International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Rectal cancer is one of the most common cancers in Japan as well as the western world. Preoperative CRT followed by total mesorectal excision (TME) has improved the rates of survival, sphincter preservation, and local pelvic control (1–4). Despite significant improvements in the management of rectal cancer, tumor relapse remains the major cause of mortality in patients with preoperative CRT followed by TME. Further improvements in the survival rate cannot be achieved without better control of post-surgical local and distal recurrence.
Leucine-rich repeat-containing G protein-coupled receptor 5 (LGR5), also known as GPR49 (G-protein-coupled receptor 49), is closely related to members of the glycoprotein hormone receptor subfamily with seven transmembrane domains and is a target of Wnt signaling. LGR5 is a potential marker for stem cells in the small intestine and colon (5–7). Sato et al demonstrated that a single LGR5-positive cell could initiate a crypt villus-like structure and generate a continuously expanding, self-organizing epithelial structure reminiscent of normal gut without stroma tissue (8). On the other hand, it has been reported that LGR5 expression is implicated in colorectal carcinogenesis (7,9). Uchida et al reported that LGR5 might be implicated not only in early events but also in late events in colorectal tumori-genesis (10). From these findings, we hypothesized that LGR5 expression might participate in the maintenance and proliferation of residual cancer cells after CRT.
The transmembrane glycoprotein CD44, a hyaluronan receptor, is an adhesion molecule with multiple splice variant isoforms, which facilitates both cell-cell and cell-extracellular matrix (ECM) interactions (11,12). Additionally, CD44 is an important cell surface marker for isolating colon cancer stem cells (CSCs) (13–15). CD44 is expressed by most human cell types and is implicated in a wide variety of physiological and pathological process, including lymphocyte homing and activation, and cell migration (16,17). CD44 is consistently overexpressed in many types of carcinomas including colon cancer and participates in tumor proliferation, invasion, and metastasis (16,18,19). CD44 activation is important to consider in the metastasis cascade due to stimulating tumoral ECM (12,18). Lakshman et al demonstrated that CD44 expression, and, more importantly the v3–10 isoform, promoted resistance to apoptosis in vitro (20). Therefore, we hypothesized that CD44 might be implicated in resistance to CRT and distant relapse in rectal cancer after preoperative CRT. To the best of our knowledge, CD44 expression after CRT has scarcely been evaluated.
Both LGR5 and CD44 have been reported to be Wnt signal targets (7,21–23) and known as stemness markers (21). In this study of locally advanced rectal cancer patients treated with preoperative CRT, we used transcriptional and immunohistochemical analyses to investigate the correlation between LGR5 and CD44 expression, and the association of their expression with clinical outcomes. For CD44, we examined expression in both cancer and stromal cells.
From 2001 to 2008, 64 patients with rectal cancer received preoperative CRT followed by surgery at our institute. The criteria for induction of preoperative CRT in our institute are as follows. Patients must be ≤80 years old, in clinical stage II/III based on the International Union Against Cancer’s TNM classification, with no evidence of distant metastases, no invasion of external sphincter muscle nor elevator muscle of the anus, and no evidence of deep venous thrombosis. Five patients without curative surgery were excluded in this study. Additionally, we excluded 5 patients with pathological complete response after preoperative CRT because cancer cells were not obtained. A total of 54 formalin-fixed, paraffin-embedded (FFPE) specimens were investigated for this study. The study design was approved by the ethics review board of Mie University Hospital. All patients signed informed consent forms for their tissues to be used in this study.
Patients with rectal cancer were treated with short-course (a dose of 20 Gy in 4 fractions) or long-course (a dose of 45 Gy in 25 fractions) radiotherapy using a 4-field box technique with concurrent chemotherapy to take advantage of 5-fluorouracil (5-FU) radio-sensitization. Patients underwent concurrent pharmacokinetic modulation chemotherapy (intravenous infusion of 5-FU: 600 mg/m2 for 24 h, and tegafur-uracil (UFT) given as 400 mg/m2 orally for 5 days. This regimen was based on the previously tested combination of continuous infusion of 5-FU and oral administration of UFT (24). Short-course radiotherapy in our institute is different from standard short-course radiotherapy, 25 Gy in 5 fractions. There are several reasons that we designed the present regimen. We calculated a biologically equivalent dose (BED) of 20 Gy in 4 fractions using a linear quadratic model (25) and its BED was 30 Gy (α/β ratio: 10 Gy). We understand that BED: 30 Gy had a sufficient efficacy reducing the local failure of radiotherapy (26). Forty-two patients received short-course radiotherapy with chemotherapy over 1 week. The remaining 10 patients received long-course radiotherapy with chemotherapy for 4 weeks. The time interval between preoperative CRT and surgery was 2–3 weeks in short-course irradiation patients, and 4–6 weeks in long-course irradiation patients. All patients underwent standard surgery including total mesorectal excision, and received 5-FU based adjuvant chemotherapy after surgery for 6 months to 1 year.
