International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
The intestinal epithelium forms a physical barrier that separates the luminal contents of the gut from the internal milieu (1). Intestinal epithelial cells (IECs) also perform several other functions, such as the sampling of the intestinal microenvironment, the sensing of both beneficial and harmful microbes and the secretion of numerous factors in response to positive or negative signals, which are crucial for intestinal homeostasis (2). To fulfill these diverse functions, the intestinal epithelium has unique anatomical and cellular adaptations, and IECs comprise several specialized cell types with distinct function (2,3). The dynamic crosstalk between IECs and local immune cells represents one of the basic features of intestinal homeostasis (2,3). These interactions are not only essential for maintaining homeostasis, but are also critical for the pathogenesis of inflammatory bowel disease (IBD) and intestinal epithelium restitution following injury.
Interleukin (IL)-22 belongs to the IL-10 cytokine family and is expressed by several types of lymphocytes, including CD4+ T cells, Th17 cells, natural killer (NK) cells and neutrophils (4-14). IL-22 binds to a heterodimeric receptor consisting of IL-22RA1 and IL10-RB. In contrast to the wide expression pattern of IL-10RB, IL-22RA1 is expressed by non-hematopoietic cells, such as epithelial cells of the gastrointestinal tract and skin (15-17). Thus, IL-22 can function in both lymphocytes and epithelial cells. In the intestine, IL-22 has been shown to prevent prolonged inflammation in models of dextran sodium sulfate (DSS)-mediated colitis and graft versus host disease (13,18,19). On the contrary, IL-22 can induce inflammatory responses in the other intestine models (20). These findings indicate that IL-22 has dual functions of promoting and antagonizing inflammation, which likely depends on the specific context. To date, these complex roles of IL-22 are not yet fully understood.
It is well known that intestinal stem cells (ISCs) are located at the crypt base and specifically express markers, such as leucine-rich repeat-containing G-protein coupled receptor 5 (Lgr5) (21). They play significant roles in intestinal homeostasis and regeneration. An ex vivo 3D culture system of intestinal organoids (epithelial mini-guts), highly mimicking the growth in vivo, has been successfully established by Clever’s laboratory. This was done by culturing intestinal epithelial organoids in Matrigel and supplementing epidermal growth factor (EGF), activators of the Wnt and Notch pathways, and an inhibitor of the bone morphogenetic protein (BMP) pathway (22). This powerful system has been widely used for the study of intestinal epithelium homeostasis (22-26).
In this study, we applied DSS and X-ray induced colitis mouse models, and an ex vivo organoid culture system to explore the role of IL-22 in regulating the homeostasis of the intestinal epithelium during inflammation. We found that IL-22 was dynamically expressed with the development of intestinal inflammation. IL-22 promoted cell proliferation, but inhibited the differentiation of intestinal organoids. It also suppressed the self-renewal capacity of ISCs and accordingly resulted in the destruction of organoids. Mechanistically, IL-22 activated signal transducer and activator of transcription 3 (Stat3) activity, but suppressed the Wnt and Notch signaling pathways, in which the change in Wnt signaling was more dominant.
All animal experiments conformed to the regulations drafted by the Association for Assessment and Accreditation of Laboratory Animal Care in Shanghai and were approved by the East China Normal University Center for Animal Research.
For the model of IBD, a total of 35 male (n=5/group) C57BL/6 mice (8 weeks old, weighing approximately 20 g) were obtained from Shanghai SLAC Laboratory Animal Co., Ltd. (Shanghai, China) and maintained under SPF experimental animal conditions (temperature, 23±2°C; humidity, 65±5%) in a 12-h light/dark cycle and fed a standard laboratory diet and water in East China Normal University Center for Animal Research. Acute colitis was induced at day 0 by the administration of 2.5% (w/v) DSS (molecular weight, 36-50 kDa; MP Biomedicals, Santa Ana, CA, USA) in their drinking water and this was then changed to normal drinking water at day 5. The mice were sacrificed at different time points as indicated (days 0, 2, 4, 6, 8, 10 and 12) and intestinal samples were collected for RNA extraction or histological analysis.
For in vivo regeneration assay, a total of 20 male (n=5/group) C57BL/6 mice (8 weeks old, weighing approximately 20 g) were obtained from Shanghai SLAC Laboratory Animal Co., Ltd. and kept under SPF experimental animal conditions (temperature, 23±2°C; humidity, 65±5%) in a 12-h light/dark cycle and fed a standard laboratory diet and water in East China Normal University Center for Animal Research. The mice were irradiated by 9.0 Gy X-ray using a Biological X-ray irradiator (RS 2000 series; Rad Source Technologies, Inc., Suwanee, GA, USA) operated at 250 kVp, 15 mA. The mice were sacrificed every other day after irradiation by cervical dislocation.
Small intestinal crypt isolation and culture were performed as previously described (21,22). Briefly, the small intestine was washed in cold PBS. The tissue was then chopped into approximately 3-5-mm-thick sections, washed with cold PBS and incubated in 5 mM EDTA in PBS for 30 min on ice. The tissue fragments were suspended vigorously, and the supernatants, including most of the villi were discarded. The sediment was further resuspended with cold PBS; the yielded supernatants enriched in crypts were collected and filter through a 70 μm cell mesh (BD Biosciences, San Jose, CA, USA). The crypts were then pelleted by centrifugation (132 × g, 5 min), suspended in ADF medium (advanced DMEM F12) (Thermo Fisher Scientific, Waltham, MA, USA) containing 1% GlutaMAX (Thermo Fisher Scientific). The crypts were centrifuged at low speed (33 × g, 3 min) for 2-3 times to remove single cells. The final crypts were resuspended with growth factor reduced to Matrigel (356231; BD Biosciences) at 5-10 crypts per μl, followed by seeding on a 96-well plate (5 μl per well) or 48-well plate (30 μl per well). Culture medium was made by ADF supplemented with penicillin/streptomycin, 10 mM HEPES, 1X GlutaMAX, 1X N2, 1X B27 (all from Thermo Fisher Scientific) and 1 μM N-acetylcysteine (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) containing 50 ng/ml Murine EGF, 100 ng/ml Murine Noggin and 1 μg/ml Human R-spondin-1 (all from PeproTech, Rocky Hill, NJ, USA). The medium was changed every other day.
