Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
June-2020 Volume 45 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2020 Volume 45 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

miR‑539 suppresses the proliferation, migration, invasion and epithelial mesenchymal transition of pancreatic cancer cells through targeting SP1

  • Authors:
    • Liang Xue
    • Yan Shen
    • Zhenglong Zhai
    • Shusen Zheng
  • View Affiliations / Copyright

    Affiliations: Department of Hepatobiliary and Pancreatic Surgery, The First Affiliated Hospital, Zhejiang University, Hangzhou, Zhejiang 310003, P.R. China
    Copyright: © Xue et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 1771-1782
    |
    Published online on: April 1, 2020
       https://doi.org/10.3892/ijmm.2020.4561
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

MicroRNA (miR)‑539 has inhibitory effects on certain types of cancer, but its role in pancreatic cancer (PCa) remains unclear. The present study investigated the effects of miR‑539 on PCa, and aimed to determine possible therapeutic targets for the treatment of PCa. The expression of miR‑539 in PCa tissues, paired normal adjacent tissues and PCa cell lines (CAPAN‑2, BxPC3, CFPAC1, SW1990 and PANC1), and human non‑cancerous pancreatic cells (hTRET‑HPNE) was determined and compared. The effects of upregulation and downregulation of miR‑539 on proliferation, apoptosis, cell cycle, invasion, migration and epithelial‑mesenchymal transition (EMT) of PCa cells were investigated. Additionally, the target gene of miR‑539 was predicted and its effects on PCa cells were further investigated. The results revealed low expression of miR‑539 in PCa tissues and cell lines. Additionally, increasing miR‑539 expression inhibited the proliferation, migration, invasion and EMT of PCa cells and induced apoptosis by blocking G1 phase of the cell cycle, while reducing miR‑539 expression had the opposite results. Furthermore, specificity protein 1 (SP1) was found to be the target gene of miR‑539. SP1 promoted the proliferation, migration, invasion and EMT transformation of PCa cells, but these effects were reversed by high expression of miR‑539. Additionally, miR‑539 suppressed the proliferation, metastasis, invasion and EMT transformation of PCa cells through targeting SP1. Therefore, miR‑539 overexpression may contribute toward development of novel therapeutic strategies for PCa in the future.

Introduction

Pancreatic cancer (PCa) has a high degree of malignancy (1). Early diagnosis of the disease is often difficult due to the physiological location and biological characteristics of the pancreas; furthermore, PCa can rapidly progress into later stages and has poor prognosis and high mortality rate in advanced stages (2,3). At present, surgery is the main therapeutic option for treating PCa. However, as PCa does not show specific symptoms in the early stages, patients are often diagnosed with the disease at later stages and therefore lose the optimal chance for surgery (4). Furthermore, patients with PCa develop multi-drug resistance to chemotherapy drugs, which results in poor outcomes for radiotherapy and chemotherapy (5,6). In recent years, previously unrecognized miRNAs and mRNAs have been detected and investigated as effective methods for the clinical diagnosis and treatment of PCa (7-9).

As a class of single-stranded nucleotides, miRNAs participate in the coding and synthesis of proteins and serve critical roles in the physiological and pathological processes of cancer (10). miRNAs can inhibit the expression of target proteins by binding to the 3′-untranslated region (3′-UTR) of the targeted genes, thereby restraining or degrading the translation and expression of mRNAs (11). Previous studies have demonstrated that miRNAs are associated with the migration and deterioration of tumors (12-14). Previous studies also demonstrated that miR-615-5p (15), miR-153 (16) and miR-206 (17) inhibited the metastasis of PCa, while miR-10b (18), miR-212 (19) and miR-367 (20) promoted the migration of PCa.

miR-539 was revealed to act as a tumor suppressor gene in different cancer types, including gastric cancer, prostate cancer and lung cancer (21-24). Low expression of miR-539 has been reported in gastric cancer tissues and cell lines, and this was correlated with the differentiation, clinical stage, poor survival outcome and lymph node metastasis of the disease (25). Although previous studies have reported that the role of miR-539 in cancer is mainly acting as a tumor suppressor, only few studies have investigated the specific mechanisms of miR-539 in PCa. Specificity protein 1 (Sp1) was one of the earliest transcription factors identified, and it belongs to the Sp1/Krüppel-like factor transcription factor family of sequence-specific DNA binding proteins (26,27). High expression of Sp1 has been detected in gastric cancer and is associated with a poor prognosis of the disease (28). In addition, abnormal Sp1 activation may improve the growth, metastasis and dedifferentiation of PCa and breast cancer (29,30). The results of these studies indicated that Sp1 may serve an important role in cancer development.

In order to further investigate the role of miRNAs in PCa, the present study focused on the effects of miR-539 on PCa. The roles of miR-539 in the proliferation, apoptosis, migration and invasion of PCa cells were analyzed by upregulating and inhibiting the expression of miR-539 in several PCa cell lines. Furthermore, the target gene of miR-539 and the mechanism were studied. The results of the present study provide a molecular mechanism and alternative treating strategy to PCa.

Materials and methods

Tissue samples

PCa tissues and paired normal adjacent tissues were collected from patients with PCa (36 males and 20 females; age range, 29-70 years; median age, 61 years) who received surgical resection in The First Affiliated Hospital, Zhejiang University from January to December 2018. Those who had received radiotherapy, chemotherapy, traditional Chinese medicine or immunotherapy prior to surgery were excluded, and patients enrolled in the study received routine preoperative auxiliary tests. Carcinoma tissues and their paired normal adjacent tissues (2-3 cm from the margin of the carcinoma tissue) were separated from surgical specimens within 30 min, temporarily frozen in liquid nitrogen and stored in a refrigerator at −80°C for expression detection. The present study was approved by the Ethics Committee of the First Affiliated Hospital (approval no. ZJ2018121017), Zhejiang University and written informed consent was obtained from all participants.

