Open Access

Total C-21 steroidal glycosides, isolated from the root tuber of Cynanchum auriculatum Royle ex Wight, attenuate hydrogen peroxide-induced oxidative injury and inflammation in L02 cells

  • Authors:
    • Zhenhui Wu
    • Yingyu Wang
    • Xian Meng
    • Xinjie Wang
    • Zhenlin Li
    • Shihui Qian
    • Yingjie Wei
    • Luan Shu
    • Yongfang Ding
    • Peijuan Wang
    • Yunru Peng
  • View Affiliations

  • Published online on: September 25, 2018     https://doi.org/10.3892/ijmm.2018.3896
  • Pages: 3157-3170
  • Copyright: © Wu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Oxidative stress plays an important role in the pathology of liver disorders. Total C‑21 steroidal glycosides (TCSGs), isolated from the root tuber of Cynanchum auriculatum Royle ex Wight, have been reported to exert numerous effects, including liver protective and antioxidant effects. In order to investigate the potential mechanisms underlying the protective effects of TCSGs on liver function, the present study used the human normal liver cell line, L02, to evaluate the effects of TCSGs on hydrogen peroxide (H2O2)‑induced oxidative injury and inflammatory responses. The L02 cells were pretreated with various concentrations of TCSGs, followed by exposure to 1.5 mM H2O2. Cell viability was determined by a 3‑(4,5‑dimethylthiazol‑2‑yl)‑2,5‑diphenyltetrazolium bromide (MTT) assay. The levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), lactate dehydrogenase (LDH) and nitric oxide (NO) were measured using colorimetric assays. The activities of superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GSH‑Px) and the production of malondialdehyde (MDA) were also determined. Intracellular reactive oxygen species (ROS) levels were detected using a fluorescent probe. H2O2‑induced oxidative toxicity was attenuated following treatment with TCSGs, as indicated by the increase in cell viability, the decreased levels of ALT, AST, LDH, NO, MDA and ROS, and the increased activities of SOD, CAT and GSH‑Px. To further explore the possible mechanisms of action of TCSGs, the nuclear factor erythroid 2‑related factor 2 (Nrf2) and nuclear factor‑κB (NF)‑κB pathways were examined. The results revealed that treatment with TCSGs markedly induced Nrf2 nuclear translocation and upregulated the expression of heme oxygenase‑1 (HO‑1) in the L02 cells damaged by H2O2. In addition, pretreatment with TCSGs inhibited the NF‑κB signaling pathway by blocking the degradation of the inhibitor of nuclear factor κBα (IκBα), thereby reducing the expression and nuclear translocation of NF‑κB, as well as reducing the expression of tumor necrosis factor‑α (TNF‑α), interleukin-6 (IL‑6), inducible nitric oxide synthase (iNOS) and cyclooxygenase 2 (COX‑2). On the whole, the findings of this study demonstrate that TCSGs can protect L02 cells against H2O2‑induced oxidative toxicity and inflammatory injury by increasing the expression of Nrf2 and HO‑1, mediated by the NF‑κB signaling pathway.

Introduction

Cynanchum auriculatum (C. auriculatum) Royle ex Wight, a member of the Asclepiadaceae family, is widely distributed in China. The root tuber of C. auriculatum Royle ex Wight, a well-known traditional Chinese herbal medicine known as ‘Baishouwu’ has been used as a local tonic and medicine for >1,000 years since the Tang Dynasty in China (1). Modern phytochemical and pharmacological studies have demonstrated that C-21 steroidal glycosides are the major active components of Baishouwu (2,3). The total C-21 steroidal glycosides (TCSGs), isolated from Baishouwu, possess various pharmacological activities, including antitumor (411), aging-attenuating (12), free radical-scavenging (13), immunity-enhancing (14), depression-reducing (15) and fungus-suppressing (16) activities. Recently, it has been reported that the C-21 steroidal glycosides isolated from Baishouwu exhibit notable hepatoprotective effects in vivo (17). However, the underlying mechanisms remain largely unknown.

Pathological and experimental evidence has suggested that multiple mechanisms of hepatic injury are implicated in oxidative damage, inflammation, the dysfunction of intracellular targets and the innate immune system (1820). It has been well established that cell oxidative stress damage induced by reactive oxygen species (ROS) is a principal mechanism of hepatic injury. When there is an imbalance in the levels of intracellular oxidative factors and antioxidants, oxidative stress can result in a disruption in redox signaling and cellular injury (21,22). An increasing body of evidence has indicated that superoxide anion and hydrogen peroxide (H2O2) are associated with various pathological diseases, such as viral hepatitis (23), alcoholic hepatitis (24) and non-alcoholic fatty liver diseases (NAFLD) (25). H2O2-induced hepatic injury is a common cell model for investigating the potential hepatoprotective activity (26). Lipid peroxidation is one of the significant causes of H2O2-induced hepatic injury and can be monitored by detecting the content of intracellular malondialdehyde (MDA). The disruption of the hepatic antioxidant defense system is characterized by increased MDA and/or altered enzymatic antioxidants, including superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GSH-Px). The superoxide radical (O2) is an oxygen free radical that damages the body, which is then converted to O2 and H2O2 by the action of SOD and detoxified to water by CAT or GSH-Px. The activities of these antioxidants have been used to evaluate oxidative stress levels in cells (27). Excessive ROS levels induced by H2O2 disrupt the balance between ROS production and the antioxidant defense system.

It has been reported that excessive ROS levels induced by H2O2 can induce nuclear factor (NF)-κB activation, and subsequently increase NF-κB p65 subunit nuclear translocation (28). The activation of NF-κB is enhanced by increasing the degradation and phosphorylation of inhibitor of nuclear factor-κB (IκB), which further modulates the hepatic injury by regulating proinflammatory cytokine production, such as tumor necrosis factor (TNF)-α and interleukin (IL)-6, and the expression of inflammatory mediators including inducible nitric oxide synthase (iNOS) and cyclooxygenase (COX)-2. Nitric oxide (NO) plays a critical role in hepatic injury caused by H2O2. H2O2 exposure generates excessive levels of NO via the activation of iNOS, thereby leading to hepatic tissue damage (29).

In addition, a previous study revealed that the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway played an important role in the intracellular defense against oxidative stress (30). The nuclear transcription factor Nrf2 binds to antioxidant response elements (AREs) in order to activate antioxidant genes that are involved in the elimination of free radicals by promoting the expression of antioxidant enzymes, such as SOD and CAT (31). The role of the Nrf2/ARE signaling pathway in liver disease pathogenesis and its possible application as a underlying therapeutic target to block and treat chronic hepatitis, and alcoholic as well as non-alcoholic hepatic injury, have been extensively investigated (32).

The critical roles of oxidative stress and inflammation in the initiation and progression of liver injury have attracted increasing levels of attention (33). Previous studies have reported that H2O2-derived ROS production induced oxidative stress and promoted the generation of proinflammatory cytokines via the Nrf2 and NF-κB signaling pathway (3437). Thus, redox-sensitive transcription factors, such as Nrf2 and NF-κB, are essential transcription factors that modulate an array of antioxidant responses and proinflammatory gene expression in the liver (38).

