch J, et al: Inhibition of GTP cyclohydrolase attenuates tumor growth by reducing angiogenesis and M2-like polarization of tumor associated macrophages. Int J Cancer. 132:591–604. 2013. View Article : Google Scholar

44 

Yángüez E, García-Culebras A, Frau A, Llompart C, Knobeloch KP, Gutierrez-Erlandsson S, García-Sastre A, Esteban M, Nieto A and Guerra S: ISG15 regulates peritoneal macrophages functionality against viral infection. PLoS Pathog. 9:e10036322013. View Article : Google Scholar : PubMed/NCBI

45 

Yu L, Wan F, Dutta S, Welsh S, Liu Z, Freundt E, Baehrecke EH and Lenardo M: Autophagic programmed cell death by selective catalase degradation. Proc Natl Acad Sci USA. 103:4952–4957. 2006. View Article : Google Scholar : PubMed/NCBI

46 

Lin Y, Zhang B, Liang H, Lu Y, Ai X, Zhang B and Chen X: JNK inhibitor SP600125 enhances TGF-β-induced apoptosis of RBE human cholangiocarcinoma cells in a Smad-dependent manner. Mol Med Rep. 8:1623–1629. 2013.PubMed/NCBI

47 

Huang S, Yang ZJ, Yu C and Sinicrope FA: Inhibition of mTOR kinase by AZD8055 can antagonize chemotherapy-induced cell death through autophagy induction and down-regulation of p62/sequestosome 1. J Biol Chem. 286:40002–40012. 2011. View Article : Google Scholar : PubMed/NCBI

48 

Evert BO, Wüllner U and Klockgether T: Cell death in polyglutamine diseases. Cell Tissue Res. 301:189–204. 2000. View Article : Google Scholar : PubMed/NCBI

49 

Veereshwarayya V, Kumar P, Rosen KM, Mestril R and Querfurth HW: Differential effects of mitochondrial heat shock protein 60 and related molecular chaperones to prevent intracellular beta-amyloid-induced inhibition of complex IV and limit apoptosis. J Biol Chem. 281:29468–29478. 2006. View Article : Google Scholar : PubMed/NCBI

50 

Dix DJ, Allen JW, Collins BW, Poorman-Allen P, Mori C, Blizard DR, Brown PR, Goulding EH, Strong BD and Eddy EM: HSP70-2 is required for desynapsis of synaptonemal complexes during meiotic prophase in juvenile and adult mouse spermatocytes. Development. 124:4595–4603. 1997.PubMed/NCBI

51 

Zhou H, Zhang Y, Fu Y, Chan L and Lee AS: Novel mechanism of anti-apoptotic function of 78-kDa glucose-regulated protein (GRP78): endocrine resistance factor in breast cancer, through release of B-cell lymphoma 2 (BCL-2) from BCL-2-interacting killer (BIK). J Biol Chem. 286:25687–25696. 2011. View Article : Google Scholar : PubMed/NCBI

52 

Tchivilev I, Madamanchi NR, Vendrov AE, Niu XL and Runge MS: Identification of a protective role for protein phosphatase 1cgamma1 against oxidative stress-induced vascular smooth muscle cell apoptosis. J Biol Chem. 283:22193–22205. 2008. View Article : Google Scholar : PubMed/NCBI

53 

Saito Y, Yamagishi N, Ishihara K and Hatayama T: Identification of alpha-tubulin as an hsp105alpha-binding protein by the yeast two-hybrid system. Exp Cell Res. 286:233–240. 2003. View Article : Google Scholar : PubMed/NCBI

54 

Viard I, Wehrli P, Jornot L, Bullani R, Vechietti JL, Schifferli JA, Tschopp J and French LE: Clusterin gene expression mediates resistance to apoptotic cell death induced by heat shock and oxidative stress. J Invest Dermatol. 112:290–296. 1999. View Article : Google Scholar : PubMed/NCBI

55 

Flanagan L, Whyte L, Chatterjee N and Tenniswood M: Effects of clusterin over-expression on metastatic progression and therapy in breast cancer. BMC Cancer. 10:1072010. View Article : Google Scholar : PubMed/NCBI

56 

Kong DH, Zhang Q, Meng X, Zong ZH, Li C, Liu BQ, Guan Y and Wang HQ: BAG3 sensitizes cancer cells exposed to DNA damaging agents via direct interaction with GRP78. Biochim Biophys Acta. 1833:3245–3253. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yunoki T, Tabuchi Y, Hayashi A and Kondo T: Network analysis of genes involved in the enhancement of hyperthermia sensitivity by the knockdown of BAG3 in human oral squamous cell carcinoma cells. Int J Mol Med 38: 236-242, 2016.
APA
Yunoki, T., Tabuchi, Y., Hayashi, A., & Kondo, T. (2016). Network analysis of genes involved in the enhancement of hyperthermia sensitivity by the knockdown of BAG3 in human oral squamous cell carcinoma cells. International Journal of Molecular Medicine, 38, 236-242. https://doi.org/10.3892/ijmm.2016.2621
MLA
Yunoki, T., Tabuchi, Y., Hayashi, A., Kondo, T."Network analysis of genes involved in the enhancement of hyperthermia sensitivity by the knockdown of BAG3 in human oral squamous cell carcinoma cells". International Journal of Molecular Medicine 38.1 (2016): 236-242.
Chicago
Yunoki, T., Tabuchi, Y., Hayashi, A., Kondo, T."Network analysis of genes involved in the enhancement of hyperthermia sensitivity by the knockdown of BAG3 in human oral squamous cell carcinoma cells". International Journal of Molecular Medicine 38, no. 1 (2016): 236-242. https://doi.org/10.3892/ijmm.2016.2621
Copy and paste a formatted citation
x
Spandidos Publications style
Yunoki T, Tabuchi Y, Hayashi A and Kondo T: Network analysis of genes involved in the enhancement of hyperthermia sensitivity by the knockdown of BAG3 in human oral squamous cell carcinoma cells. Int J Mol Med 38: 236-242, 2016.
APA
Yunoki, T., Tabuchi, Y., Hayashi, A., & Kondo, T. (2016). Network analysis of genes involved in the enhancement of hyperthermia sensitivity by the knockdown of BAG3 in human oral squamous cell carcinoma cells. International Journal of Molecular Medicine, 38, 236-242. https://doi.org/10.3892/ijmm.2016.2621
MLA
Yunoki, T., Tabuchi, Y., Hayashi, A., Kondo, T."Network analysis of genes involved in the enhancement of hyperthermia sensitivity by the knockdown of BAG3 in human oral squamous cell carcinoma cells". International Journal of Molecular Medicine 38.1 (2016): 236-242.
Chicago
Yunoki, T., Tabuchi, Y., Hayashi, A., Kondo, T."Network analysis of genes involved in the enhancement of hyperthermia sensitivity by the knockdown of BAG3 in human oral squamous cell carcinoma cells". International Journal of Molecular Medicine 38, no. 1 (2016): 236-242. https://doi.org/10.3892/ijmm.2016.2621
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team