Cell culture

Non-cancerous pancreatic cells (hTRET-HPNE) and PCa cell lines (CAPAN-2, BxPC3, CFPAC1, SW1990 and PANC1) were purchased from American Type Culture Collection. All cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA), containing 10% fetal bovine serum (FBS; HyClone; GE Healthcare Life Sciences), 100 µg/ml streptomycin, 100 units/ml penicillin and 2 mmol/l glutamine (Gibco; Thermo Fisher Scientific, Inc.) in a humid environment at 37°C with 5% CO2.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was isolated from tissues and cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.). The purity and concentration of the extracted total RNAs were determined by NanoDrop-2000c ultramicro spectrophotometer (Thermo Fisher Scientific, Inc.) and 1% agarose modified gel electrophoresis. Taqman microRNA RT kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) and corresponding primers were used to reverse transcribe the total RNAs into cDNAs, the reverse transcription condition as follows: At 42°C for 40 min, at 85°C for 5 min. SYBR-Green I mix reagent (Toyobo Life Science) and ABI Ⅶ A7 fluorescence quantitative PCR reactor were used for amplifying the reaction under the following conditions: Pre-degeneration at 95°C for 30 sec, denaturation at 95°C for 5 sec, annealing at 60°C for 34 sec for a total of 40 cycles. Primer sequences were synthesized by Shanghai Gene Pharma Co., Ltd. (Shanghai, China) and are presented in Table I. Quantitative analysis was conducted using the 2-ΔΔCq method (31), and the expression of U6 served as the internal reference.

Table I

Primer base sequence.

Table I

Primer base sequence.

GeneForward (5′-3′)Reverse (5′-3′)
miR-539 GAAGAGGCTAACGTGAGGTTG CACCATGACCAAGCCACGTAG
U6 GCTTCGGCAGCACATATACTAAAAT CGCTTCACGAATTTGCGTGTCAT
Cell transfection

SW1990 and BxPC3 cells in the logarithmic growth stage were inoculated into 6-well plates at a concentration of 1×105 cells/well. SW1990 cells were respectively transfected with blank, miR-539 mimic (5′-GGA GAA AUU AUC CUU GGU GUG U-3′; cat. no. 4464066; Ambion; Thermo Fisher Scientific, Inc.) and mimic control (MC; 5′-UUU GUA CUA CAC AAA AGU ACU G-3′), while BxPC3 cells were respectively transfected with blank, miR-539 inhibitor (5′-ACA CAC CAA GGA UAA UUU CUC C-3′; cat. no. 4464084; Ambion; Thermo Fisher Scientific, Inc.) and inhibitor control (IC; 5′-CAG UAC UUU UGU GUA GUA CAA-3′). In addition, the SW1990 cells were also co-transfected with MC and negative control (NC), MC and SP1, mimic and NC (pcDNA3.1 empty plasmid), and mimic and SP1 (pcDNA3.1-SP1 plasmid; Ambion; Thermo Fisher Scientific, Inc.). Similarly, the BxPC3 cells were co-transfected with IC and siNC (5′-UUC UCC GAA CGU GUC ACG U-3′), IC and siSP1 (5′-CAG AUA CCA GAC CUC UUC U-3′; cat. no. 4392420; Ambion; Thermo Fisher Scientific, Inc.), inhibitor and siNC, and inhibitor and siSP1. A total of 5 µg/well Lipofectamine 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) was used for cell transfection. All the cells were cultured in the medium (DMEM; Gibco; Thermo Fisher Scientific, Inc.) containing 10% FBS, 50 U/ml penicillin and 50 µg/ml streptomycin at 37°C with 5% CO2.

Cell activity

Cell Counting kit-8 (CCK-8; Dojindo Molecular Technologies, Inc.) was mixed with the culture medium at a ratio of 1:10 to detect the proliferation abilities of SW1990 and BxPC3 cells following the manufacturer's protocol. The cells were transferred into the 96-well plates at a density of 5×104/well, and 110 µl mixed medium was added. The plates were maintained in the dark at 37°C with 5% CO2, and optical density (OD) was recorded using a microplate reader (BioTek Instruments, Inc.) at 450 nm after 24, 48 and 72 h of cultivation.

Cell apoptosis

Annexin V-FITC Apoptosis Detection kit (BD Biosciences) was used to determine the apoptotic rates of SW1990 and BxPC3 cells. The culture medium was removed 48 h after transfection. The cells were washed with pre-cooled phosphate-buffered saline (PBS) at 4°C and digested by 0.25% trypsin. Next, the supernatant was discarded (800 × g) by centrifugation, and sediments were washed twice with PBS. According to the manufacturer's protocol, 5 µl fluorescein isothiocyanate (FITC) and 5 µl propidium iodide (PI) were added into the cells and incubated together at room temperature in the dark for 15 min. Cell apoptosis was analyzed by Beckman CoulterFC500 (Beckman Coulter, Inc.).

Cell cycle

The transfected cells (SW1990 and BxPC3; at 1×105) were collected, washed with PBS and fixed using 70% ice ethanol overnight at 4°C. Next, cell DNA was stained with 1 mg/ml RNase A and 50 mg/ml PI at room temperature for 30 min. Cell Lab Quanta SC flow cytometry (Beckman Coulter, Inc.) was used to analyze the cell cycles in G1, S and G2 phases.

Cell migration

The cells (SW1990 and BxPC3) were inoculated at 1×105/ml into 6-well plates and cultured at 37°C with 5% CO2 for 24 h. After the cells have been covered with monolayer, scratches were created in the center of the 6-well plates using a 1,000 µl spear head. Images were captured using an inverted light microscope (Eclipse TS-100; Nikon Corporation) at ×100 magnification at 0 and 48 h.

Cell invasion

Transwell invasion assays (Costar; Corning, Inc.) were performed to detect cell invasion abilities. A total of 50 µl Matrigel (Costar; Corning, Inc.) at a dilution ratio of 1:8 was inserted into the upper chamber of the Transwell and solidified at 37°C for 30 min. Cell suspension (serum-free medium) at a density of 1×105/ml was added to the upper chamber, while the lower chamber was covered with DMEM containing 20% FBS. The chambers were cultured at 37°C with 5% CO2 for 48 h. After the cells had been fixed with 70% ethanol for 30 min at room temperature and stained with 0.1% crystal violet for 20 min at room temperature, the number of cells was counted under a light microscope (magnification, ×200; Zeiss AG).