For single cell culture, 4-6-day cultured organoids were dissociated with TrypLE express (Thermo Fisher Scientific) including 2,000 U/ml DNase (Roche Diagnostics, Indianapolis, IN, USA) for 10 min at 37°C. Dissociated cells were passed through a 20 μm cell mesh (BD Biosciences) and embedded in Martrigel containing 1 μM jag1 (AnaSpec, Fremont, CA, USA) at up to 5,000-10,000 cells per 30-50 μl. The culture medium was regular organoid culture medium supplemented with 10 μM ROCK inhibitor Y27632 (Sigma-Aldrich; Merck KGaA).
For rescue experiments, 100 ng/ml IL-22 (R&D Systems, Minneapolis, MN, USA), 200 ng/ml Wnt3a (R&D Systems), 1 μM Jag1 (AnaSpec), 5 μM WP1066 (Stat3 inhibitor; Santa Cruz Biotechnology, Inc., Dallas, TX, USA), 3 μM Stattic (Stat3 inhibitor; Santa Cruz Biotechnology, Inc.,) were used at different combinations in oranoid culture medium: Vehicle (without IL22), Stattic, WP1066, Wnt3a, Jag1, IL-22, IL-22 plus Stattic, IL-22 plus WP1066, IL-22 plus Wnt3a, IL-22 plus Jag1.
RNA from the organoids, intestines (IECs) and immune cells [macrophages, monocytes, CD4+ T cells and dendritic cells (DCs) were sorted from mouse peripheral blood by corresponding magnetic beads; Miltenyi Biotec, Bergisch Gladbach, Germany] was obtained by tissue homogenization using TRIzol reagent (Takara Bio, Inc., Otsu, Japan), followed by RNA precipitation in isopropanol, resuspension in DEPC-treated water and verification as DNA free by PCR. cDNA was synthesized with the Superscript RNase H2 Reverse Transcriptase kit (Takara Bio, Inc.) using 2.5 mM random hexamers (Takara Bio, Inc.). Quantitative (real-time) PCR (qPCR) was performed using the SYBR-Green PCR kit (Takara Bio, Inc.) on a Mx3005P thermal cycler (Stratagene, San Diego, CA, USA). The amplification conditions included 3 processes, namely hold stage (1 cycle): 95°C for 1 min; PCR stage (40 cycles): 95°C for 5 sec, 55°C for 30 sec; melt curve stage (1 cycle): 95°C for 5 sec, 55°C for 30 sec and 95°C for 30 sec. The sequences of the main primers were as follows: β-actin sense, CAGCCTTCCTTCTTGGGTAT and antisense, TGATCTTGATCTTCATGGTGC; Il-22 sense, ACATCGTCAACCGCACCTTT and antisense, CAGCCTTCTGACATTCTTCTGGAT; Il-22ra1 sense, CTACGTGTGCCGAGTGAAGA and antisense, GGTAGGTTGCAGGATGGAGA; Il-10rb sense, TTCGGAGTGGGTCAATGTCA and antisense, GACCTCAGAGTCGTACGGAG; Lgr5 sense, CCTACTCGAAGACTTACCCAG T and antisense, GCATTGGGGTGAATGATAGCA; olfactomedin 4 (Olfm4) sense, TCTTGGGCAGAAGGTGGGACT and antisense, GGACCGTCAGGTTCAGGAGC; achaete-scute family bHLH transcription factor 2 (Ascl2) sense, AAGCACACCTTGACTGGTACG; and anti-sense, AAGTGGACGTTTGCACCTTCA; zinc and ring finger 3 (Znrf3) sense, CCAGTGGTGTATGTGAAGGGT G and antisense, AATTCTGACTACGACGTTGCT; WD repeat domain 43 (Wdr43) sense, GCATACAGTGGCATCAAGAC and antisense, GTGAACCTAAGCGACGAAA; Prominin 1 (Prom1) sense, CTGAAGATTGCCCTCTATGA and anti-sense, AGTTTCTGGGTCCCTTTGAT; Axin2 sense, TGACTCTCCTTCCAGATCCCA and antisense, TGCCCACACTAGGCTGACA; and EPH receptor B3 (Ephb3) sense, GACCTTGCTGCCCGAAACAT and antisense, CCCACATGACAATCCCATAGCT; Mus musculus mucin 2 (Muc2) sense, ATGACGTCTGGTGGAATGGT and antisense, TGTTCTGACAGTTGCACGTG; Mus musculus SAM pointed domain containing ets transcription factor (Spdef) sense, TGAACATCACAGCAGACCCT and antisense, ACTTCCAGATGTCCAGGTGG; Chga chromogranin A (Chga) sense, ACTTCAAGACCTGGCTCT CC and antisense, CCTAGGTCCCTCTGTGGTTG; Mus musculus neurogenin 3 (Nuero3) sense, ACACAACAACCTTTTCCCGG and antisense, CCCGATCATTGGCCTTCTTG; Mus musculus caudal type homeobox 1 (Cdx1) sense, AAGGTTCCAGAGTGAGGTG and anti-sense, TAGGGCAGGTGAAAGTGAGG; Mus musculus caudal type homeobox 2 (Cdx2) sense, CTCTCCTCCTACCCACGAAC and antisense, TGGGGCAAAAGAGGCTGATA; Mus musculus lysozyme 1 (Lyz1) sense, GCTTCTACTGCAGCCCATTC and antisense, GCTGACTGACAAGGGAGACT; Mus musculus SRY (sex determining region Y)-box 9 (Sox9) sense, CAAGAACAAGCCACACGT CA and antisense, GTGGTCTTTCTTGTGCTGCA; Mus musculus defensin, alpha, 29 (Defa29 or Crs1c) sense, AAAGAAGGTTTCCGTGGTGC and antisense, TGAGGCTAAGCACAATGGGA; Mus musculus defensin, alpha, 5 (Defa5) sense, ATTTGTCCTCCTCTCTGCCC and antisense, ACGCGTTCTCTTCTTTTGCA; Axin2 sense, TGACTCTCCTTCCAGATCCCA and antisense, TGCCCACACTAGGCTGACA; cyclin D1 (Ccnd1) sense, AGTTCATTTCCAACCCACCC and antisense, AGACCAGCCTCTTCCTCCAC; transcriptional regulator Myc-like (C-myc) sense, CCCTACCCGCTCAACGACAG and antisense, TTGCCTCTTCTCCACAGACACC; Eph receptor B3 (Ephb3) sense, GACCTTGCTGCCCGAAACAT and antisense, CCCACATGACAATCCCATAGCT; Eph receptor B2 (Ephb2) sense, GGCTTTACCTCTTTC GAC G and antisense, CAATCCCCTTTTCCTTCC; wingless-type MMTV integration site family, member 3A (Wnt3a) sense, GCACCACCGTCAGCAACAGC and antisense, TCCCTGGCATCGGCAAA CTC; Notch1 sense, AATGGAGGGAGGTGCGAA GT and antisense, CAGAGGTGTCAGGCAGAGGG; hes family bHLH transcription factor 1(Hes1) sense, GGAGAAGAGGCGAAGGGCAAG A and antisense, CGTGGACAGGAAGCGGGTCA; jagged 1 (Jag1) sense, AATGGTTATCGCTGTATCTGTCC and antisense, AGTTCTTGCCCTCATAGTCCTC; delta like canonical Notch ligand 1 (Dll-1) sense, CCGATGACCTCGCAACAGAA and antisense, CCAGGGTCGCACATCTTCTC. β-actin served as the control gene, all reactions were performed in triplicate. The relative expression was calculated using the 2-ΔΔCq method (27).