Natural products derived from herbal medicines are attracting increasing attention as alternative treatment options for the prevention and treatment of liver diseases. TCSGs, the most important active components of Baishouwu, are commonly considered to be strong antioxidants due to their high free radical scavenging properties. Recent studies have revealed that TCSGs affect cellular inflammatory stress and inhibit tumors by regulating carcinogenesis-associated processes (3,9,10,39). In addition, it has been demonstrated that TCSGs exert hepatoprotective effects against liver injury induced by carbon tetrachloride in vivo (17). To date, few studies have provided conclusive results, particularly with regard to the molecular mechanism of TCSGs in protecting hepatocytes against oxidative damage and inflammatory response.

The aim of the present study was to explore the possible protective effects of TCSGs on human liver cells against H2O2-induced oxidative damage by detecting oxidative stress indicators and inflammatory markers. More specifically, the potential molecular mechanisms of action of TCSGs were investigated by examining antioxidant and inflammatory signaling pathways. These results may elucidate the underlying protective mechanisms of TCSGs in liver injury.

Materials and methods

Plant material and preparation of TCSGs

The peeled root tubers of C. auriculatum were collected from Binhai County (Jiangsu, China) in December, 2015. The materials were identified and authenticated by Professor Shi-Hui Qian (Jiangsu Province Academy of Traditional Chinese Medicine, Jiangsu, China). A voucher specimen (no. WFC-20151225) was deposited at the Department of Natural Product Chemistry, Jiangsu Province Academy of Traditional Chinese Medicine (Nanjing, China). Chemical reference substances, namely caudatin-2,6-dideoxy-3-O-methy-β-D-cymaropyrano side (no. 1), wilfoside C1N (no. 2), caudatin (no. 3), wilfoside K1N (no. 4), wilfoside C1G (no. 5), cynauricuoside A (no. 6), cynauricuoside C (no. 7) and auriculoside IV (no. 8) (Fig. 1), were isolated from C. auriculatum (40) and identified based on infrared, ultraviolet, mass spectrometry (MS) and nuclear magnetic resonance spectroscopic analyses (data not shown). The purity of these compounds was determined to be >98% by high-performance liquid chromatography (HPLC) analysis. The root tubers were cut into small sectoins and boiled in 95% ethanol (1:10) 2 times, 2 h each time, filtered through gauze and concentrated under reduced pressure to produce the ethanol extract. The ethanolic extract was extracted with ethyl acetate 3 times and then merged and evaporated to obtain the TCSG extract, as previously described (41). The main chemical components of the TCSGs were identified and determined by the ultra high-performance liquid chromatography triple quadrupole tandem mass spectrometry method according to previously reported protocols (41). An Acquity UHPLC BEH C18 column (2.1×100 mm, 1.7 µm) was used for separations. The mobile phase was composed of (A) water [0.1% (v/v) formic acid] and (B) acetonitrile, and a linear gradient elution was used. MS was operated using an electrospray ionization (ESI) source in negative mode and the ESI-MS spectra were acquired by multiple reaction monitoring (MRM). Chlorzoxazone was used as the internal standard. A series of concentrations of standard solution were prepared for the establishment of the calibration curves. It was revealed that the TCSGs mainly contained 8 C-21 steroidal glycoside components, including caudatin-2,6-dideoxy-3-O-methy-β-D-cymaropyranoside (20.11 mg/g), wilfoside C1N (5.13 mg/g), caudatin (3.96 mg/g), wilfoside K1N (7.90 mg/g), wilfoside C1G (73.25 mg/g), cynauricuoside A (80.16 mg/g), cynauricuoside C (7.20 mg/g) and auriculoside IV (3.07 mg/g). The chemical structures and the total ion chromatograms of the 8 compounds are presented in Fig. 1. The total glycosides content of the TCSGs was 73.5%, as detected according to the vanillin-vitriol colorimetric method (42). The standard curve was constructed using the cynauricuoside A standard.

Reagents

H2O2 was purchased from Nanchang Baiyun Pharmaceutical Co., Ltd. (Nanchang, China). Fetal bovine serum (FBS) was purchased from Gibco/Thermo Fisher Scientific, Inc. (Waltham, MA, USA). Alanine aminotransferase (ALT; cat. no. C009-2), aspartate aminotransferase (AST; cat. no. C010-2), lactate dehydrogenase (LDH; cat. no. C020-2) and NO (cat. no. C013-2) assay kits were obtained from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). SOD (cat. no. S0101), CAT (cat. no. S0051), GSH-Px (cat. no. S0058), MDA (cat. no. S0131) and ROS (cat. no. S0033) assay kits were purchased from Beyotime Institute of Biotechnology (Shanghai, China). Dulbecco’s modified Eagle’s medium (DMEM), the BCA protein quantification kit and the cytoplasmic-nuclear protein extraction kit were obtained from KeyGEN Biotech Co., Ltd. (Nanjing, China). Anti-iNOS (cat. no. 13120), anti-NF-κB (cat. no. 8242), anti-phospho-NF-κB p65 (cat. no. 3033) and anti-GAPDH (cat. no. 5174) antibodies were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA). Anti-IκBα (cat. no. abp57568) antibody was obtained from AmyJet Scientific (Wuhan, China). Anti-phospho-IκBα (cat. no. orb13487) antibody was obtained from Biorbyt (Wuhan, China). Anti-COX-2 (cat. no. ab15191) and anti-Lamin B1 (cat. no. ab133741) antibodies were purchased from Abcam (Cambridge, UK). Anti-heme oxygenase-1 (HO-1; cat. no. Pb0212) antibody was purchased from Wuhan Boster Biological Technology, Ltd. (Wuhan, China). Anti-Nrf2 (cat. no. Abs120634) antibody was obtained from Absin (Shanghai, China). Goat anti-rabbit (cat. no. AP307P) and mouse IgG (cat. no. AP124P) antibodies were purchased from EMD Millipore (Billerica, MA, USA).

Cell culture

L02 cells, a normal human hepatic cell line, were obtained from KeyGEN Biotech Co., Ltd. (cat. no. KG063) and used in the subsequent experiments, as previously described (43). The L02 cells were incubated at 37°C and 5% CO2 in DMEM supplemented with 10% FBS and 100 U/ml penicillin-streptomycin. Once cell confluence reached ~80%, the cells were passaged.

Cell viability assay

The viability of the L02 cells was determined using the 3-(4,5-dimethyl-2-thiazolyl)-2,5-di-phenyl-2-H-tetrazolium bromide (MTT) method. Firstly, the effective concentrations and treatment durations for TCSGs and H2O2 were determined using the cell viability data. The L02 cells at the exponential growth phase were suspended in DMEM (5×103 cells/well in 100 µl) and seeded into Corning disposable 96-well plates. Cell treatments were performed as follows: i) The cells were incubated with the TCSGs (0, 5, 10, 15, 20, 25, 30, 35, 40 and 45 µg/ml) for 24, 48 and 72 h; ii) The cells were cultured for 72 h and then treated with H2O2 (0, 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.5 and 2 mM) for 24 h. The cells were then washed with PBS, and 10 µl of MTT solution (5 mg/ml) were added to each well and the plate was incubated for 4 h. Then cell supernatants were discarded and 150 µl dimethyl sulfoxide were added to each well. The formazan crystals in the wells were dissolved and the absorbance was read at 570 nm using the Universal Microplate Reader (Thermo Fisher Scientific, Inc.). During these experiments, the TCSG group (0 µg/ml) or the H2O2 group (0 mM) was considered to be the control group (negative control) in each test, respectively. Based on the results obtained from the above-mentioned experiments, the effect of TCSGs on the viability of the L02 cells damaged by H2O2 was investigated as the selected protocol. There were 5 groups during this test: The control group (negative control), the H2O2 group (positive control), and the TCSGs I (10 µg/ml), TCSGs II (20 µg/ml) and TCSGs III (40 µg/ml) groups. Following exposure to the TCSGs (0, 10, 20 and 40 µg/ml) for 48 h, the cells were treated with or without H2O2 (1.5 mM) for 24 h. MTT assay was then performed as described above.