Western blot analysis

Western blotting (WB) was performed to determine the expression levels of proteins associated with epithelial-mesenchymal transition (EMT). The total intracellular proteins were extracted using radioimmunoprecipitation assay lysis buffer (Beyotime Institute of Biotechnology, Haimen, China), and the protein concentration was determined using bicinchoninic acid (Pierce; Thermo Fisher Scientific, Inc.). A total of 50 µg protein was separated on 10-12% SDS-PAGE (Beyotime Institute of Biotechnology) and transferred to polyvinylidene difluoride membranes (GE Healthcare) and then blocked with 5% non-fat milk at room temperature for 2 h. Primary antibodies: E-cadherin (E-cad; cat. no. 14472; Cell Signaling Technology, Inc.), N-cadherin (N-cad; cat. no. 14215; Cell Signaling Technology, Inc.), Snail (cat. no. ab53519; Abcam), SP1 (cat. no. ab13370; Abcam) and GAPDH (cat. no. ab8245; Abcam) at a dilution of 1:1,000 at 4°C were used to incubate the membranes overnight. GAPDH served as internal reference. Next, a horseradish peroxidase-labeled secondary antibody (dilution, 1:1,000; cat. no. ab6728; Abcam) was added to incubate the membranes for another hour at room temperature. An enhanced chemiluminescence kit (Thermo Fisher Scientific, Inc.) was used for color development.

Dual-luciferase reporter

Targetscan 7.2 (http://www.targetscan.org/) predicted that SP1 was possibly the target gene for miR-539, and the prediction was further verified by double-luciferase reporter gene analysis. The SP1 3′-UTR region containing the sequence of miR-539 binding site was inserted into the pMIR-reporter vector (Guangzhou RiboBio Co., Ltd.) to construct mutant carrier (SP1-MUT) and wild-type vector (SP1-WT). miR-539 mimic was transfected into SW1990 cells with SP1-MUT or SP1-WT using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.), while BxPC3 cells were respectively co-transfected with miR-539 inhibitor and the two plasmids. The cells were collected 48 h after the transfection, and double-luciferase reporter gene analysis system (Promega Corporation) was performed to determine the activities of firefly and renilla luciferase.

Statistical analysis

Statistical Package of the Social Sciences 20.0 software (IBM Corp.) was used for data analysis. The data are presented as the mean ± standard deviation, and Student's t-test was performed for comparison in two groups, while one-way analysis of variance, followed by the Tukey's test, was conducted for comparing differences among multiple groups. The association between miR-539 expression and clinicopathological factors of PCa was analyzed using the Pearson's χ2 test. All independent experiments in vitro were performed in triplicate. P<0.05 was considered to indicate a statistically significant difference.

Results

miR-539 had a low expression in PCa tissues and cell lines

The expression of miR-539 was significantly reduced in cancer tissues compared with that in their paired normal adjacent tissues of PCa (P<0.001; Fig. 1A). According to the median as the segmentation point, the expression of miR-539 was divided into high expression and low expression. As shown in Table II, miR-539 expression is associated with tumor size, Tumor-Node-Metastasis (TNM) stage and lymph node metastasis (LNM) of patients. In brief, patients with tumor size ≥2, higher TNM stage and presenting LNM had lower miR-539 expression. In PC cell lines, the expression level of miR-539 was the lowest in SW1990 cells and the highest in BxPC3 cells (P<0.001; Fig. 1B). In addition to the expression of miR-539 in different PCa cell lines, cells with fast growth rates and good growth were selected. Therefore, in subsequent experiments, miR-539 was overexpressed in SW1990 cells, while BxPC3 cells were treated with an miR-539 inhibitor. The transfection results revealed that the expression of miR-539 was increased markedly in the mimic group but was decreased significantly in the inhibitor group, suggesting that the transfection was successful (P<0.001; Fig. 1C and D).

Figure 1

Overexpression of miR-539 inhibited the activities of PCa cells and promoted apoptosis. According to the results from RT-qPCR, the expression levels of miR-539 in (A) cancerous tissues and their paired normal adjacent tissues from patients with PCa (n=56) and in (B) non-cancerous pancreatic cells (hTRET-HPNE) and PCa cell lines (CAPAN-2, BxPC3, CFPAC1, SW1990 and PANC1). RT-qPCR assays showed the expression levels of miR-539 in (C) SW1990 and (D) BxPC3 cells after transfection. The activities of (E) SW1990 and (F) BxPC3 cells after transfection for 24, 48 and 72 h were detected by Cell Counting kit-8. Apoptosis figures and corresponding quantitative analyses of (G and H) SW1990 and (I and J) BxPC3 cells after transfection were tested by flow cytometry. SW1990 cells were transfected with blank, mimic control and miR-539 mimic, while BxPC3 cells were transfected with blank, inhibitor control and miR-539 inhibitor. **P<0.001, vs. normal, hTRET-HPNE, or blank; ##P<0.001, vs. mimic control or inhibitor control (n=3). PCa, pancreatic cancer; RT-qPCR, real time-quantitative polymerase chain reaction.

Table II

Associations between miR-539 expression and clinicopathological characteristics of patients with pancreatic cancer.

Table II

Associations between miR-539 expression and clinicopathological characteristics of patients with pancreatic cancer.

Clinical factormiR-539 expressionP-value
Low expression (n=28)High expression (n=28)
Age, years0.567
 <601820
 ≥60108
Sex0.577
 Male1917
 Female911
Tumor size, cm0.016a
 <2918
 ≥21910
Tumor differentiation0.179
 Well1015
 Poor1813
TNM stage0.014a
 I+II716
 III+IV2112
Lymph node metastasis0.031a
 Negative816
 Positive2012
Distant metastasis (M) status0.105
 M01319
 M1159

a P<0.05. TNM, Tumor-Node-Metastasis.

Over-expression of miR-539 inhibited the activities of PCa cells and promoted apoptosis

After transfection for 48 and 72 h, the activity of SW1990 cells was significantly reduced in the mimic group, while that of BxPC3 was notably increased in the inhibitor group (P<0.001; Fig. 1E and F). Furthermore, the apoptotic rate of SW1990 cells transfected with miR-539 increased greatly, while that of BxPC3 cells transfected with an miR-539 inhibitor markedly decreased (P<0.001; Fig. 1G-J). In addition, the cell proportion in G1 phase was notably increased by elevated miR-539 expression, but decreased in S phase of SW1990 cells (P<0.001); however, no significant effect of miR-539 on G2 phase was observed (Fig. 2A and B). Additionally, in BxPC3 cells, suppression of miR-539 significantly reduced cell proportion in G1 phase, but increased cell proportion in the S phase (P<0.001), and there was no notable difference in G2 phase (Fig. 2C and D).