The intestines were dissected and flushed gently with cold PBS. They were then immediately fixed by 4% PFA in PBS or snap-frozen on dry ice. Frozen samples were stored at -80°C until cut into frozen slices using a cryostat microtome. Fixed intestines were dehydrated by gradient alcohols, embedded in paraffin, and cut into 4-μm-thick sections which were then subjected to H&E staining or immunohistochemistry (IHC).
Organoid histological staining was carried out with the sections or whole-mount sections. For the sections, organoids were collected after Matrigel was melted by Cell Recovery Solution (BD Biosciences). The organoids were then dehydrated and embedded in paraffin. The sections were deparaffinized in xylene and rehydrated in gradient alcohols. Endogenous peroxidase activity was quenched with 3% H2O2 in methanol for 20 min and washed in PBS. Antigen retrieval was performed by boiling the slides in 10 mM sodium citrate buffer, pH 6.0 or 10 mM Tris-base, 1 mM EDTA solution, pH 9.0. The sections were blocked with 1% BSA and incubated with the primary antibodies as listed below overnight at 4°C. For IHC staining, following incubation with secondary antibody (HRP labeled polymer, GK500710; Shanghai Genetech Co., Shanghai, China) for 30 min, the sections were developed with DAB and counterstained with hematoxylin, then dehydrated and mounted in neutral resins. For BrdU staining, before fixture, the organoids were treated with 3 μg/ml BrdU for 2 h. A similar procedure was performed with the addition of a 30-min treatment with 2 N HCl after antigen retrieval. For immunofluorescence (IF), the sections, following primary antibody as listed below incubation overnight at 4°C were washed and incubated with secondary Alexa Fluor 488 (1:500 dilution; cat. no. ab150077; Abcam, Cambridge, MA, USA) or 647 antibodies (1:500 dilution; cat. no. ab150115; Abcam) for 2 h at room temperature with DAPI (1:10,000 dilution; cat. no. ab104139; Abcam) counterstaining for 5 min at room temperature (Thermo Fisher Scientific) and subjected to immunofluorescence microscopy (BX53; Olympus Corporation, Tokyo, Japan).
For the whole-mount sections, the organoids were fixed with 4% PFA in a plate without melting the Matrigel, then permeabilized with 0.2% Triton in PBS and incubated overnight with primary antibodies as listed below. Fluorescence was detected as mentioned above.
The primary antibodies were as follows: Cleaved caspase-3 (1:200; cat. no. 9661; Cell Signaling Technology, Danvers, MA, USA), Ki67 (1:2,000; cat. no. ab873; Abcam), Lysozyme (Paneth cell marker; 1:2,000; cat. no. ab108508; Abcam), Chromogranin A (endocrine cell marker; 1:2,000; cat. no. 20085; ImmunoStar, Hudson, WI, USA), Muc2 (goblet cell marker; 1:100; cat. no. sc-59859; Santa Cruz Biotechnology, Inc.,), phosphor-Stat3 at Tyr705 (1:200; cat. no. 4113; Cell Signaling Technology), BrdU (1:500; cat. no. B8434; Sigma-Aldrich; Merck KGaA) and IL-22RA1 (1:400; cat. no. ab211675; Abcam).
Lgr5-EGFP-IRES-creERT2 mice (Stock no. 008875) were obtained from The Jackson Laboratory (Bar Harbor, ME, USA) and a total of 5 male, Lgr5-EGFP-IRES-creERT2 mice (8 weeks old, weighing approximately 20 g) were kept under SPF experiment animal conditions (temperature,23±2°C; humidity, 65±5%) in a 12-h light/dark cycle and fed a standard laboratory diet and water in East China Normal University Center for Animal Research. Endogenous GFP (green) driven by Lgr5 promoter indicates crypt base columnar stem cells in the small intestine. Crypts from the Lgr5-EGFP-IRES- CreERT2 mice were isolated as described above after the mice were sacrificed and organoid culture was performed. Following treatment with 100 ng/ml recombinant mouse IL-22 (R&D Systems, Inc., Minneapolis, MN, USA), organoids were collected and dissociated with TypLE and 2,000 U/ml DNase for 15 min at 37°C. The dead cells were then excluded by scatter characteristics and propidium iodide. Lgr5+ISCs were identified by their endogenous GFP expression.