The histo-pathological response of CRT was evaluated using Rödel tumor regression grading (TRG) system (27) and 3-point Ryan system (28). Each TRG was classified by two investigators in a blinded fashion without knowledge of the clinical and pathological information. Rödel TRG system is classified into five categories: grade 0, no regression; grade 1, minor regression (dominant tumor mass with obvious fibrosis in ≤25% of the tumor mass); grade 2, moderate regression (dominant tumor mass with obvious fibrosis in 26–50% of the tumor mass); grade 3, good regression (dominant fibrosis outgrowing the tumor mass; i.e., >50% tumor regression); and grade 4, total regression (no viable tumor cells, only fibrotic mass). We categorized responders as patients with TRG 3 to 4, while non-responders were TRG 0–2. Three-point Ryan system is devised by combining TRG1 (no viable cancer cells) and TRG2 (single cells or small groups of cancer cells) to form one category as 3-point TRG1, and TRG3 (residual cancer outgrown by fibrosis) into 3-point TRG2, combining TRG4 (significant fibrosis outgrown by cancer) and TRG5 (no fibrosis with extensive residual cancer) into 3-point TRG3. Patients with 3-point TRG1 and 2 were categorized as responders and patients with 3-point TRG were categorized as non-responders.
Microdissection of FFPE was performed as previously described (29). Micro-dissected specimens were digested with proteinase K in lysis buffer containing Tris-HCl, ethylenediaminetetraacetic acid, and sodium dodecyl sulfate, as previously published (30), with minor modifications. RNA was purified by phenol and chloroform extraction. Isolated RNA was purified using ethanol precipitation. The concentration and quality of RNA was measured with UV absorbance at 260 and 280 nm (A260/280 ratio).
To reverse transcribe the fragmented mRNA from FFPE tissue materials, we used random hexamer priming, instead of oligo(dT)-based priming. cDNA was synthesized with random hexamer and Superscript III reverse transcriptase (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions.
qRT-PCR analysis was carried out with the SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) using the Applied Biosystems 7500 Real-Time PCR system according to the manufacturer’s instructions. Primers for LGR5, CD44, CTNNB1 (β-catenin) and ACTB (β-actin) were designed with Primer3 software (Biology Workbench Version 3.2, San Diego Supercomputer Center, at the University of California, San Diego). Sequences were as follows: LGR5-specific primers (sense, GATGTTGCTCAGGGTGGACT, and antisense, GGG AGCAGCTGACTGATGTT); CD44-specific primers (sense, CGGACACCATGGACAAGTTT, and antisense, CACGTGGA ATACACCTGCAA), CTNNB1-specific primer (sense, TGTT CGTGCACATCAGGATAC and antisense, GCTCCGGTACA ACCTTCAAC) and ACTB (sense, ACAGAGCCTCGCCTT TGC, and antisense, GCGGCGATATCATCATCC). PCR was performed in a final volume of 25 μl with a SYBR Green PCR Master Mix, using 1 μl cDNA, and 400 nM of each primer for the respective genes. Cycling conditions were 50°C for 2 min and 95°C for 10 min, followed by 40 cycles at 95°C for 15 sec and 60°C for 1 min.
Relative gene expression levels were determined by the standard curve method. The standard curves and line equations were generated using 5-fold serially diluted solutions of cDNA from qPCR Human Reference Total RNA (Clontech, Mountain View, CA) for LGR5 and CD44. All standard curves were linear in the analyzed range with an acceptable correlation coefficient (R2). The amount of target gene expression was calculated from the standard curve followed by quantitative normalization of cDNA in each sample using ACTB gene expression as an internal control. Target gene mRNA levels are given as ratios to ACTB mRNA levels. RT-PCR assays were done in duplicate for each sample and the mean value was used for calculation of the mRNA expression levels.
Immunohistochemistry was performed as previously described (29). LGR5 (GPR49, rabbit monoclonal antibody, clone EPR3065Y, Epitomics, CA, USA) and human CD44H antibody (monoclonal mouse IgG2A, clone no. 2C5, R&D Systems, MN, USA) as primary antibodies were used at dilutions of 1:100 and 1:1000 respectively. All sections were counterstained with hematoxylin, and were dehydrated and mounted. Negative controls were also run simultaneously. LGR5 and CD44 expression was evaluated semi-quantitatively in a blinded fashion without knowledge of clinical and pathological information. We defined the high expression group as cases in which >50% of cancer cells. For the evaluation of immunoreactivity of CD44 in stroma, we defined the high expression group as cases that its strong expressions were localized in cancer stroma surrounding cancer nests.