Figure 2

Over-expression of miR-539-suppressed the migration of pancreatic cancer cells. Cell cycle (G1, S and G2) diagrams and corresponding quantitative analyses of (A and B) SW1990 cells and (C and D) BxPC3 cells after transfection were measured by flow cytometry. Migration distances under the microscope and corresponding quantitative analyses of (E and F) SW1990 and (G and H) BxPC3 cells at 0 or 48 h after transfection were determined by scratch tests. SW1990 cells were transfected with blank, mimic control and miR-539 mimic, while BxPC3 cells were transfected with blank, inhibitor control and miR-539 inhibitor. **P<0.001, vs. blank; ##P<0.001, vs. mimic control or inhibitor control (n=3).

Over-expression of miR-539 suppressed the migration and invasion abilities of PCa cells

The migration distance of SW1990 cells in the mimic group was shorter than that in the blank and mimic control groups 48 h after the transfection (P<0.001; Fig. 2E and F), while the distance of BxPC3 cells transfected with miR-539 inhibitor was significantly longer than that of the blank and inhibitor control groups (P<0.001; Fig. 2G and H). The results of Transwell assays revealed that the number of SW1990 cells in the mimic group that penetrated into the lower chamber was significantly fewer than that in the blank and control groups (P<0.001; Fig. 3A and B), while number of BxPC3 cells in the inhibitor group that penetrated into the lower chamber was markedly more than the blank and control groups (P<0.001; Fig. 3C and D). Furthermore, WB of EMT-related proteins showed that over-expression of miR-539 increased the expression of E-cad in SW1990 cells, while the expressions of N-cad and Snail were inhibited (P<0.001; Fig. 3E and F). Correspondingly, in BxPC3 cells, low expression of miR-539 suppressed the expression of E-cad, but increased the expressions of N-cad and Snail (P<0.001; Fig. 3G and H).

Figure 3

Overexpression of miR-539 inhibited the invasion and epithelial-mesenchymal transition of pancreatic cancer cells. The numbers of invaded cells under the microscope and corresponding quantitative analyses of (A and B) SW1990 and (C and D) BxPC3 cells based on the Transwell assays. Western blot analysis showed the expression levels of EMT-related proteins, including E-cadherin (E-cad), N-cadherin (N-cad) and Snail, in (E and F) SW1990 and (G and H) BxPC3 cells. GAPDH served as the internal reference. SW1990 cells were transfected with blank, mimic control and miR-539 mimic, while BxPC3 cells were transfected with blank, inhibitor control and miR-539 inhibitor. **P<0.001, vs. blank; ##P<0.001, vs. mimic control or inhibitor control (n=3).

SP1 was the target gene of miR-539

Targetscan7.2 revealed that the position 3197-3204 of SP1 3′-UTR could be coupled with hsa-miR-539-5p, suggesting that SP1 may be the target gene for miR-539 (Fig. 4A). Dual-luciferase reporter gene analysis demonstrated that the luciferase activity of SW1990 cells co-transfected with SP1-WT and miR-539 mimic decreased significantly (P<0.001; Fig. 4B), while that of BxPC3 cells co-transfected with SP1-WT and miR-539 inhibitor increased significantly (P<0.001; Fig. 4C), suggesting that SP1 was the target gene for miR-539. Therefore, in the subsequent experiments, miR-539 mimic, inhibitor and SP1, and siSP1 were co-transfected to SW1990 and BxPC3 cells, respectively. The results of WB showed that the expression of SP1 in MC+SP1 group was significantly higher than that in MC+NC and mimic+SP1 groups, and that the expression of SP1 in mimic+SP1 group was significantly higher than that in mimic+NC group (P<0.001; Fig. 4D and E). In BxPC3 cells, SP1 expression was successfully inhibited in IC+siSP1 and inhibitor+siSP1 groups (P<0.001; Fig. 4F and G).

Figure 4

SP1 was the target gene of miR-539. (A) Targetscan7.2 predicted that the position 3197-3204 of SP1 3′URT could be coupled with hsa-miR-539-5p. Results of dual-luciferase reporter gene analysis in (B) SW1990 cells co-transfected miR-539 mimic with wild-type SP1 (SP1-WT) and mutant SP1 (SP1-MUT) and that in (C) BxPC3 cells co-transfected miR-539 inhibitor with SP1-WT or SP1-MUT. The expression levels of miR-539 in (D and E) SW1990 and (F and G) BxPC3 cells after transfection were determined by the western blot analysis. The activities of (H) SW1990 and (I) BxPC3 cells after 48-h transfection were detected using Cell Counting kit-8. (D-I) SW1990 cells were co-transfected with MC and negative control (NC, pcDNA3.1 empty plasmid), mimic control (MC) and SP1, mimic and NC, and mimic and SP1. Similarly, BxPC3 cells were co-transfected with inhibitor control (IC) and siNC, IC and siSP1, inhibitor and siNC, and inhibitor and siSP1. **P<0.001, vs. blank, MC + NC or IC + siNC; ##P<0.001, vs. MC + SP1 or IC + siSP1; ^^P<0.001, vs. mimic + NC or inhibitor + siNC (n=3).