Organoids were collected after Matrigel melting. The cells were then lysed with 0.5% NP-40 lysis buffer [50 mM Tris-base (pH 7.4), 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS and Complete Mini Protease Inhibitor mixture (Roche Diagnostics)] for western blot analysis. The protein concentration was determined using a BCA Protein Assay kit (cat. no. p0011; Beyotime, Shanghai, China). The proteins (30 μg each sample) were resolved on 12% SDS-PAGE gels, transferred onto PVDF membranes (EMD Millipore, Billerica, MA, USA). Following blocking with PBS containing 3% skim milk, the membranes were incubated overnight at 4°C with primary antibodies as follows: Anti-cleaved caspase-3 (1:1,000; cat. no. 9661), anti-Bax (1:1,000; cat. no. 2772), anti-Bcl2 (1:1,000; cat. no. 3498), anti-Bcl-xL (1:1,000; cat. no. 2762), anti-Stat3 (1:1,000; cat. no. 9139), anti-phospho-Stat3 (Tyr705; 1:1,000; cat. no. 9145) (all from Cell Signaling Technology) and anti-β-actin (1:1,000; cat. no. A1978; Sigma-Aldrich; Merck KGaA). Following incubation with peroxidase AffiniPure secondary antibodies (goat anti-mouse IgG, cat. no. 115-035-003; goat anti-rabbit IgG, cat. no. 111-035-003; Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA) for 1 h at room temperature, the blots were then analyzed using the ECL detection system or scanned with an Odyssey Infrared Imager (LI-COR Biosciences, Lincoln, NE, USA).
The colons from mice with DSS-induced colitis were obtained and completely homogenized in PBS containing proteinase inhibitors. Following centrifugation at 825 × g/min for 20 min, the supernatant was collected. The level of secreted IL-22 from IECs was measured using a mouse IL-22 ELISA kit (Abcam) following the manufacturer’s instructions. The experiment was repeated 3 times.
Data were statistically analyzed by one-way ANOVA or the Student’s t-test. A value of P<0.05 considered to indicate a statistically significant difference. Results are presented as the means ± standard error of the means (SEM).
We first detected the gene transcription of IL-22RA1 and IL-10RB, heterodimeric receptors of IL-22, in both immune cells and IECs by RT-qPCR. While IL-22RA1 was specifically expressed in epithelial cells, IL-10RB expression was found in both immune and IECs (Fig. 1A). The results of immunohistochemistry revealed that IL-22RA1 was expressed in the epithelium of the colon and intestine (Fig. 1B). These data suggest IL-22 signaling functions in the intestinal epithelium.
We then examined IL-22 expression in the colon in a mouse model of DSS-induced colitis. Histological analysis revealed that damage to the intestinal epithelium gradually increased, being most severe on day 6 (1 day after DSS administration), and were recovered from day 8 to day 12 (3rd day to the 7th day after DSS administration) (Fig. 1C). Notably, IL-22 expression was consistently altered with the development of colitis. It reached maximum levels on day 6 following DSS administration and decreased during the regeneration of the intestinal epithelium (Fig. 1D and E). In another mouse model of irradiation, we observed similar results (Fig. 1F and G). Taken together, our results reveal that IL-22 expression is associated with the state of intestinal damage.
As it is well known that IL-22 promotes cell proliferation during tissue repair, we wished to explore the direct function of IL-22 in IECs. In an extra in vitro organoid culture system, we found that IL-22 treatment led the organoids acquiring a rounded shape and they began to degenerate after 3 days (Fig. 2A). On day 4, the buds of the organoids were significantly decreased and almost all organoids were disrupted in the IL-22-treated group (Fig. 2B-D).
Subsequently, to determine the mechanisms through which IL-22 regulates organoid formation, we assessed the proliferation and apoptosis of IECs following IL-22 treatment. IHC staining for BrdU and Ki67 revealed that the majority of the cells were in a proliferative state (Fig. 2E). By contrast, we failed to detect a marked difference in cell apoptosis between the vehicle (the organoid cultured without IL-22) and the IL-22-treated samples, as determined by measuring the levels of apoptosis-related markers (Fig. 2E and F).
We then wished determine whether IL-22 affects the differentiation of IECs. The results of IF staining revealed that the numbers of different differentiated cell types, including Paneth cells, goblet cells and enteroendocrine cells were significantly decreased following IL-22 treatment (Fig. 2G and H). In addition, the expression of specific markers of differentiated cells was suppressed by IL-22, as shown by RT-qPCR (Fig. 2I). Collectively, these results indicated that IL-22 regulates organoid formation through activation of cell proliferation and inhibition of IECs differentiation.
Paneth cells provide EGF, Notch and Wnt ligands to maintain ISC self-renewal ability, which is essential for organoid formation. Since IL-22 was found to inhibit the differentiation of Paneth cells, we wished to determine whether it also affects ISCs self-renewal. By isolating the organoids from Lgr5-EGFP-IRES-creERT2 mice, we found that the number of ISCs, positive for Lgr5-EGFP, was markedly decreased by IL-22 (Fig. 3A and B). Consistently, the results of RT-qPCR revealed that the expression of stem cell markers, including Ascl2, Olfm4 and Lgr5 was significantly lower in the group treated with IL-22 (Fig. 3C). Moreover, the expression of Wdr43 and Prom1, the transit-amplifying (TA) cells markers, was slightly upregulated by IL-22. This suggested that IL-22 promotes the differentiation into TA cells from Lgr5+ISCs (Fig. 3D).