Cell morphological changes assessment

Briefly, the L02 cells (2×105 cells/well) were incubated in corning disposable 6-well plates at 37°C and 5% CO2 for 24 h. The cells were pretreated with the TCSGs (0, 10, 20 and 40 µg/ml) for 48 h, and then stimulated with or without H2O2 (1.5 mM) for 24 h. Cell morphological changes were imaged under a contrast microscope (Zeiss, Axiovert 200; Zeiss GmbH, Jena, Germany).

Assay of AST, ALT and LDH activities and NO levels

The levels of NO and the activities of hepatocellular leakage enzymes were assayed using commercial assay kits according to the manufacturer’s instructions, respectively. Exponential growth phase cells were cultured in corning disposable 96-well plates (5×103 cells/well in 100 µl) for 24 h and pretreated with the TCSGs (0, 10, 20 and 40 µg/ml) for 48 h, followed by exposure to, or the absence of, 1.5 mM H2O2 for 24 h. The cell culture media were then collected for the detection of AST, ALT and LDH activities, and NO levels. The data were expressed as units per liter (U/l) and µmol/l, respectively.

Determination of SOD, CAT and GSH-Px activities, and MDA levels

Following treatment with TCSGs and/or H2O2 as described above, the cells were washed and lysed with radioimmunoprecipitation assay (RIPA) buffer containing 1 mM phenylmethylsulfonyl fluoride (PMSF) and maintained on ice for 30 min. Cell lysates were collected and centrifuged at 10,000 x g for 5 min. The supernatants were used to detect the activities of SOD, CAT and GSH-Px, and the levels of MDA following the manufacturer’s instructions. The protein contents of the supernatants were assayed using a BCA protein quantification kit.

Detection of ROS levels

To evaluate the direct effects of TCSGs on H2O2-induced oxidative stress in L02 cells, the intracellular ROS levels were observed and analyzed via a fluorescence microplate assay and fluorescence microscopy. According to the manufacturer’s instructions and as previously described (44), the intracellular ROS levels were measured using the ROS assay kit. Briefly, exponential growth phase L02 cells were pretreated with or without TCSGs for 48 h, followed by exposure to, or the absence of, 1.5 mM H2O2 for 24 h. Following 3 washes with PBS, the L02 cells were treated with 10 µM of the fluorescent probe, 2′,7′-dichlorodihy-drofluorescein diacetate (DCFH-DA; 1:1,000), and incubated for 20 min at 37°C in the dark. Finally, the cells preloaded with DCFH-DA were imaged with a fluorescence microscope (Olympus Corporation, Tokyo, Japan), and the DCF fluorescence intensity was detected with an EnSpire Multifunctional Microplate Reader (PerkinElmer Inc., Waltham, MA, USA) under a 488 nm excitation wavelength and 525 nm emission wavelength.

RNA extraction and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) detection

Total RNA was extracted from the L02 cells using TRIzol reagent (Invitrogen/Thermo Fisher Scientific, Inc.) and first-stand cDNA was obtained using the Thermo Fisher K1622 first-stand cDNA Synthesis kit (Thermo Fisher Scientific, Inc.). Gene-specific primer sequences were designed and synthesized by GenScript Inc., Nanjing, China, as previously described (45). The primer sequences utilized are presented in Table I.

Table I

Primer sequences used for reverse transcription-quantitative polymerase chain reaction.

Table I

Primer sequences used for reverse transcription-quantitative polymerase chain reaction.

GeneSequence (5′-3′)Accession number
TNF-αF: GTCAACCTCCTCTCTGCCATCAAGNM_000594
TNF-αR: CTGAGTCGGTCACCCTTCTCCA
IL-6F: CTCAATATTAGAGTCTCAACCCCCANM_000600
IL-6R: GAAGGCGCTTGTGGAGAAGG
iNOSF: GGAGCCAGCTCTGCATTATCNM_000620
iNOSR: TTTTGTCTCCAAGGGACCAG
COX-2F: TGCACTACATACTTACCCACTTCAANM_000963
COX-2R: CAAATGTGATCTGGATGTCAACACA
GAPDHF: GAAGGTCGGAGTCAACGGATNM_002046
GAPDHR: CCTGGAAGATGGTGATGGG

[i] F, forward; R, reverse; TNF, tumor necrosis factor; IL, interleukin; iNOS, inducible nitric oxide synthase; COX-2, cyclooxygenase-2.

The qPCR reactions were carried out in 20 µl reaction mixtures containing 10 µl 2X Real Time PCR Master Mix (SYBR-Green), 2 µl primer mix (including forward and reverse primers), and 1 µl cDNA diluted in RNase-free water. The housekeeping gene, GAPDH, was used as an internal standard. The levels of relative mRNA were analyzed using the 2−ΔΔCq comparative approach (46).

Western blot analysis

The L02 cells were lysed in RIPA buffer (containing 1 mM PMSF) on ice for 30 min and total proteins were collected. The cytoplasmic and nuclear protein samples were extracted using the cytoplasmic-nuclear protein extraction kits. The protein concentration was detected using the BCA protein quantification kit. Equal amounts of proteins (50 µg/lane) were separated on 10% SDS-PAGE and elec-troblotted onto polyvinylidene difluoride membranes (EMD Millipore). Following blocking with 5% skim milk for 1 h, the membranes were incubated overnight with primary antibodies (anti-iNOS, 1:1,000; anti-COX-2, 1:800; anti-NF-κB p65, 1:1,000; anti-phospho-NF-κB p65, 1:1,000; anti-IκBα, 1:1,000; anti-phospho-IκBα, 1:1,000; anti-Nrf2, 1:500; anti-HO-1, 1:800; anti-Lamin B1, 1:1,000; and anti-GAPDH, 1:1,000) at 4°C. Following 3 washes, the membranes were incubated for 1 h with goat anti-rabbit IgG (1:2,000) and goat anti-mouse IgG (1:2,000) peroxidase-conjugated secondary antibodies at room temperature. The transferred proteins were visualized using an enhanced chemiluminescence detection kit (Beyotime Institute of Biotechnology, Shanghai, China) and the grayscale values of each band were quantified using Tanon-5200 Analyzer software. Target protein expression levels were normalized based on the internal controls (GAPDH and Lamin B1).

Statistical analysis

All results are presented as the means ± standard deviation, and analyzed using one-way analysis of variance followed by Tukey’s post hoc test for multiple comparisons with SPSS software (version 22.0; IBM Corp., Armonk, NY, USA). All histograms were plotted using GraphPad Prism 5 software (GraphPad Software, Inc., La Jolla, CA, USA). A value of P<0.05 was considered to indicate a statistically significant difference.