Over-expression of miR-539 inhibited the activity, migration and invasion of PCa cells and promoted cell apoptosis by targeting SP1

CCK-8 results revealed that SP1 increased the activity of SW1990 cells and reversed the inhibitory effect produced by overexpressed miR-539 (P<0.001; Fig. 4H), while downregulation of SP1 reduced the activity of BxPC3 cells and weakened the promoted effect produced by low expression of miR-539 (P<0.001; Fig. 4I). In cell apoptosis experiments, the apoptosis rate of SW1990 cells transfected with SP1 decreased significantly (P<0.05), which could be reversed by over-expression of miR-539 (P<0.001; Fig. 5A and B). Additionally, the apoptotic rate of BxPC3 cells transfected with siSP1 increased significantly (P<0.001), and miR-539 inhibitor could reverse the pro-apoptosis effect produced by low expression of SP1 (P<0.001; Fig. 5C and D). Furthermore, it was revealed that the migratory distance and number of invasive SW1990 cells were increased by SP1. By contrast, the migratory distance became shorter and the number of invasive BxPC3 cells was reduced by inhibiting SP1. However, this phenomenon could be reversed by overexpression of miR-539 or its inhibitor (P<0.001; Figs. 5E-H and 6A-D). Furthermore, SP1 inhibited the expression of E-cad and promoted the expression of N-cad and Snail, while silencing P1 produced the opposite results (P<0.001). Notably, overexpression of miR-539 attenuated the effects of SP1 on EMT-related proteins, while miR-539 inhibitor reversed the effects of siSP1 (P<0.001; Fig. 6E-H).

Figure 5

Over-expression of miR-539 suppressed migration of pancreatic cancer cells and promoted apoptosis. Apoptosis figures and corresponding quantitative analyses of (A and B) SW1990 and (C and D) BxPC3 cells after transfection were measured by flow cytometry. Migration distances under the microscope and corresponding quantitative analyses of (E and F) SW1990 and (G and H) BxPC3 cells at 0 or 48 h after transfection were determined by scratch tests. SW1990 cells were co-transfected with MC and negative control (NC, pcDNA3.1 empty plasmid), mimic control (MC) and SP1, mimic and NC, and mimic and SP1. Similarly, BxPC3 cells were co-transfected with inhibitor control (IC) and siNC, IC and siSP1, inhibitor and siNC, and inhibitor and siSP1. *P<0.05, **P<0.001, vs. MC + NC or IC + siNC; ##P<0.001, vs. MC + SP1 or IC + siSP1; ^^P<0.001, vs. mimic + NC or inhibitor + siNC (n=3).

Figure 6

The numbers of invaded cells under the microscope and corresponding quantitative analyses of (A and B) SW1990 cells and (C and D) BxPC3 cells based on the Transwell assays. Experimental results of western blotting showed the expression levels of EMT-related proteins, including E-cadherin (E-cad), N-cadherin (N-cad) and Snail, in (E and F) SW1990 and (G and H) BxPC3 cells. GAPDH served as the internal reference. SW1990 cells were co-transfected with MC and negative control (NC, pcDNA3.1 empty plasmid), mimic control (MC) and SP1, mimic and NC, and mimic and SP1. Similarly, BxPC3 cells were co-transfected with inhibitor control (IC) and siNC, IC and siSP1, inhibitor and siNC, and inhibitor and siSP1. **P<0.001, vs. MC + NC or IC + siNC; ##P<0.001, vs. MC + SP1 or IC + siSP1; ^^P<0.001, vs. mimic + NC or inhibitor + siNC (n=3).

Discussion

PCa is a highly invasive cancer and its 5-year survival rate is less than 5% (32). Surgical resection is an effective method in treating PCa, but ~60% of PCa patients have lost the optimal opportunities for undergoing surgery at the time of diagnosis, and only 15% of patients are suitable for taking radical surgery. Furthermore, median postoperative survival time for PCa patients is only 20-23 months even they underwent surgery and chemotherapy (33-35). Therefore, finding effective methods for treating PCa is important. Previous studies have found abnormal expression of miRNAs in PCa, and that this correlates with the development, differentiation, invasion and metastasis of PCa (36,37). The results of the present study revealed that the expression level of miR-539 in cancerous tissues from PCa patients was markedly lower than that in adjacent tissues and PCa cell lines, suggesting that miR-539 may be associated with the occurrence and progression of PCa.

A previous study reported that the expression of miR-539 suppressed the proliferation, invasion and migration of PCa cell lines (38). Jin and Wang (39) also found that miR-539 could act as an inhibitor to control osteosarcoma progression. A recent study reported that miR-539 overexpression suppressed the invasion, migration and EMT of BXPC-3 and PANC-1 cells through targeting TWIST1 (40). Similarly, in this study, the overexpression of miR-539 reduced the proliferation, migration and invasion of PCa cells, whereas the inhibition of miR-539 produced the opposite effect. Furthermore, the present study revealed that miR-539 induced the apoptosis of PCa cell lines mainly through blocking the cell cycle in G1 phase, which was consistent with the results obtained by Deng et al (41) that miR-539 could cause cell cycle arrest in non-small cell lung cancer cell lines. A previous study also confirmed that miR-539 regulates the growth of nasopharyngeal carcinoma cells through cell cycle arrest (42). Therefore, it was confirmed that the upregulation of miR-539 played an active role in PCa.

EMT is the initial event indicating tumor metastasis (43). E-cad, N-cad and Snail are EMT-related proteins. E-cad is an adhesion protein, and downregulating the expression of E-cad can decrease or even eliminate adhesion between cells, thereby leading to tumor detachment, local migration or distant spread via blood vessels and lymphatic ducts from primary site (44). Notably, N-cad and Snail have completely opposite effects to that of E-cad, and the upregulation of N-cad and Snail accelerates tumor metastasis (45). A previous study revealed that certain miRNAs could inhibit the occurrence of EMT by reducing the expression of N-cad and Snail, and increasing the synthesis of E-cad, thereby preventing tumor metastasis (46). The results of the present study revealed that overexpression of miR-539 may promote the expression of E-cad, while inhibiting the expression of N-cad and Snail. Additionally, the suppression of miR-539 resulted in opposite outcomes, suggesting that miR-539 could block the metastasis and invasion of PCa cells through blocking EMT.