To further validate the effects of IL-22 on the maintenance of ISC self-renewal, we disassociated the organoids into single cells and assessed the growth ability. We observed that the single cells could individually grow to a cyst-like structure and finally formed an organoid structure (Fig. 3E, arrowheads). On the contrary, these cells could not survive following culture for 3-4 days with the addition of IL-22 (Fig. 3E, bottom panels). Taken together, these data suggest that IL-22 counteracts the self-renewal ability of ISCs.
It has been reported that IL-22 modulates the phosphorylation of Stat3 (18,28). In this regard, we assessed the changes in the levels of phosphorylated Stat3 following treatment of the organoids with IL-22. In the assay of immunofluorescence, we observed that the addition of IL-22 increased the level of phosphorylated Stat3 in the nucleus of the organoids (Fig. 4A and C). Consistently, similar results were got by immunoblotting (Fig. 4B). Moreover, in the organoids of Lgr5-EGFP-IRES-creERT2 mice, increased levels of nuclear phosphorylated Stat3 were observed in the Lgr5-positive ISCs following treatment with IL-22 (Fig. 4C).
We then examined the activity of the Wnt and Notch signaling pathways, which are essential for ISC self-renewal and differentiation. It was found that both the Wnt and Notch signaling pathways were markedly suppressed by IL-22 (Fig. 4D and E). In summary, these results demonstrate that IL-22 activates the Stat3, and inhibits the Wnt and Notch signaling pathways.
To understand the importance of signaling pathway changes caused by IL-22, we carried out rescue experiments. We applied WP1066 and Stattic as Stat3 specific inhibitors, and added Wnt3a and Jag1 as respective ligands for the Wnt and Notch pathways.
In the absence of IL-22, these supplements did not affect the formation and survival of organoids (Fig. 5A and B). Notably, only the addition of Wnt3a recovered the defects in the organoids induced by the addition of IL-22 (43% vs. 7%; Fig. 5A and B). Furthermore, we found that the number of Paneth cells was retrieved by Wnt3a, but not by Stattic, WP1066 and Jag1 (Fig. 5D). Notably, Stattic treatment significantly restrained IL-22-induced cell hyper-proliferation (Fig. 5C). This observation suggested that IL-22 promotes cell proliferation mainly through Stat3 activation. Consistently, the upregulation of Wnt target genes, including Axin2 and Ephb3, was confirmed by RT-qPCR following the addition of Wnt3a in IL-22-treated organoids (Fig. 5E). Moreover, the levels of ISC markers (Lgr5, Olfm4 and Znrf3) were elevated as well. Taken together, these data suggest that IL-22 caused the deficiency of organoid formation mainly by suppressing the Wnt signaling pathway.
Taken together, in this study, we observed that the IL-22 level initially increased and gradually decreased during inflammation. Elevated IL-22 levels of modulated the Stat3, Wnt and Notch pathways to accelerate the proliferation of TA cells, suppressing cell differentiation and causing the deficiency of ISC self-renewal (Fig. 6).
It has been reported that IL-22 is a dual-natured cytokine depending on the context of inflammation. It has either pro-inflammatory or anti-inflammatory properties (13,29). In the majority of inflammatory bowel disease animal models (14,18,28,30,31), infectious disease (32-34) and graft versus host disease (GVHD) (35), IL-22 plays a protective role against inflammation. By contrast, in a Treg cell transferring animal model and during Toxoplasma gondii-induced ileitis, IL-22 has been shown to play a pro-inflammatory function (20,36). In this respect, a more precise association between IL-22 and epithelial cells needs to be determined. In this study, we used an ex vivo organoid culture system to investigate the role of IL-22 in the homeostasis of intestinal epithelium during inflammation. The advantage of this system is that it can rule out the effects of other cells surrounding the IECs, such as mesenchyme cells and leukocytes. In this manner, we discovered a previously unknown direct association between IL-22 and the intestinal epithelium in that IL-22 promotes the proliferation but inhibits the differentiation of intestinal organoids. Moreover, it suppresses the self-renewal ability of ISCs and consequently leads to the death of organoids. These data reveal that IL-22 has more complex functions in IECs than what was previously known.
Following IL-22 treatment, we observed that the organ-oids became rounded without buds whose tips were enriched with ISCs and Paneth cells (21,22,37). In addition, fewer terminal differentiated cells were found in IL-22-treated organoids. It has been known that the downregulation of Wnt signaling suppresses EphB expression and thus impairs the ephrinB-EphB repulsion, which is critical for the crypt-villi axis establishment (38,39). Thus, the rounded structure caused by IL-22 treatment is likely attributed to the accelerated proliferation of IECs and the loss of migration axis, causing the cells to detach from the epithelial structures and to shed into the lumen.
In vivo, IL-22 expression was upregulated within 6-8 days of DSS-induced inflammation and on the 3rd day of X-ray radiation-induced inflammation; during this period, the intestine incurs the most severe inflammatory response. We postulate that high level of IL-22 promotes anti-microbial peptide expression and alleviates the bacterial burden, which is critical for the initiation of intestinal regeneration (32,40,41). However, following bacterial clearance, the epithelium begins to recover and reconstitute; the limitation of IL-22 is important for IEC differentiation. The decreased IL-22 level is possible due to the reduced number of adaptive immune cells, such as Th17 and Th22, which are the source of IL-22, while responding the inflammatory stresses and bacterial states (33,42-44).
The stem cell niche is indispensable for the homeostasis of the intestinal epithelium. In this study, we observed that IL-22 activates Stat3 signaling to promote the hyper-proliferation of intestinal organoids. Moreover, IL-22 inhibited the Wnt and Notch signaling pathways in IECs. Notably, only Wnt3a rescued the organoid defects caused by IL-22, which suggests that the Wnt pathway is a key factor, downstream of IL-22, to regulate intestinal homeostasis. A recent study indicated that Wnt signaling synergizes with R-spondin to maintain ISC self-renewal (45). However, the mechanisms through which IL-22 influences the Wnt pathway remain unclear. One possibility is that IL-22 directly modulates important players controlling Wnt signaling. Another possibility is that IL-22 suppresses the differentiation of Paneth cells which secret Wnt ligands for ISCs and IECs.