All statistical analyses were performed using StatView 5.0 for Windows (SAS Institute Inc., Cary, NC). Values of each target gene are expressed as median values (inter-quartile range) in tables. Associations between continuous variables and categorical variables were evaluated using Mann-Whitney U tests for two groups. The χ2 test was also used to assess the significance of the correlation between categorical variables. A non-parametric receiver operating characteristic (ROC) analysis was performed to calculate the best cutoff value for each gene expression level that would be predictive of recurrence and survival, using Medcalc 7.2 for Windows (Mariakerke, Belgium). Recurrence-free survival (RFS) and overall survival (OS) time were calculated from the date of surgery to the date of disease recurrence and patients’ death, respectively. RFS and OS probabilities were calculated using the Kaplan-Meier product limit method; intergroup differences were determined using a log-rank test. The influence of distant recurrence and survival predictors identified univariate analysis was accessed by multivariate analysis using Cox’s proportional hazards model. Two-sided P-values <0.05 were considered statistically significant.
A total of 54 total-RNA were obtained from FFPE specimens of rectal cancer with preoperative CRT. Two specimens were excluded as the ACTB expressions were very low and without reproducibility. Therefore, 52 patients were included in this study. Table I shows patient characteristics and the association of the gene expression levels of LGR5 and CD44 with clinicopathological variables. The median age was 64.5 years (range 37–78 years) and the male to female ratio was 3.7:1. The post-CRT pathological T stages were ypT1 (n=5), ypT2 (n=12), ypT3 (n=33), and ypT4 (n=2). Seventeen patients (33%) had lymph node metastases. Forty-four tumors (85%) showed well or moderately differentiated adenocarcinoma histology. Three patients (6%) had local recurrence alone. A total of 12 patients (23%) had distant recurrence. Patterns of distant recurrence were seen as liver and lung metastases in 2 patients, lung metastasis alone in 6 patients, and peritoneal metastasis in 2 patients. Rödel TRG system was as follows: grade 0, 0 patients; grade 1, 10 patients; grade 2, 22 patients; grade 3, 19 patients; and grade 4, 1 patient. 3-point Ryan TRG was as follows: TRG1, 14 patients; TRG2, 23 patients; TRG3, 15 patients. The median follow-up period was 67 months (range 22–129 months).
Table I.Tumor characteristics and association of LGR5 and CD44 gene expression levels with clinicopathological variables. |
Elevated LGR5 gene expression was significantly correlated with the absence of vascular invasion (P=0.043), well differentiated tumor (P=0.009), and poor pathological response (Rödel system, P=0.011; Ryan system, P=0.0037). On the other hand, no significant associations of CD44 gene expression in residual cancer cells with clinicopathological variables were found (Table I).
qRT-PCR revealed that 16 of the 52 (30.8%) total patients showed detectable CD44 mRNA expression in residual cancer stroma, whereas the remaining patients had no detectable expression despite positive gene expression of ACTB. The right side of Table I shows significant correlations of stromal CD44 gene expression with long course radiation (P=0.0258) and recurrence after curative operation (P=0.0004) (Table I).
As shown in Fig. 1, there was a significant positive correlation between expression levels of LGR5 and CD44 in rectal cancer after CRT (Spearman’s ϱ = 0.451, P=0.0014).
LGR5 expression was detected immunohistochemically at the membrane and in the cytoplasm of cancer cells. CD44 expression was observed at the membrane of cancer cells and in stromal tissue surrounding residual cancer nests (Fig. 2). We divided expression into two groups, high or low, according to immunoreactivity of LGR5 and CD44. There was significant correlation between their immunoreactivities using the χ2 test (P=0.0356) (data not shown).
The correlation of LGR5 and CD44 immunoreactivities with clinical outcome was evaluated. The LGR5 immunoreactivity of cancer cells was correlated with well differentiated tumor (P=0.0196). On the other hand, the CD44 immunoreactivity of cancer cells was correlated with the absence of lymph node metastasis and low postoperative stage (P=0.0092 and 0.00046, respectively). The strong immunoreactivity of CD44 in stromal cells was correlated with tumor recurrence (Rödel, P=0.012; Ryan, P=0.042, respectively) (Table II).