Results

Effect of TCSGs on H2O2-induced cytotoxicity in and morphology of L02 cells

The cell viability data indicated that the TCSGs exerted no significant toxicity towards the L02 cells, even at high concentrations (40 µg/ml) following treatment for 24 and 48 h. However, TCSGs at the concentrations exceeding 40 µg/ml and treatment for longer than 48 h markedly decreased cell viability (P<0.05; Fig. 2A). As shown in Fig. 2B, with increasing concentrations of H2O2, cell viability decreased in a dose-dependent manner, and the 50% inhibitory concentration of H2O2 treatment was 1.49 mM, as determined by SPSS software. Based on these results, treatment with 10, 20 and 40 µg/ml TCSGs and 1.5 mM H2O2, as well as the time points of 48 h for the TCSGs and 24 h for H2O2, were employed in the subsequent experiments. With this selected protocol, the effects of TCSGs on H2O2-induced cytotoxicity in and morphology of the L02 cells were investigated. The results revealed that pretreatment with the TCSGs significantly increased the cell survival rate in the cells exposed to H2O2 (Fig. 2C). As shown in Fig. 2D, the control cells exhibited an irregular polygon morphology, with only a few cells being spindle-shaped. Following exposure to H2O2 (1.5 mM), the cells became smaller. However, pretreatment with the TCSGs (10, 20 and 40 µg/ml) for 48 h, attenuated the morphological changes of the L02 cells observed with exposure to H2O2.

Effect of TCSGs on the activities of ALT, AST, LDH and NO levels in L02 cells

As shown in Fig. 3, exposure to H2O2 led to a significant elevation in the levels of hepatocellular leakage enzymes, including ALT, AST and LDH, which are indicative of hepatic injury. When compared with the control group, the NO levels in the group exposed to H2O2 were markedly increased (P<0.01). Following pretreatment with the TCSGs, there was a significant attenuation in the activities of ALT, AST and LDH, and the NO levels when compared with the H2O2 group (P<0.05, P<0.01 or P<0.001). The results thus suggested that TCSGs attenuated H2O2-induced injury in L02 cells.

Effect of TCSGs on the activities of SOD, CAT and GSH-Px, and MDA levels in L02 cells

The effects of TCSGs on the activities of SOD, CAT and GSH-Px in the L02 cells are presented in Fig. 4A–C. H2O2 significantly (P<0.001) decreased the activities of SOD, CAT and GSH-Px in the L02 cells. However, pretreatment with the TCSGs alleviated the inhibition of antioxidant enzyme activities in a dose-dependent manner under oxidative stress.

The effects of TCSGs on the levels of MDA in the H2O2-exposed L02 cells are presented in Fig. 4D. Exposure to H2O2 significantly increased the levels of MDA in the L02 cells when compared with the control group (P<0.001). However, pretreatment with the TCSGs dose-dependently inhibited the increase in the MDA levels when compared with the H2O2 group (P<0.001).

Effect of TCSGs on ROS levels in L02 cells

The effects of TCSGs on the production of ROS in the H2O2-exposed L02 cells are presented in Fig. 5B. Exposure to H2O2 significantly increased intracellular ROS levels in the L02 cells (P<0.001), and this effect was markedly suppressed by the TCSGs. The results revealed that the TCSGs dose-dependently attenuated H2O2-induced ROS production in the L02 cells. In addition, each group of images was recorded using a digital camera attached to an inverted fluorescence microscope. As shown in Fig. 5A, the results were in agreement with the fluorescence intensity assays.

Effect of TCSGs on H2O2-induced production of inflammatory mediators and cytokines in L02 cells

iNOS and COX-2 are used as inflammatory markers and play critical roles in the pathogenesis of chronic inflammation. The effects of TCSGs on the expression levels of iNOS and COX-2 in the L02 cells are presented in Fig. 6. The protein and mRNA expression levels of iNOS (Fig. 6A, B and D) and COX-2 (Fig. 6A, C and D) increased significantly in the H2O2-exposed group; however, pretreatment with the TCSGs dose-dependently inhibited the increase in the iNOS and COX-2 levels. Furthermore, the results of RT-qPCR demonstrated that the TCSGs markedly attenuated the upregulation in the mRNA expression levels of TNF-α and IL-6 (Fig. 6D) induced by H2O2 in the L02 cells, which was consistent with the iNOS and COX-2 expression levels mentioned above.

Effect of TCSGs on the Nrf2 signaling pathway in L02 cells

In order to determine the antioxidative mechanisms of action of the TCSGs, the protein expression levels of Nrf2 and HO-1, as well as the translocation of Nrf2 into the nucleus were measured by western blot analysis (Fig. 7). The results revealed that H2O2 significantly decreased Nrf2 expression in the cytosol and increased Nrf2 expression in the nucleus, indicating that nuclear Nrf2 translocation had occurred (Fig. 7A, B and D). H2O2 also downregulated the protein expression of HO-1 in the L02 cells (Fig. 7C). Pretreatment with the TCSGs resulted in the enhanced expression of Nrf2 and HO-1, suggesting that treatment with the TCSGs activated the Nrf2 signaling pathway.

Effect of TCSGs on the activation of the NF-κB signaling pathway in L02 cells

To further elucidate the mechanisms responsible for the suppression of the inflammatory mediators by the TCSGs in the H2O2-exposed L02 cells, the NF-κB signaling pathway was investigated (Fig. 8). It was revealed that pretreatment with the TCSGs dose-dependently downregulated NF-κB p65 and phospho-NF-κB p65 levels in the nucleus, and enhanced NF-κB p65 expression in the cytosol in the H2O2-injured L02 cells (Fig. 8A–C and G). As shown in Fig. 8A and E, the TCSGs significantly inhibited the H2O2-induced phosphorylation of IκBα in the L02 cells. These results indicated that the TCSGs prevented the translocation of NF-κB by inhibiting the phosphorylation of NF-κB, as well as the degradation and phosphorylation of IκBα in the H2O2-exposed L02 cells.

Taken together, the potential molecular mechanisms of action of TCSGs in human liver cells and their protective effects against H2O2-induced oxidative injury and inflammation are presented in Fig. 9.

Discussion

Hepatic injury is a leading cause of hepatic fibrosis and cancer development. Several factors, including oxidative stress, inflammation and immune responses, have been considered to be involved in the pathogenesis of hepatic injury. An accumulating body of evidence has indicated that oxidative stress and inflammation play important roles in the pathogenesis of liver disease (47). High levels of oxidative stress cause cellular damage, such as lipid peroxidation (48). Inflammatory cytokines also induce oxidant formation and cause liver injury. Anti-oxidative stress-based treatments are promising therapeutic strategies for chronic liver diseases.

TCSGs, the main bioactive components of Baishouwu, have been reported to have potent free radical scavenging properties and hepatoprotective effects (13,17). In the present study, it was confirmed that TCSGs was able to ameliorate H2O2-induced toxicity in the L02 human hepatic cell line. The results of cell viability assay revealed that treatment with the TCSGs markedly protected the cells from damage caused by H2O2, and improved the cell survival rate. As shown in Fig. 2B, treatment with TCSGs at a concentration exceeding 40 µg/ml or given or for a prolonged period of time (72 h) seemed to be toxic to the cells. To the best of our knowledge, C-21 steroidal glycosides at higher concentrations may exert cytotoxic effects in vitro (4952). We speculate the reasons are as follows: i) Chemical structures of C-21 steroidal glycosides usually contain hydrophilic and lipophilic groups, which probably affect the cell membrane and produce a surfactant-like action (53); ii) DNA damage may be involved in the cytotoxic mechanisms of C-21 steroidal glycosides. It has been reported that C-21 steroidal glycosides exert growth inhibitory effects on human glioma cells by triggering DNA damage (54). To date, the majority of reports on the cytotoxicity of C-21 steroidal glycosides have mainly focused on tumor cells lines, and few on normal cell lines. From this, it can be deduced that the cytotoxic effects of C-21 steroidal glycosides on normal cells may differ from those on cancer cell lines. Thus, in the future, we aim to carry out further investigations on the cytotoxic effects and mechanisms of action of C-21 steroidal glycosides.