Our results are not consistent with those from a previous study, which demonstrated that IL-22 maintained the self-renewal ability of Lgr5-positive stem cells by using an IL-22 knockout mouse strain (35). IL-22 has been reported to have diverse functions in the intestine. For example, it can promote antibacterial peptide secretion and mucus production (18). We hypothesized that the loss of IL-22 may cause global consequences, such as impairing bacterial clearance, and therefore leads to the destruction of the intestinal barrier and structure. Inconsistently, another study recently demonstrated that IL-22 promotes the proliferation and expansion of ISCs in intestinal organoids (46). Of note, we used a much higher concentration of IL-22 (100 ng/ml vs. 5-10 ng/ml) in this study. This is more coincident with the high level of IL-22 expression during inflammation (47). We reason that a greater amount of IL-22 likely reaches a certain threshold that causes the suppression of Wnt signaling. Additionally, given that IL-22 receptors are also bound to other cytokines (10,48-50), a greater amount of IL-22 may competitively inhibit other signaling, such as IL-20 and IL-24 (48), which affect ISC self-renewal.
Given that IL-22 is well documented to regulate barrier immunity and anti-microbiota, it is considered to play a protective role in IBD (51). Agents to activate the IL-22 pathway are being developed for the treatment of patients with IBD. For example, Indigo naturalis has been shown to be beneficial for ulcerative colitis in a clinical trial (52). However, a previous study demonstrated that the continuous stimulation of IL-22 potentially increases the risk of colitis-associated cancer (53). In this study, we found that the dynamic alteration of IL-22 was important for the maintenance of intestinal homeostasis during inflammation (Fig. 6), which sheds light into the role of IL-22 in regulating the homeostasis of the intestinal epithelium during inflammation. Thus, this study suggests that a prolonged administration of agents to activate the IL-22 pathway for IBD treatment may not be beneficial. Our findings further the current understanding of IL-22 and may aid in the clinical therapy of IBD.
In conclusion, in this study, we found that IL-22 treatment promoted cell proliferation, suppressed the differentiation of intestinal organoids and led to self-renewal defects of intestinal stem cells. As regards the underlying mechanisms, IL-22 activated Stat3 phosphorylation and suppressed the Wnt and Notch signaling pathways. This study reveals that IL-22 regulates the homeostasis of the intestinal epithelium and is critical for the regeneration of the intestine during inflammation. Thus, it deepens our current understanding of the regulation and function of IL-22 and provides the theoretical basis for IBD treatment.
This study was supported by the National Natural Science Foundation of China (grant no. 81772622 to JZ) and the Animal Research Project of Shanghai Science and Technology Commision (grant no. 16140902000 to XuZ).
All data generated or analyzed during this study are included in this published article.
XiZ, JZ, YC, XuZ designed the experiments. XiZ, SL, YWa, HH, LL performed the experiments. SL DC and YWu performed the data analysis. YWu contributed materials/facilities. XiZ, JZ, YC and XuZ wrote the manuscript. All authors have read and approved the final manuscript.
All animal experiments conformed to the regulations drafted by the Association for Assessment and Accreditation of Laboratory Animal Care in Shanghai and were approved by the East China Normal University Center for Animal Research.
Not applicable.
The authors declare that they have no competing interests.
Not applicable.
|
Sturm A and Dignass AU: Epithelial restitution and wound healing in inflammatory bowel disease. World J Gastroenterol. 14:348–353. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Artis D: Epithelial-cell recognition of commensal bacteria and maintenance of immune homeostasis in the gut. Nat Rev Immunol. 8:411–420. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Hooper LV and Macpherson AJ: Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol. 10:159–169. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Kreymborg K, Etzensperger R, Dumoutier L, Haak S, Rebollo A, Buch T, Heppner FL, Renauld JC and Becher B: IL-22 is expressed by Th17 cells in an IL-23-dependent fashion, but not required for the development of autoimmune encephalomyelitis. J Immunol. 179:8098–8104. 2007. View Article : Google Scholar | |
|
Satoh-Takayama N, Vosshenrich CA, Lesjean-Pottier S, Sawa S, Lochner M, Rattis F, Mention JJ, Thiam K, Cerf-Bensussan N, Mandelboim O, et al: Microbial flora drives interleukin 22 production in intestinal NKp46+ cells that provide innate mucosal immune defense. Immunity. 29:958–970. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Cella M, Fuchs A, Vermi W, Facchetti F, Otero K, Lennerz JK, Doherty JM, Mills JC and Colonna M: A human natural killer cell subset provides an innate source of IL-22 for mucosal immunity. Nature. 457:722–725. 2009. View Article : Google Scholar | |
|
Cupedo T, Crellin NK, Papazian N, Rombouts EJ, Weijer K, Grogan JL, Fibbe WE, Cornelissen JJ and Spits H: Human fetal lymphoid tissue-inducer cells are interleukin 17-producing precursors to RORC+ CD127+ natural killer-like cells. Nat Immunol. 10:66–74. 2009. View Article : Google Scholar | |
|
Luci C, Reynders A, Ivanov II, Cognet C, Chiche L, Chasson L, Hardwigsen J, Anguiano E, Banchereau J, Chaussabel D, et al: Influence of the transcription factor RORgammat on the development of NKp46+ cell populations in gut and skin. Nat Immunol. 10:75–82. 2009. View Article : Google Scholar | |