A significant correlation of gene expression of LGR5 with LGR5 immunoreactivity was observed (P= 0.0062). On the other hand, there was a significant correlation between CD44 mRNA levels and its immunoreactivity in cancer stroma (P=0.0138). Without reaching statistical significance, there was a correlation between CD44 mRNA levels and its immunoreactivity in cancer cells (P=0.0669) (Fig. 3).
On the basis of these results, receiver operating curve (ROC) analysis was used to identify the cutoff value for LGR5 and for CD44 gene expression levels that were predictive of disease recurrence and patients’ death. A nonparametric ROC analysis determined that the optimal cutoff values of LGR5 and CD44 were 6.169 and 0.185 for RFS, and 24.621 and 0.213 for OS. Fig. 4 shows the survival curve for RFS and OS according to LGR5 and CD44 gene expression using Kaplan-Meier method. Patients with LGR5 gene expression levels above cutoff values showed a significantly poorer RFS and OS than did patients with expression levels below cutoff values (RFS; P=0.0063, OS; P=0.0191). While, CD44 gene expression levels above cutoff values showed a significantly poorer OS than did patients with expression levels below cutoff values although CD44 gene expression level did not have a significant association with RFS (RFS; P=0.0837, OS; P=0.0131). On the other hand, patients with positive CD44 gene expression in cancer stroma showed significantly worse RFS and OS (P<0.0001). RFS and OS according to the immunoreactivity of LGR5 and CD44 did not show the significant difference (data not shown).
Table III shows the results of univariate and multivariate analyses of factors influencing patients’ prognosis using Cox’s proportional hazards model. univariate analysis showed that cancer LGR5 expression and positivity of stromal CD44 gene expression levels were significantly associated with a higher rate of developing recurrence after preoperative CRT (P=0.0136 and 0.0005, respectively). In a multivariate analysis, a positivity of stromal CD44 gene expression was found to be an independent predictive marker for disease recurrence after preoperative CRT (P=0.0028) (Table IIIA). On the other hand, univariate analysis showed that the following factors were significantly related to postoperative overall survival: disease recurrence, cancer LGR5, CD44 gene expression level and positivity of stromal CD44 gene expression (P=0.0044, 0.0287, 0.0192 and 0.0004, respectively). Multivariate analysis indicated that positivity of stromal CD44 gene expression was an independent prognostic factor for the overall survival of patients with rectal cancer after preoperative CRT (P=0.0491) (Table IIIB). The clinical variables before CRT seemed not to be influenced in patient prognosis after CRT.
Preoperative CRT for locally advanced rectal cancer is an effective tool for local control because it induces cancer cell apoptosis and death, and inhibits cell growth in various malignancies (2,31). However, the mechanism of tumor relapse in rectal cancer after preoperative CRT has been not fully elucidated. Actually, clinicopathological variables including TNM classification in pre-CRT was not influenced in patient prognosis after CRT in the present study. To clarify the characteristics of cancer cells after CRT, it is necessary to reevaluate the expression of genes and proteins associated with clinical outcome because the characteristics of cancer cells after CRT may be different from those of primary cancer cells prior to treatment. The identification of predictive markers for recurrence or poor prognosis should improve both clinical outcome and potential treatment stratification for such patients. Therefore, we focused the expression of genes and proteins after preoperative CRT.
CSCs are a small sub-population of cancer cells that possess stem cell-like properties such as self-renewal and the ability to differentiate into multiple cell types. Recent research suggests that CSCs are particularly resistant to conventional CRT compared with non-CSCs (13–15,32). These lines of evidence prompted us to hypothesize that CSCs survive CRT and are associated with resistance to CRT and tumor relapse after CRT. CD44 is a candidate marker for colon CSCs (13–15), while LGR5 is a potential marker for stem cells in the small intestine and colon (5–7). We found a significant positive correlation between LGR5 and CD44 protein expression and between LGR5 and CD44 gene expression in cancer cells after CRT using transcriptional and immunohistochemical analyses. Both these markers have been known as targets of Wnt signaling. Wnt signaling has emerged as a critical regulator of stem cells and the its pathway is integrally involved in both stem cell and cancer cell maintenance and growth (33). Kanwar et al reported that Wnt/β-catenin signaling plays a critical role in the growth and maintenance of colonospheres and the inhibition of β-catenin results in a marked reduction in CD44-positive cells as well as colonospheres formation (34). While, it has been reported that LGR5 expression is associated with activation of the Wnt pathway (35). We immunohistochemically examined the expression of β-catenin as Wnt target molecule and observed its expression in residual cancer cells with both LGR5 and CD44 expression (data not shown). Although our study did not demonstrate the direct correlation between LGR5 and CD44, these expressions might have any interaction via Wnt signaling pathway.