Oxidative stress leads to cellular damage and cell death via the generation of ROS. Excess ROS primarily induces lipid peroxidation, as indicated by the production of MDA. MDA is a critical marker of lipid peroxidation and is one of the final products of the peroxidation of unsaturated fatty acids. The levels of MDA reflect the extent of cell oxidative damage (55). The antioxidant defense system, containing SOD, CAT, and GSH-Px, scavenges ROS to prevent cell damage in response to oxidative stress (56,57). The present study demonstrated that the enzyme activities of SOD, CAT and GSH-Px, decreased following exposure to H2O2. In addition, the ROS levels and MDA levels increased in the L02 cells exposed to H2O2. However, treatment with the TCSGs attenuated these effects. The results indicated that TCSGs inhibited H2O2-induced oxidative damage by suppressing ROS production and lipid peroxidation, and enhancing the antioxidant defense systems.

The pro-inflammatory enzymes, iNOS and COX-2, play important roles in liver damage. The activation of iNOS induces the production of high levels of NO and further damages hepatocytes (58,59). The present study demonstrated that the TCSGs significantly inhibited COX-2 and iNOS expression, which was consistent with the reduced NO levels in the L02 cells exposed to H2O2 but pretreated with the TCSGs. It has been reported that the upregulation in the mRNA levels of iNOS and COX-2 in hepatic tissues and cells is a result of the increased expression of pro-inflammatory cytokines, such as TNF-α and IL-6, and the activation of NF-κB (60,61). Cytokines, including TNF-α and IL-6 have been the focus of previous investigations evaluating the inflammatory injury of tissues or cells, as they activate the inflammatory and immune responses, exacerbating hepatic injury (62). The results of the present study revealed that the increased levels of TNF-α and IL-6 induced by H2O2 were markedly suppressed by pretreatment with the TCSGs. Notably, treatment with the TCSGs also markedly downregulated the expression of NF-κB p65 and p-NF-κB p65 in the nucleus, upregulated NF-κB p65 expression in the cytosol, and reduced the degradation and phosphorylation of IκBα induced by H2O2 in the L-02 cells. Oxidative stress is known to activate NF-κB, leading to the induction of inflammatory genes, which in turn increases neutrophil recruitment to the liver and exacerbates oxidative stress and inflammation. Taken together, the results of the present study indicated that TCSGs exerted hepatoprotective effects against H2O2-induced oxidative stress via the inhibition of the NF-κB signaling pathway and the reduction in COX-2 and iNOS levels, resulting in the reduction of inflammatory factors.

Nrf2 is a pivotal transcription factor, which can encode detoxification enzymes and antioxidant proteins to against oxidative stress (63). Nrf2 regulates the expression of various antioxidant enzymes, including CAT, GSH-Px, and SOD, by using GSH as their substrate (64). The activation of Nrf2 in cells provides an indirect strategy to enhance antioxidative capacity (65,66). Under oxidative stress conditions, Nrf2 is released from Kelch-like ECH-associated protein 1 and translocates to the nucleus; it then recognizes the ARE and regulates the expression of antioxidant enzymes including HO-1. In the present study, the antioxidant ability of TCSGs in the regulation of redox mechanisms by augmenting the expression of antioxidant genes via the Nrf2 signaling pathway, was evaluated. Following exposure to H2O2, Nrf2 expression in the L02 cells decreased in the cytoplasm, but increased in the nucleus when compared with the control group, which indicated that the nuclear Nrf2 translocation and Nrf2 activation had occurred. To the best of our knowledge, the effects of H2O2 on Nrf2 activation are strongly dependent on H2O2 concentrations and the method of H2O2 delivery (67). Different results however, have been obtained under different experimental conditions. Ma et al reported that treatment with 200 µM H2O2 for 30 min exerted no significant effect on the cytosolic Nrf2 expression in HepG2 cells (68). In addition, in another study, no significant influence on the expression of nuclear Nrf2 was observed in melanocyte cells exposed to 1 mM H2O2 for 24 h (69). Some researchers have proven that the nuclear Nrf2 translocation occurs in melanocytes or human dental pulp stem cells following exposure to H2O2 (36,70). Other studies have found that exposure to 300 µM H2O2 for 4 h significantly decreased the expression of Nrf2 at both the mRNA and protein level in PC12 cells (71). In this study, H2O2 decreased Nrf2 expression in the cytoplasm and increased it in the nucleus, which indicated that nuclear Nrf2 translocation and Nrf2 activation occurred. It was speculated that Nrf2 may have been slightly activated as an adaptive defense against oxidative stress under these conditions. In the groups treated with the TCSGs, Nrf2 expression and the translocation of Nrf2 into the nucleus were markedly increased when compared with the H2O2 group, indicating that there was an enhanced activation of the Nrf2 signaling pathway. Furthermore, the TCSGs markedly upregulated the expression of downstream target proteins of the Nrf2 signaling pathway, such as HO-1. HO-1 is a key rate-limiting enzyme in the degradation of heme, preventing free heme from participating in the oxidative reaction. The overexpression of HO-1 inhibited ROS generation, NF-κB activation and nuclear translocation, and protected against oxidative stress and inflammatory injury (72). Combined with the findings of the present study, these results demonstrated that TCSGs protected L02 cells against H2O2-mediated oxidative injury by activating the Nrf2 signaling pathway and inducing HO-1 expression.

In conclusion, in this study, it was demonstrated that pretreatment with the TCSGs protected the L02 cells against H2O2-induced oxidative damage by increasing the expression of Nrf2 and HO-1, medicated by the NF-κB signaling pathway. The present study also indicated that TCSGs isolated from Baishouwu possessed marked anti-oxidative stress and anti-inflammatory effects against H2O2-induced hepatic injury via Nrf2 activation and inhibition of the NF-κB signaling pathway (Fig. 9). Further studies on the potential effects of TCSGs on any other cell signaling pathways involved in the pathogenesis of H2O2-induced hepatotoxicity are still ongoing. Based on these results, TCSGs may be proven to be a promising strategy for preventing inflammation and reducing the risk of hepatic disease.

Funding

The present study was supported by the National Natural Science Foundation of China (grant nos. 81774178, 81373888 and 81102884) and Jiangsu Province Natural Science Foundation of China (grant no. BK20151606).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors’ contributions

PW and YP designed the experiments. ZW, YWa and XM performed the experiments. XW, ZL and SQ equally contributed in extraction and analysis of chemical constituents. YWe, LS and YD analyzed the results. ZW drafted the manuscript. All the authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors confirm that they have no competing interests.

Acknowledgements

Not applicable.