|
Sanos SL, Bui VL, Mortha A, Oberle K, Heners C, Johner C and Diefenbach A: RORgammat and commensal microflora are required for the differentiation of mucosal interleukin 22-producing NKp46+ cells. Nat Immunol. 10:83–91. 2009. View Article : Google Scholar | |
|
Ouyang W, Rutz S, Crellin NK, Valdez PA and Hymowitz SG: Regulation and functions of the IL-10 family of cytokines in inflammation and disease. Annu Rev Immunol. 29:71–109. 2011. View Article : Google Scholar | |
|
Sawa S, Lochner M, Satoh-Takayama N, Dulauroy S, Bérard M, Kleinschek M, Cua D, Di Santo JP and Eberl G: RORγt+ innate lymphoid cells regulate intestinal homeostasis by integrating negative signals from the symbiotic microbiota. Nat Immunol. 12:320–326. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Spits H and Di Santo JP: Regulators and effectors of immunity and tissue remodeling. Nat Immunol. 12:21–27. 2011. View Article : Google Scholar | |
|
Zenewicz LA and Flavell RA: Recent advances in IL-22 biology. Int Immunol. 23:159–163. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Zindl CL, Lai JF, Lee YK, Maynard CL, Harbour SN, Ouyang W, Chaplin DD and Weaver CT: IL-22-producing neutrophils contribute to antimicrobial defense and restitution of colonic epithelial integrity during colitis. Proc Natl Acad Sci USA. 110:12768–12773. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Xie MH, Aggarwal S, Ho WH, Foster J, Zhang Z, Stinson J, Wood WI, Goddard AD and Gurney AL: Interleukin (IL)-22, a novel human cytokine that signals through the interferon receptor-related proteins CRF24 and IL-22R. J Biol Chem. 275:31335–31339. 2000. View Article : Google Scholar : PubMed/NCBI | |
|
Kotenko SV, Izotova LS, Mirochnitchenko OV, Esterova E, Dickensheets H, Donnelly RP and Pestka S: Identification of the functional interleukin-22 (IL-22) receptor complex: The IL-10R2 chain (IL-10Rbeta) is a common chain of both the IL-10 and IL-22 (IL-10-related T cell-derived inducible factor, IL-TIF) receptor complexes. J Biol Chem. 276:2725–2732. 2001. View Article : Google Scholar | |
|
Pestka S, Krause CD, Sarkar D, Walter MR, Shi Y and Fisher PB: Interleukin-10 and related cytokines and receptors. Ann Rev Immunol. 22:929–979. 2004. View Article : Google Scholar | |
|
Sugimoto K, Ogawa A, Mizoguchi E, Shimomura Y, Andoh A, Bhan AK, Blumberg RS, Xavier RJ and Mizoguchi A: IL-22 ameliorates intestinal inflammation in a mouse model of ulcerative colitis. J Clin Invest. 118:534–544. 2008.PubMed/NCBI | |
|
Honda K: IL-22 from T cells: Better late than never. Immunity. 37:952–954. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Kamanaka M, Huber S, Zenewicz LA, Gagliani N, Rathinam C, O’Connor W Jr, Wan YY, Nakae S, Iwakura Y, Hao L and Flavell RA: Memory/effector (CD45RB(lo)) CD4 T cells are controlled directly by IL-10 and cause IL-22-dependent intestinal pathology. J Exp Med. 208:1027–1040. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Sato T, Vries RG, Snippert HJ, van de Wetering M, Barker N, Stange DE, van Es JH, Abo A, Kujala P, Peters PJ and Clevers H: Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459:262–265. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Sato T, van Es JH, Snippert HJ, Stange DE, Vries RG, van den Born M, Barker N, Shroyer NF, van de Wetering M and Clevers H: Paneth cells constitute the niche for Lgr5 stem cells in intestinal crypts. Nature. 469:415–418. 2011. View Article : Google Scholar | |
|
Dekkers JF, Wiegerinck CL, de Jonge HR, Bronsveld I, Janssens HM, de Winter-de Groot KM, Brandsma AM, de Jong NW, Bijvelds MJ, Scholte BJ, et al: A functional CFTR assay using primary cystic fibrosis intestinal organoids. Nat Med. 19:939–945. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Yilmaz ÖH, Katajisto P, Lamming DW, Gültekin Y, Bauer-Rowe KE, Sengupta S, Birsoy K, Dursun A, Yilmaz VO, Selig M, et al: mTORC1 in the Paneth cell niche couples intestinal stem-cell function to calorie intake. Nature. 486:490–495. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Yui S, Nakamura T, Sato T, Nemoto Y, Mizutani T, Zheng X, Ichinose S, Nagaishi T, Okamoto R, Tsuchiya K, et al: Functional engraftment of colon epithelium expanded in vitro from a single adult Lgr5(+) stem cell. Nat Med. 18:618–623. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Sato T and Clevers H: Growing self-organizing mini-guts from a single intestinal stem cell: Mechanism and applications. Science. 340:1190–1194. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar | |
|
Pickert G, Neufert C, Leppkes M, Zheng Y, Wittkopf N, Warntjen M, Lehr HA, Hirth S, Weigmann B, Wirtz S, et al: STAT3 links IL-22 signaling in intestinal epithelial cells to mucosal wound healing. J Exp Med. 206:1465–1472. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Sonnenberg GF, Fouser LA and Artis D: Border patrol: Regulation of immunity, inflammation and tissue homeostasis at barrier surfaces by IL-22. Nat Immunol. 12:383–390. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Zenewicz LA, Yancopoulos GD, Valenzuela DM, Murphy AJ, Stevens S and Flavell RA: Innate and adaptive interleukin-22 protects mice from inflammatory bowel disease. Immunity. 29:947–957. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Cox JH, Kljavin NM, Ota N, Leonard J, Roose-Girma M, Diehl L, Ouyang W and Ghilardi N: Opposing consequences of IL-23 signaling mediated by innate and adaptive cells in chemically induced colitis in mice. Mucosal Immunol. 5:99–109. 2012. View Article : Google Scholar | |
|