Furthermore, while investigating the mechanism of miR-539 in PCa, the results of the present study suggested that SP1 was the target gene for miR-539. SP1, which is an important transcription factor, is involved in cell proliferation, apoptosis and differentiation, and associated with the expression of genes related to tumor growth and metastasis (47,48). The results of the present study demonstrated that increased SP1 promoted the proliferation, migration, invasion and EMT of PCa cells and inhibited cell apoptosis, while silencing of SP1 produced the opposite effects, indicating that SP1 may facilitate the development and progression of PCa. Xia et al (49) reported that the downregulation of SP1 could reduce the proliferation rate of ovarian cancer cells and restrain tumor metastasis. Mei et al (50) revealed that certain miRNAs may suppress the multiplication, migration and EMT of esophageal cancer cells by targeting SP1. Notably, it was discovered that the overexpression of miR-539 inhibited the effects of SP1 on PCa cell lines, and that SP1-silencing reversed the effect of low expression of miR-539, showing that miR-539 was involved in the occurrence and development of PCa through targeting SP1. However, there are questions that remain to be answered from basic research to clinical application. The biological effects of miRNAs are microenvironment-dependent or cell-type-dependent, and the expression of miR-539 varies in different PCa cell lines, which may also have different effects on the proliferation, invasion, migration and EMT of different PCa cells. The expression of miR-539 differs in different PCa cells, and the effect of miR-539 on the viability of different PCa cells may also vary, which requires further investigation. However, miR-539 may still serve an anti-cancer role in different PCa cells. Although there are limitations to the present study, and in vivo experiments should be performed to further support the present data, the findings in the present study further elucidate the underlying mechanism of miR-539 in PCa.

In conclusion, miR-539 is involved in the development and progression of PCa through targeting SP1 to suppress the proliferation, metastasis, invasion, apoptosis and EMT of PCa cells, at least in SW1990 and BxPC3 cells. Therefore, we hypothesize that miR-539 may be investigated as a novel therapeutic strategy for PCa treatment in the future.

Abbreviations:

miR

microRNA

PCa

pancreatic cancer

EMT

epithelial-mesenchymal transition

miRNAs

microRNAs

MC

mimic control

IC

inhibitor control

NC

negative control

CCK-8

Cell Counting Kit-8

OD

optical density

FITC

fluorescein isothiocyanate

WB

western blotting

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

LX and YS made substantial contributions to the conception and design. ZZ was involved in data acquisition, analysis and interpretation. LX was responsible for drafting the article or critically revising it for important intellectual content. SZ agreed to be accountable for all aspects of the work, in ensuring that questions related to the accuracy or integrity of the work are appropriately investigated and resolved. All authors gave final approval of the version to be published.

Ethics approval and consent to participate

The present study was approved by the Ethics Committee of the First Affiliated Hospital (approval no. ZJ2018121017), Zhejiang University and written informed consent was obtained from all participants. All procedures involving human participants were performed in accordance with the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Lin QJ, Yang F, Jin C and Fu DL: Current status and progress of pancreatic cancer in China. World J Gastroenterol. 21:7988–8003. 2015. View Article : Google Scholar : PubMed/NCBI

2 

Lee ES and Lee JM: Imaging diagnosis of pancreatic cancer: A state-of-the-art review. World J Gastroenterol. 20:7864–7877. 2014. View Article : Google Scholar : PubMed/NCBI

3 

Ilic M and Ilic I: Epidemiology of pancreatic cancer. World J Gastroenterol. 22:9694–9705. 2016. View Article : Google Scholar : PubMed/NCBI

4 

Puleo F, Maréchal R, Demetter P, Bali MA, Calomme A, Closset J, Bachet JB, Deviere J and Van Laethem JL: New challenges in perioperative management of pancreatic cancer. World J Gastroenterol. 21:2281–2293. 2015. View Article : Google Scholar : PubMed/NCBI

5 

Wu Q, Yang Z, Nie Y, Shi Y and Fan D: Multi-drug resistance in cancer chemotherapeutics: Mechanisms and lab approaches. Cancer Lett. 347:159–166. 2014. View Article : Google Scholar : PubMed/NCBI

6 

Mansoori B, Mohammadi A, Davudian S, Shirjang S and Baradaran B: The different mechanisms of cancer drug resistance: A brief review. Adv Pharm Bull. 7:339–348. 2017. View Article : Google Scholar : PubMed/NCBI

7 

Tang Y, Tang Y and Cheng YS: miR-34a inhibits pancreatic cancer progression through Snail1-mediated epithelial-mesenchymal transition and the Notch signaling pathway. Sci Rep. 7:382322017. View Article : Google Scholar : PubMed/NCBI

8 

Wei W, Liu Y, Lu Y, Yang B and Tang L: LncRNA XIST promotes pancreatic cancer proliferation through miR-133a/EGFR. J Cell Biochem. 118:3349–3358. 2017. View Article : Google Scholar : PubMed/NCBI

9 

Huang B, Liu C, Wu Q, Zhang J, Min Q, Sheng T, Wang X and Zou Y: Long non-coding RNA NEAT1 facilitates pancreatic cancer progression through negative modulation of miR-506-3p. Biochem Biophys Res Commun. 482:828–834. 2017. View Article : Google Scholar

10 

Feng YH and Tsao CJ: Emerging role of microRNA-21 in cancer. Biomed Rep. 5:395–402. 2016. View Article : Google Scholar : PubMed/NCBI

11 

Zhao G, Wang B, Liu Y, Zhang JG, Deng SC, Qin Q, Tian K, Li X, Zhu S, Niu Y, et al: miRNA-141, downregulated in pancreatic cancer, inhibits cell proliferation and invasion by directly targeting MAP4K4. Mol Cancer Ther. 12:2569–2580. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Gambari R, Brognara E, Spandidos DA and Fabbri E: Targeting oncomiRNAs and mimicking tumor suppressor miRNAs: New trends in the development of miRNA therapeutic strategies in oncology (Review). Int J Oncol. 49:5–32. 2016. View Article : Google Scholar : PubMed/NCBI

13 

Rupaimoole R and Slack FJ: MicroRNA therapeutics: Towards a new era for the management of cancer and other diseases. Nat Rev Drug Discov. 16:203–222. 2017. View Article : Google Scholar : PubMed/NCBI

14 

Tutar L, Özgür A and Tutar Y: Involvement of miRNAs and pseudogenes in cancer. Methods Mol Biol. 1699:45–66. 2018. View Article : Google Scholar

15 

Sun Y, Zhang T, Wang C, Jin X, Jia C, Yu S and Chen J: Correction: miRNA-615-5p functions as a tumor suppressor in pancreatic ductal adenocarcinoma by targeting AKT2. PLoS One. 10:e01282572015. View Article : Google Scholar : PubMed/NCBI