References

1 

Shan L, Liu RH, Shen YH, Zhang WD, Zhang C, Wu DZ, Min L, Su J and Xu XK: Gastroprotective effect of a traditional Chinese herbal drug ‘Baishouwu’ on experimental gastric lesions in rats. J Ethnopharmacol. 107:389–394. 2006. View Article : Google Scholar : PubMed/NCBI

2 

Li Y, Zhang J, Gu X, Peng Y, Huang W and Qian S: Two new cytotoxic pregnane glycosides from Cynanchum auriculatum. Planta Med. 74:551–554. 2008. View Article : Google Scholar : PubMed/NCBI

3 

Wang DY, Hua X, Ye JL, Li JJ, Li Q and Yan HS: Antitumor effect of C21 steroidal glycosides in Radix Cynanchi bungei on Heps rats and its influence on hematopoiesis. J Clin Med Pract. 18:6–8. 2014.

4 

Peng YR, Li YB, Liu XD, Zhang JF and Duan JA: Antitumor activity of C-21 steroidal glycosides fro. Cynanchum auriculatum Royle ex Wight Phytomedicine. 15:1016–1020. 2008.

5 

Zhang RS, Ye YP and Liu XL: Studies on in vitro antitumor activity of total steroidal glycoside from the root of Cynanchum auriculatum. Chin Tradit Herbal Drugs. 31:599–601. 2000.

6 

Zhang RS, Ye YP, Shen YM and Liang HL: Two new cytotoxic C-21 steroidal glycosides from the root of Cynanchum auriculatum. Tetrahedron. 56:3875–3879. 2000. View Article : Google Scholar

7 

Wang YQ, Zhang SJ, Lu H, Yang B, Ye LF and Zhang RS: A C21-steroidal glycoside isolated from the roots of Cynanchum auriculatum induces cell cycle arrest and apoptosis in human gastric cancer SGC-7901 cells. Evid Based Complement Alternat Med. 2013.180839:2013.

8 

Wang DY, Zhang HQ and Li X: Apoptosis induced by the C21 sterols in Baishouwu and its mechanism of action in hepatoma. Yao Xue Xue Bao. 42:366–370. 2007.In Chinese. PubMed/NCBI

9 

Shan L, Zhang WD, Zhang C, Liu RH, Su J and Zhou Y: Antitumor activity of crude extract and fractions from root tuber of Cynanchum auriculatum Royle ex Wight. Phytother Res. 19:259–261. 2005. View Article : Google Scholar : PubMed/NCBI

10 

Peng YR, Li YB, Liu XD, Zhang JF and Duan JA: Apoptosis induced by caudatin in human hepatoma cell line SMMC7721. Chin J Nat Med. 6:210–213. 2008. View Article : Google Scholar

11 

Peng YR, Ding YF, Wei YJ, Shu B, Li YB and Liu XD: Caudatin-2,6-dideoxy-3-O-methy-β-D-cymaropyranoside 1 induced apoptosis through caspase 3-dependent pathway in human hepatoma cell line SMMC7721. Phytother Res. 25:631–637. 2011. View Article : Google Scholar

12 

Zhang SX, Li X, Yin JL, Chen LL and Zhang HQ: Effect of C21 steroidal glycoside from root of Cynanchum auriculatum on D-galactose induced aging model mice. Zhongguo Zhong Yao Za Zhi. 32:2511–2514. 2007.In Chinese.

13 

Song JM and Ding XL: Study on the scavenging effect of Baishouwu on superoxide free radicals. Chin Wild Plant Resources. 17:1–4. 1997.

14 

Gu LG, Gong SS, Tao JD, Liu CH and Zhou Y: Studies on the regulation effect of Baishouwu on the immunity of mouse. Chin J Int Med. 7:37–41. 1987.

15 

Ji CX, Li XY, Jia SB, Liu LL, Ge YC, Yang QX and Zhang JJ: The antidepressant effect of Cynanchum auriculatum in mice. Pharm Biol. 50:1067–1072. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Yoon MY, Choi NH, Min BS, Choi GJ, Choi YH, Jang KS, Han SS, Cha B and Kim JC: Potent in vivo antifungal activity against powdery mildews of pregnane glycosides from the roots of Cynanchum wilfordii. J Agric Food Chem. 59:12210–12216. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Lv W, Zhang A, Xu S and Zhang H: Effects of general glycosides in Cynanchum auriculatum of Jiangsu province on liver fibrosis of rats. Zhongguo Zhong Yao Za Zhi. 34:2508–2511. 2009.In Chinese.

18 

Jaeschke H: Reactive oxygen and mechanisms of inflammatory liver injury: Present concepts. J Gastroenterol Hepatol. 26(Suppl 1): S173–S179. 2011. View Article : Google Scholar

19 

Miller AM, Wang H, Park O, Horiguchi N, Lafdil F, Mukhopadhyay P, Moh A, Fu XY, Kunos G, Pacher P and Gao B: Anti-inflammatory and anti-apoptotic roles of endothelial cell STAT3 in alcoholic liver injury. Alcohol Clin Exp Res. 34:719–725. 2010. View Article : Google Scholar : PubMed/NCBI

20 

Dey A and Cederbaum AI: Alcohol and oxidative liver injury. Hepatology. 43(Suppl 1): S63–S74. 2006. View Article : Google Scholar : PubMed/NCBI

21 

Sies H, Berndt C and Jones DP: Oxidative stress. Annu Rev Biochem. 86:715–748. 2017. View Article : Google Scholar : PubMed/NCBI

22 

Weng D, Lu Y, Wei Y, Liu Y and Shen P: The role of ROS in microcystin-LR-induced hepatocyte apoptosis and liver injury in mice. Toxicology. 232:15–23. 2007. View Article : Google Scholar : PubMed/NCBI

23 

Tsukiyama-Kohara K: Role of oxidative stress in hepatocarcinogenesis induced by hepatitis C virus. Int J Mol Sci. 13:15271–15278. 2012. View Article : Google Scholar : PubMed/NCBI

24 

Das S, Maras JS, Hussain MS, Sharma S, David P, Sukriti S, Shasthry SM, Maiwall R, Trehanpati N, Singh TP and Sarin SK: Hyperoxidized albumin modulates neutrophils to induce oxidative stress and inflammation in severe alcoholic hepatitis. Hepatology. 65:631–646. 2017. View Article : Google Scholar

25 

Chen G, Ni Y, Nagata N, Xu L and Ota T: Micronutrient antioxidants and nonalcoholic fatty liver disease. Int J Mol Sci. 17:pii: E13792016. View Article : Google Scholar

26 

Wang M, Ma HL, Liu B, Wang HB, Xie H, Li RD and Wang JF: Pinus massoniana bark extract protects against oxidative damage in L-02 hepatic cells and mice. Am J Chin Med. 38:909–919. 2010. View Article : Google Scholar : PubMed/NCBI

27 

Sies H: Hydrogen peroxide as a central redox signaling molecule in physiological oxidative stress: Oxidative eustress. Redox Biol. 11:613–619. 2017. View Article : Google Scholar : PubMed/NCBI

28 

Hseu YC, Wu FY, Wu JJ, Chen JY, Chang WH, Lu FJ, Lai YC and Yang HL: Anti-inflammatory potential of Antrodia Camphorata through inhibition of iNOS, COX-2 and cytokines via the NF-kappaB pathway. Int Immunopharmacol. 5:1914–1925. 2005. View Article : Google Scholar : PubMed/NCBI

29 

Lee D, Park S, Bae S, Jeong D, Park M, Kang C, Yoo W, Samad MA, Ke Q, Khang G and Kang PM: Hydrogen peroxide-activatable antioxidant prodrug as a targeted therapeutic agent for ischemia-reperfusion injury. Sci Rep. 5:165922015. View Article : Google Scholar : PubMed/NCBI

30 

Li W and Kong AN: Molecular mechanisms of Nrf2-mediated antioxidant response. Mol Carcinog. 48:91–104. 2009. View Article : Google Scholar :

31 

Yu J, Zhu X, Qi X, Che J and Cao B: Paeoniflorin protects human EA.hy926 endothelial cells against gamma-radiation induced oxidative injury by activating the NF-E2-related factor 2/heme oxygenase-1 pathway. Toxicol Lett. 218:224–234. 2013. View Article : Google Scholar : PubMed/NCBI

32 

Shin SM, Yang JH and Ki SH: Role of the Nrf2-ARE pathway in liver diseases. Oxid Med Cell Longev. 2013.763257:2013.