Zheng Y, Valdez PA, Danilenko DM, Hu Y, Sa SM, Gong Q, Abbas AR, Modrusan Z, Ghilardi N, de Sauvage FJ and Ouyang W: Interleukin-22 mediates early host defense against attaching and effacing bacterial pathogens. Nat Med. 14:282–289. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Basu R, O’Quinn DB, Silberger DJ, Schoeb TR, Fouser L, Ouyang W, Hatton RD and Weaver CT: Th22 cells are an important source of IL-22 for host protection against enteropathogenic bacteria. Immunity. 37:1061–1075. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Zenewicz LA, Yin X, Wang G, Elinav E, Hao L, Zhao L and Flavell RA: IL-22 deficiency alters colonic microbiota to be transmissible and colitogenic. J Immunol. 190:5306–5312. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Hanash AM, Dudakov JA, Hua G, O’Connor MH, Young LF, Singer NV, West ML, Jenq RR, Holland AM, Kappel LW, et al: Interleukin-22 protects intestinal stem cells from immune-mediated tissue damage and regulates sensitivity to graft versus host disease. Immunity. 37:339–350. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Muñoz M, Heimesaat MM, Danker K, Struck D, Lohmann U, Plickert R, Bereswill S, Fischer A, Dunay IR, Wolk K, et al: Interleukin (IL)-23 mediates Toxoplasma gondii-induced immu-nopathology in the gut via matrixmetalloproteinase-2 and IL-22 but independent of IL-17. J Exp Med. 206:3047–3059. 2009. View Article : Google Scholar | |
|
Farin HF, Van Es JH and Clevers H: Redundant sources of Wnt regulate intestinal stem cells and promote formation of Paneth cells. Gastroenterology. 143:1518–1529.e7. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Batlle E, Henderson JT, Beghtel H, van den Born MM, Sancho E, Huls G, Meeldijk J, Robertson J, van de Wetering M, Pawson T and Clevers H: Beta-catenin and TCF mediate cell positioning in the intestinal epithelium by controlling the expression of EphB/ephrinB. Cell. 111:251–263. 2002. View Article : Google Scholar : PubMed/NCBI | |
|
Cortina C, Palomo-Ponce S, Iglesias M, Fernández-Masip JL, Vivancos A, Whissell G, Humà M, Peiró N, Gallego L, Jonkheer S, et al: EphB-ephrin-B interactions suppress colorectal cancer progression by compartmentalizing tumor cells. Nat Genet. 39:1376–1383. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Wolk K, Kunz S, Witte E, Friedrich M, Asadullah K and Sabat R: IL-22 increases the innate immunity of tissues. Immunity. 21:241–254. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Raffatellu M, George MD, Akiyama Y, Hornsby MJ, Nuccio SP, Paixao TA, Butler BP, Chu H, Santos RL, Berger T, et al: Lipocalin-2 resistance confers an advantage to Salmonella enterica serotype Typhimurium for growth and survival in the inflamed intestine. Cell Host Microbe. 5:476–486. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Chung Y, Yang X, Chang SH, Ma L, Tian Q and Dong C: Expression and regulation of IL-22 in the IL-17-producing CD4+ T lymphocytes. Cell Res. 16:902–907. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Liang SC, Tan XY, Luxenberg DP, Karim R, Dunussi-Joannopoulos K, Collins M and Fouser LA: Interleukin (IL)-22 and IL-17 are coexpressed by Th17 cells and cooperatively enhance expression of antimicrobial peptides. J Exp Med. 203:2271–2279. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Zheng Y, Danilenko DM, Valdez P, Kasman I, Eastham-Anderson J, Wu J and Ouyang W: Interleukin-22, a T(H)17 cytokine, mediates IL-23-induced dermal inflammation and acanthosis. Nature. 445:648–651. 2007. View Article : Google Scholar | |
|
Yan KS, Janda CY, Chang J, Zheng GXY, Larkin KA, Luca VC, Chia LA, Mah AT, Han A, Terry JM, et al: Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem-cell self-renewal. Nature. 545:238–242. 2007. View Article : Google Scholar | |
|
Lindemans CA, Calafiore M, Mer telsmann A M, O’Connor MH, Dudakov JA, Jenq RR, Velardi E, Young LF, Smith OM, Lawrence G, et al: Interleukin-22 promotes intestinal-stem-cell-mediated epithelial regeneration. Nature. 528:560–564. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Andoh A, Zhang Z, Inatomi O, Fujino S, Deguchi Y, Araki Y, Tsujikawa T, Kitoh K, Kim-Mitsuyama S, Takayanagi A, et al: Interleukin-22, a member of the IL-10 subfamily, induces inflammatory responses in colonic subepithelial myofibroblasts. Gastroenterology. 129:969–984. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Dumoutier L, Leemans C, Lejeune D, Kotenko SV and Renauld JC: Cutting edge: STAT activation by IL-19, IL-20 and mda-7 through IL-20 receptor complexes of two types. J Immunol. 167:3545–3549. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Sabat R: IL-10 family of cytokines. Cytokine Growth Factor Rev. 21:315–324. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Wang M, Tan Z, Zhang R, Kotenko SV and Liang P: Interleukin 24 (MDA-7/MOB-5) signals through two heterodimeric receptors, IL-22R1/IL-20R2 and IL-20R1/IL-20R2. J Biol Chem. 277:7341–7347. 2002. View Article : Google Scholar | |
|
Li LJ, Gong C, Zhao MH and Feng BS: Role of interleukin-22 in inflammatory bowel disease. World J Gastroenterol. 20:18177–18188. 2014. View Article : Google Scholar | |
|
Sugimoto S, Naganuma M, Kiyohara H, Arai M, Ono K, Mori K, Saigusa K, Nanki K, Takeshita K, Takeshita T, et al: Clinical efficacy and safety of oral Qing-Dai in patients with ulcerative colitis: A single-center open-label prospective study. Digestion. 93:193–201. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Low D, Mino-Kenudson M and Mizoguchi E: Recent advancement in understanding colitis-associated tumorigenesis. Inflamm Bowel Dis. 20:2115–2123. 2014. View Article : Google Scholar : PubMed/NCBI |