16 

Bai Z, Sun J, Wang X, Wang H, Pei H and Zhang Z: MicroRNA-153 is a prognostic marker and inhibits cell migration and invasion by targeting SNAI1 in human pancreatic ductal adenocarcinoma. Oncol Rep. 34:595–602. 2015. View Article : Google Scholar : PubMed/NCBI

17 

Keklikoglou I, Hosaka K, Bender C, Bott A, Koerner C, Mitra D, Will R, Woerner A, Muenstermann E, Wilhelm H, et al: MicroRNA-206 functions as a pleiotropic modulator of cell proliferation, invasion and lymphangiogenesis in pancreatic adenocarcinoma by targeting ANXA2 and KRAS genes. Oncogene. 34:4867–4878. 2015. View Article : Google Scholar :

18 

Ouyang H, Gore J, Deitz S and Korc M: microRNA-10b enhances pancreatic cancer cell invasion by suppressing TIP30 expression and promoting EGF and TGF-beta actions. Oncogene. 36:49522017. View Article : Google Scholar

19 

Ma C, Nong K, Wu B, Dong B, Bai Y, Zhu H, Wang W, Huang X, Yuan Z and Ai K: miR-212 promotes pancreatic cancer cell growth and invasion by targeting the hedgehog signaling pathway receptor patched-1. J Exp Clin Cancer Res. 33:542014. View Article : Google Scholar : PubMed/NCBI

20 

Zhu Z, Xu Y, Zhao J, Liu Q, Feng W, Fan J and Wang P: miR-367 promotes epithelial-to-mesenchymal transition and invasion of pancreatic ductal adenocarcinoma cells by targeting the Smad7-TGF-β signalling pathway. Br J Cancer. 112:1367–1375. 2015. View Article : Google Scholar : PubMed/NCBI

21 

Ding S and Zhang Y: MicroRNA539 inhibits the proliferation and migration of gastric cancer cells by targeting SRYbox 5 gene. Mol Med Rep. 20:2533–2540. 2019.PubMed/NCBI

22 

Sun B, Fan Y, Yang A, Liang L and Cao J: MicroRNA-539 functions as a tumour suppressor in prostate cancer via the TGF-β/Smad4 signalling pathway by down-regulating DLX1. J Cell Mol Med. 23:5934–5948. 2019. View Article : Google Scholar : PubMed/NCBI

23 

Sun H and Sun Y: Lidocaine inhibits proliferation and metastasis of lung cancer cell via regulation of miR-539/EGFR axis. Artif Cells Nanomed Biotechnol. 47:2866–2874. 2019. View Article : Google Scholar : PubMed/NCBI

24 

Gong YB and Fan XH: miR-539-3p promotes the progression of epithelial ovarian cancer by targeting SPARCL1. Eur Rev Med Pharmacol Sci. 23:2366–2373. 2019.PubMed/NCBI

25 

Jin W, Han H and Liu D: Downregulation miR-539 is associated with poor prognosis of gastric cancer patients and aggressive progression of gastric cancer cells. Cancer Biomark. 26:183–191. 2019. View Article : Google Scholar : PubMed/NCBI

26 

Kadonaga JT, Carner KR, Masiarz FR and Tjian R: Isolation of cDNA encoding transcription factor Sp1 and functional analysis of the DNA binding domain. Cell. 51:1079–1090. 1987. View Article : Google Scholar : PubMed/NCBI

27 

Roder K, Kim KH and Sul HS: Induction of murine H-rev107 gene expression by growth arrest and histone acetylation: Involvement of an Sp1/Sp3-binding GC-box. Biochem Biophys Res Commun. 294:63–70. 2002. View Article : Google Scholar : PubMed/NCBI

28 

Chen F, Zhang F, Rao J and Studzinski GP: Ectopic expression of truncated Sp1 transcription factor prolongs the S phase and reduces the growth rate. Anticancer Res. 20:661–667. 2000.PubMed/NCBI

29 

Wei D, Wang L, He Y, Xiong HQ, Abbruzzese JL and Xie K: Celecoxib inhibits vascular endothelial growth factor expression in and reduces angiogenesis and metastasis of human pancreatic cancer via suppression of Sp1 transcription factor activity. Cancer Res. 64:2030–2038. 2004. View Article : Google Scholar : PubMed/NCBI

30 

Wright C, Angus B, Napier J, Wetherall M, Udagawa Y, Sainsbury JR, Johnston S, Carpenter F and Horne CH: Prognostic factors in breast cancer: Immunohistochemical staining for SP1 and NCRC 11 related to survival, tumour epidermal growth factor receptor and oestrogen receptor status. J Pathol. 153:325–331. 1987. View Article : Google Scholar : PubMed/NCBI

31 

Rao X, Huang X, Zhou Z and Lin X: An improvement of the 2ˆ(-delta delta CT) method for quantitative real-time polymerase chain reaction data analysis. Biostat Bioinforma Biomath. 3:71–85. 2013.PubMed/NCBI

32 

Vincent A, Herman J, Schulick R, Hruban RH and Goggins M: Pancreatic cancer. Lancet. 378:607–620. 2011. View Article : Google Scholar : PubMed/NCBI

33 

Witkowski ER, Smith JK and Tseng JF: Outcomes following resection of pancreatic cancer. J Surg Oncol. 107:97–103. 2013. View Article : Google Scholar

34 

Mohammed S, Van Buren G II and Fisher WE: Pancreatic cancer: Advances in treatment. World J Gastroenterol. 20:9354–9360. 2014.PubMed/NCBI

35 

Ansari D, Gustafsson A and Andersson R: Update on the management of pancreatic cancer: Surgery is not enough. World J Gastroenterol. 21:3157–3165. 2015. View Article : Google Scholar : PubMed/NCBI

36 

Abreu FB, Liu X and Tsongalis GJ: miRNA analysis in pancreatic cancer: The Dartmouth experience. Clin Chem Lab Med. 55:755–762. 2017. View Article : Google Scholar : PubMed/NCBI

37 

Vorvis C, Koutsioumpa M and Iliopoulos D: Developments in miRNA gene signaling pathways in pancreatic cancer. Future Oncol. 12:1135–1150. 2016. View Article : Google Scholar : PubMed/NCBI

38 

Zhang H, Li S, Yang X, Qiao B, Zhang Z and Xu Y: miR-539 inhibits prostate cancer progression by directly targeting SPAG5. J Exp Clin Cancer Res. 35:602016. View Article : Google Scholar : PubMed/NCBI

39 

Jin H and Wang W: MicroRNA-539 suppresses osteosarcoma cell invasion and migration in vitro and targeting Matrix metal-lopeptidase-8. Int J Clin Exp Pathol. 8:8075–8082. 2015.