33 

Huo X, Liu C, Gao L, Xu X, Zhu N and Cao L: Hepatoprotective effect of aqueous extract from the seeds of orychophragmus violaceus against liver injury in mice and HepG2 cells. Int J Mol Sci. 18:pii: E11972017. View Article : Google Scholar

34 

Conde de la Rosa L, Schoemaker MH, Vrenken TE, Buist-Homan M, Havinga R, Jansen PL and Moshage H: Superoxide anions and hydrogen peroxide induce hepatocyte death by different mechanisms: Involvement of JNK and ERK MAP kinases. J Hepatol. 44:918–929. 2006. View Article : Google Scholar

35 

Vaziri ND: Oxidative stress in uremia: Nature, mechanisms, and potential consequences. Semin Nephrol. 24:469–473. 2004. View Article : Google Scholar : PubMed/NCBI

36 

Kim D, Kim H, Kim K and Roh S: The protective effect of indole-3-acetic acid (IAA) on H2O2-damaged human dental pulp stem cells is mediated by the AKT pathway and involves increased expression of the transcription factor nuclear factor-erythroid 2-related factor 2 (Nrf2) and its downstream target heme oxygenase 1 (HO-1). Oxid Med Cell Longev. 2017.8639485:2017.

37 

Cao YJ, Zhang YM, Qi JP, Liu R, Zhang H and He LC: Ferulic acid inhibits H2O2-induced oxidative stress and inflammation in rat vascular smooth muscle cells via inhibition of the NADPH oxidase and NF-κB pathway. Int Immunopharmacol. 28:1018–1025. 2015. View Article : Google Scholar : PubMed/NCBI

38 

Tian Y, Li Z, Shen B, Zhang Q and Feng H: Protective effects of morin on lipopolysaccharide/d-galactosamine-induced acute liver injury by inhibiting TLR4/NF-κB and activating Nrf2/HO-1 signaling pathways. Int Immunopharmacol. 45:148–155. 2017. View Article : Google Scholar : PubMed/NCBI

39 

Tan ZW, Xie S, Hu SY, Liao T, Liu P, Peng KH, Yang XZ, He ZL, Tang HY, Cui Y, et al: Caudatin targets TNFAIP1/NF-κB and cytochrome c/caspase signaling to suppress tumor progression in human uterine cancer. Int J Oncol. 49:1638–1650. 2016. View Article : Google Scholar : PubMed/NCBI

40 

Gu XJ, Yao N, Qian SH, Li YB and Li P: Four new C21 steroidal glycosides from the root of Cynanchum auriculatum. Helvetica Chimica Acat. 92:88–97. 2009. View Article : Google Scholar

41 

Wang XJ, Li ZL, Lv XH, Zuo QY, Zhao YM, Ding YF, Pu SB, Qian SH and Peng YR: Antitumor evaluation and multiple analysis on different extracted fractions of the root of Cynanchum auriculatum Royle ex Wight. J Sep Sci. 40:3054–3063. 2017. View Article : Google Scholar : PubMed/NCBI

42 

Zhao YN, Wang ZL, Dai JG, Chen L and Huang YF: Preparation and quality assessment of high-purity ginseng total saponins by ion exchange resin combined with macroporous adsorption resin separation. Chin J Nat Med. 12:382–392. 2014.PubMed/NCBI

43 

Hu X, Yang T, Li C, Zhang L, Li M, Huang W and Zhou P: Human fetal hepatocyte line, L-02, exhibits good liver function in vitro and in an acute liver failure model. Transplant Proc. 45:695–700. 2013. View Article : Google Scholar : PubMed/NCBI

44 

Myhre O, Andersen JM, Aarnes H and Fonnum F: Evaluation of the probes 2′,7′-dichlorofluorescin diacetate, luminol, and lucigenin as indicators of reactive species formation. Biochem Pharmacol. 65:1575–1582. 2003. View Article : Google Scholar : PubMed/NCBI

45 

Ding YF, Wu ZH, Wei YJ, Shu L and Peng YR: Hepatic inflammation-fibrosis-cancer axis in the rat hepatocellular carcinoma induced by diethylnitrosamine. J Cancer Res Clin Oncol. 143:821–834. 2017. View Article : Google Scholar : PubMed/NCBI

46 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar

47 

Wei Y, Chen K, Whaley-Connell AT, Stump CS, Ibdah JA and Sowers JR: Skeletal muscle insulin resistance: Role of inflammatory cytokines and reactive oxygen species. Am J Physiol Regul Integr Comp Physiol. 294:R673–R680. 2008. View Article : Google Scholar

48 

Sid B, Verrax J and Calderon PB: Role of oxidative stress in the pathogenesis of alcohol-induced liver disease. Free Radic Res. 47:894–904. 2013. View Article : Google Scholar : PubMed/NCBI

49 

Dong J, Peng X, Li L, Lu S, Zhou L and Qiu M: C21 steroidal glycosides with cytotoxic activities from Cynanchum otophyllum. Bioorg Med Chem Lett. 28:1520–1524. 2018. View Article : Google Scholar : PubMed/NCBI

50 

Wang YQ, Yang B, Zhang RS and Wei EQ: Inhibitive effect of C-21 steroidal glycosides of Cynanchum auriculatum on rat glioma cells in vitro. Zhejiang Da Xue Xue Bao Yi Xue Ban. 40:402–407. 2011.In Chinese. PubMed/NCBI

51 

Wang YB, Su SS, Chen SF, Tang MX, Chen G, Zhao D, Sang XN, Si YY, Wang HF and Pei YH: C 21 steroidal glycosides with cytotoxic activity from Cynanchum taihangense. Phytochem Lett. 20:218–223. 2017. View Article : Google Scholar

52 

Kim CS, Ju YO, Sang UC and Lee KR: Chemical constituents from the roots of Cynanchum paniculatum, and their cytotoxic activity. Carbohydr Res. 381:1–5. 2013. View Article : Google Scholar : PubMed/NCBI

53 

Wang DY and Zhang HQ: The current situation and progress of Baishouwu planted in Jiangsu. Chin Wild Plant Resources. 24:13–15. 2005.

54 

Fu XY, Zhang S, Wang K, Yang MF, Fan CD and Sun BL: Caudatin inhibits human glioma cells growth through triggering DNA damage-mediated cell cycle arrest. Cell Mol Neurobiol. 35:953–959. 2015. View Article : Google Scholar : PubMed/NCBI

55 

Su M, Yu T, Zhang H, Wu Y, Wang X and Li G: The antiapoptosis effect of glycyrrhizate on HepG2 cells induced by hydrogen peroxide. Oxid Med Cell Longev. 2016.6849758:2016.