40 

Yu H, Gao G, Cai J, Song H, Ma Z, Jin X, Ji W and Pan B: miR-539 functions as a tumor suppressor in pancreatic cancer by targeting TWIST1. Exp Mol Pathol. 108:143–149. 2019. View Article : Google Scholar : PubMed/NCBI

41 

Deng H, Qianqian G, Ting J and Aimin Y: miR-539 enhances chemosensitivity to cisplatin in non-small cell lung cancer by targeting DCLK1. Biomed Pharmacother. 106:1072–1081. 2018. View Article : Google Scholar : PubMed/NCBI

42 

Lv LY, Wang YZ, Zhang Q, Zang HR and Wang XJ: miR-539 induces cell cycle arrest in nasopharyngeal carcinoma by targeting cyclin-dependent kinase 4. Cell Biochem Funct. 33:534–540. 2015. View Article : Google Scholar : PubMed/NCBI

43 

Kahlert UD, Joseph JV and Kruyt FAE: EMT- and MET-related processes in nonepithelial tumors: Importance for disease progression, prognosis, and therapeutic opportunities. Mol Oncol. 11:860–877. 2017. View Article : Google Scholar : PubMed/NCBI

44 

Liu JB, Feng CY, Deng M, Ge DF, Liu DC, Mi JQ and Feng XS: E-cadherin expression phenotypes associated with molecular subtypes in invasive non-lobular breast cancer: Evidence from a retrospective study and meta-analysis. World J Surg Oncol. 15:1392017. View Article : Google Scholar : PubMed/NCBI

45 

Song PP, Qian XY, Zhou H, Shen XH, Liu DD, Feng AN and Gao X: Expression of E-cadherin, N-cadherin, beta-catenin and their clinical significance in laryngeal carcinoma. Zhonghua Er Bi Yan Hou Tou Jing Wai Ke Za Zhi. 51:440–445. 2016.In Chinese. PubMed/NCBI

46 

Zhang L, Sun J, Wang B, Ren JC, Su W and Zhang T: MicroRNA-10b triggers the epithelial-mesenchymal transition (EMT) of laryngeal carcinoma Hep-2 cells by directly targeting the E-cadherin. Appl Biochem Biotechnol. 176:33–44. 2015. View Article : Google Scholar : PubMed/NCBI

47 

Vizcaíno C, Mansilla S and Portugal J: Sp1 transcription factor: A long-standing target in cancer chemotherapy. Pharmacol Ther. 152:111–124. 2015. View Article : Google Scholar : PubMed/NCBI

48 

Beishline K and Azizkhan-Clifford J: Sp1 and the 'hallmarks of cancer'. FEBS J. 282:224–258. 2015. View Article : Google Scholar

49 

Xia B, Hou Y, Chen H, Yang S, Liu T, Lin M and Lou G: Long non-coding RNA ZFAS1 interacts with miR-150-5p to regulate Sp1 expression and ovarian cancer cell malignancy. Oncotarget. 8:19534–19546. 2017.PubMed/NCBI

50 

Mei LL, Wang WJ, Qiu YT, Xie XF, Bai J and Shi ZZ: miR-145-5p suppresses tumor cell migration, invasion and epithelial to mesenchymal transition by Regulating the Sp1/NF-κB signaling pathway in esophageal squamous cell carcinoma. Int J Mol Sci. 18:E18332017. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Xue L, Shen Y, Zhai Z and Zheng S: miR‑539 suppresses the proliferation, migration, invasion and epithelial mesenchymal transition of pancreatic cancer cells through targeting SP1. Int J Mol Med 45: 1771-1782, 2020.
APA
Xue, L., Shen, Y., Zhai, Z., & Zheng, S. (2020). miR‑539 suppresses the proliferation, migration, invasion and epithelial mesenchymal transition of pancreatic cancer cells through targeting SP1. International Journal of Molecular Medicine, 45, 1771-1782. https://doi.org/10.3892/ijmm.2020.4561
MLA
Xue, L., Shen, Y., Zhai, Z., Zheng, S."miR‑539 suppresses the proliferation, migration, invasion and epithelial mesenchymal transition of pancreatic cancer cells through targeting SP1". International Journal of Molecular Medicine 45.6 (2020): 1771-1782.
Chicago
Xue, L., Shen, Y., Zhai, Z., Zheng, S."miR‑539 suppresses the proliferation, migration, invasion and epithelial mesenchymal transition of pancreatic cancer cells through targeting SP1". International Journal of Molecular Medicine 45, no. 6 (2020): 1771-1782. https://doi.org/10.3892/ijmm.2020.4561
Copy and paste a formatted citation
x
Spandidos Publications style
Xue L, Shen Y, Zhai Z and Zheng S: miR‑539 suppresses the proliferation, migration, invasion and epithelial mesenchymal transition of pancreatic cancer cells through targeting SP1. Int J Mol Med 45: 1771-1782, 2020.
APA
Xue, L., Shen, Y., Zhai, Z., & Zheng, S. (2020). miR‑539 suppresses the proliferation, migration, invasion and epithelial mesenchymal transition of pancreatic cancer cells through targeting SP1. International Journal of Molecular Medicine, 45, 1771-1782. https://doi.org/10.3892/ijmm.2020.4561
MLA
Xue, L., Shen, Y., Zhai, Z., Zheng, S."miR‑539 suppresses the proliferation, migration, invasion and epithelial mesenchymal transition of pancreatic cancer cells through targeting SP1". International Journal of Molecular Medicine 45.6 (2020): 1771-1782.
Chicago
Xue, L., Shen, Y., Zhai, Z., Zheng, S."miR‑539 suppresses the proliferation, migration, invasion and epithelial mesenchymal transition of pancreatic cancer cells through targeting SP1". International Journal of Molecular Medicine 45, no. 6 (2020): 1771-1782. https://doi.org/10.3892/ijmm.2020.4561
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team