56 

Zhao L, Chen J, Su J, Li L, Hu S, Li B, Zhang X, Xu Z and Chen T: In vitro antioxidant and antiproliferative activities of 5-hydroxymethylfurfural. J Agric Food Chem. 61:10604–10611. 2013. View Article : Google Scholar : PubMed/NCBI

57 

Herken H, Uz E, Ozyurt H, Söğüt S, Virit O and Akyol O: Evidence that the activities of erythrocyte free radical scavenging enzymes and the products of lipid peroxidation are increased in different forms of schizophrenia. Mol Psychiatry. 6:66–73. 2001. View Article : Google Scholar : PubMed/NCBI

58 

Pan MH, Yang JR, Tsai ML, Sang S and Ho CT: Anti-inflammatory effect of Momordica grosvenori, Swingle extract through suppressed LPS-induced upregulation of iNOS and COX-2 in murine macrophages. J Funct Foods. 1:145–152. 2009. View Article : Google Scholar

59 

Wang WW, Smith DL and Zucker SD: Bilirubin inhibits iNOS expression and NO production in response to endotoxin in rats. Hepatology. 40:424–433. 2004. View Article : Google Scholar : PubMed/NCBI

60 

Li J, Zhang X and Huang H: Protective effect of linalool against lipopolysaccharide/D-galactosamine-induced liver injury in mice. Int Immunopharmacol. 23:523–529. 2014. View Article : Google Scholar : PubMed/NCBI

61 

Dai C, Li B, Zhou Y, Li D, Zhang S, Li H, Xiao X and Tang S: Curcumin attenuates quinocetone induced apoptosis and inflammation via the opposite modulation of Nrf2/HO-1 and NF-κB pathway in human hepatocyte L02 cells. Food Chem Toxicol. 95:52–63. 2016. View Article : Google Scholar : PubMed/NCBI

62 

Arranz J, Soriano A, Garcia I, García I, Concepción MT, Navarro J, Arteaga A, Filella X, Bravo P, Barrera M, et al: Effect of proinflammatory cytokines (IL-6, TNF-alpha, IL-1beta) on hemodynamic performance during orthotopic liver transplantation. Transplant Proc. 35:1884–1887. 2003. View Article : Google Scholar : PubMed/NCBI

63 

Ma Q: Role of nrf2 in oxidative stress and toxicity. Annu Rev Pharmacol Toxicol. 53:401–426. 2013. View Article : Google Scholar : PubMed/NCBI

64 

Kim HJ and Vaziri ND: Contribution of impaired Nrf2-Keap1 pathway to oxidative stress and inflammation in chronic renal failure. Am J Physiol Renal Physiol. 298:F662–F671. 2010. View Article : Google Scholar

65 

Fahey JW, Haristoy X, Dolan PM, Kensler TW, Scholtus I, Stephenson KK, Talalay P and Lozniewski A: Sulforaphane inhibits extracellular, intracellular, and antibiotic-resistant strains of Helicobacter pylori and prevents benzo[a]pyrene-induced stomach tumors. Proc Natl Acad Sci USA. 99:7610–7615. 2002. View Article : Google Scholar

66 

Kensler TW, Wakabayashi N and Biswal S: Cell survival responses to environmental stresses via the Keap1-Nrf2-ARE pathway. Annu Rev Pharmacol Toxicol. 47:89–116. 2007. View Article : Google Scholar

67 

Covas G, Marinho HS, Cyrne L and Antunes F: Activation of Nrf2 by H2O2: De novo synthesis versus nuclear translocation. Methods Enzymol. 528:157–171. 2013. View Article : Google Scholar

68 

Ma Z, Li C, Qiao Y, Lu C, Li J, Song W, Sun J, Zhai X, Niu J, Ren Q and Wen A: Safflower yellow B suppresses HepG2 cell injury induced by oxidative stress through the AKT/Nrf2 pathway. Int J Mol Med. 37:603–612. 2016. View Article : Google Scholar : PubMed/NCBI

69 

Chang Y, Li S, Guo W, Yang Y, Zhang W, Zhang Q, He Y, Yi X, Cui T, An Y, et al: Simvastatin protects human melanocytes from H2O2-induced oxidative stress by activating Nrf2. J Invest Dermatol. 137:1286–1296. 2017. View Article : Google Scholar : PubMed/NCBI

70 

Jian Z, Li K, Song P, Zhu G, Zhu L, Cui T, Liu B, Tang L, Wang X, Wang G, et al: Impaired activation of the Nrf2-ARE signaling pathway undermines H2O2-induced oxidative stress response: A possible mechanism for melanocyte degeneration in vitiligo. J Invest Dermatol. 134:2221–2230. 2014. View Article : Google Scholar : PubMed/NCBI

71 

Mao J, Li Z, Lin R, Zhu X, Lin J, Peng J and Chen L: Preconditioning with Gua Lou Gui Zhi decoction enhances H2O2-induced Nrf2/HO-1 activation in PC12 cells. Exp Ther Med. 10:877–884. 2015. View Article : Google Scholar : PubMed/NCBI

72 

Lee IT, Luo SF, Lee CW, Wang SW, Lin CC, Chang CC, Chen YL, Chau LY and Yang CM: Overexpression of HO-1 protects against TNF-alpha-mediated airway inflammation by down-regulation of TNFR1-dependent oxidative stress. Am J Pathol. 175:519–532. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

December-2018
Volume 42 Issue 6

Print ISSN: 1107-3756
Online ISSN:1791-244X

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Wu Z, Wang Y, Meng X, Wang X, Li Z, Qian S, Wei Y, Shu L, Ding Y, Wang P, Wang P, et al: Total C-21 steroidal glycosides, isolated from the root tuber of Cynanchum auriculatum Royle ex Wight, attenuate hydrogen peroxide-induced oxidative injury and inflammation in L02 cells. Int J Mol Med 42: 3157-3170, 2018
APA
Wu, Z., Wang, Y., Meng, X., Wang, X., Li, Z., Qian, S. ... Peng, Y. (2018). Total C-21 steroidal glycosides, isolated from the root tuber of Cynanchum auriculatum Royle ex Wight, attenuate hydrogen peroxide-induced oxidative injury and inflammation in L02 cells. International Journal of Molecular Medicine, 42, 3157-3170. https://doi.org/10.3892/ijmm.2018.3896
MLA
Wu, Z., Wang, Y., Meng, X., Wang, X., Li, Z., Qian, S., Wei, Y., Shu, L., Ding, Y., Wang, P., Peng, Y."Total C-21 steroidal glycosides, isolated from the root tuber of Cynanchum auriculatum Royle ex Wight, attenuate hydrogen peroxide-induced oxidative injury and inflammation in L02 cells". International Journal of Molecular Medicine 42.6 (2018): 3157-3170.
Chicago
Wu, Z., Wang, Y., Meng, X., Wang, X., Li, Z., Qian, S., Wei, Y., Shu, L., Ding, Y., Wang, P., Peng, Y."Total C-21 steroidal glycosides, isolated from the root tuber of Cynanchum auriculatum Royle ex Wight, attenuate hydrogen peroxide-induced oxidative injury and inflammation in L02 cells". International Journal of Molecular Medicine 42, no. 6 (2018): 3157-3170. https://doi.org/10.3892/ijmm.2018.3896