We observed that elevated LGR5 expression in cancer cells and CD44 expression in cancer stroma, but not cancer cells were significantly correlated with poor pathological response. Additionally, elevated gene expression of LGR5 in cancer cells and positive gene expression of CD44 in cancer stroma were significantly associated with poor RFS, and elevated gene expression of LGR5 and CD44 in cancer cells and positive gene expression of CD44 in cancer stroma were significantly associated with poor OS. These results suggested that both LGR5 and CD44 gene expression were useful prognostic markers of patients with rectal cancer after preoperative CRT. Especially, CD44 gene expression in both cancer cells and stroma was an independent prognostic factor for the RFS and OS. Without reaching statistical significance, there was the association of poor recurrence-free survival with CD44 immunoreactivity in cancer stroma (log-rank test; P=0.060). CD44 is an important mediator in regulating interaction between ECM and the intra-cellular actin cytoskeleton. CD44 are considered to generate a number of cellular signals which play critical roles in not only cancer invasion and metastasis, but also various physiological and pathological processes (12,16,18). In the present study, our results emphasized the significance of CD44 expression in not only cancer cells but also cancer stromal tissue. However, there were some discrepancy of the results between gene expression level and immunoreactivity of these markers although the correlation between these gene and protein expressions was observed. Immunohistochemistry, western blotting, and other protein-quantification methods do not always corroborate RT-qPCR data. For CD44, we used the monoclonal antibody for CD44 immunostaining included variant 3–10. Previous reports demonstrated that overexpression of the standard CD44 isoform resulted in decreased tumorigenesis and tumor progression in vitro (36). Some studies indicated that high expression of CD44v6 was associated with primary tumors and was a predictor of metastasis, including colon cancer (11,37). Taken together, whether CD44 promotes or protects against tumor progression may depend on the isoform. Hence, to clarify the function of CD44, we plan to further investigate the differences of expression according to each splice variant.
In conclusion, there was a significant positive correlation between LGR5 and CD44 expression and elevated these expressions were associated with poor prognosis. Our results suggest that LGR5 and CD44 may contribute to tumor relapse in locally advanced rectal cancer treated with preoperative CRT. However, data in this study should be interpreted with some caution. First of all, the major limitations were the small number of patients (n=52), especially those with a recurrence (n=15), and the retrospective nature of the study. Second, this study included two neoadjuvant radiation regimens with different time interval between pretreatment and surgery. Third, our short-course regimen was different from standard one. A larger study population, a long-term follow-up and the unification of pretreatments are needed to validate these results.
The authors would like to thank Motoko Ueeda, Yuka Kato, and Chihiro Hibi for providing excellent technical assistance.
|
Sauer R, Becker H, Hohenberger W, et al: Preoperative versus postoperative chemoradiotherapy for rectal cancer. N Engl J Med. 351:1731–1740. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Sebag-Montefiore D, Stephens RJ, Steele R, et al: Preoperative radiotherapy versus selective postoperative chemoradiotherapy in patients with rectal cancer (MRC CR07 and NCIC-CTG C016): a multicentre, randomised trial. Lancet. 373:811–820. 2009. View Article : Google Scholar | |
|
Bosset JF, Collette L, Calais G, et al: Chemotherapy with preoperative radiotherapy in rectal cancer. N Engl J Med. 355:1114–1123. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Guillem JG, Chessin DB, Cohen AM, et al: Long-term oncologic outcome following preoperative combined modality therapy and total mesorectal excision of locally advanced rectal cancer. Ann Surg. 241:829–838. 2005. View Article : Google Scholar | |
|
Barker N, van Es JH, Kuipers J, et al: Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature. 449:1003–1007. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Becker L, Huang Q and Mashimo H: Immunostaining of Lgr5, an intestinal stem cell marker, in normal and premalignant human gastrointestinal tissue. Sci World J. 8:1168–1176. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Haegebarth A and Clevers H: Wnt signaling, lgr5, and stem cells in the intestine and skin. Am J Pathol. 174:715–721. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Sato T, Vries RG, Snippert HJ, et al: Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459:262–265. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Barker N, Ridgway RA, van Es JH, et al: Crypt stem cells as the cells-of-origin of intestinal cancer. Nature. 457:608–611. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Uchida H, Yamazaki K, Fukuma M, et al: Overexpression of leucine-rich repeat-containing G protein-coupled receptor 5 in colorectal cancer. Cancer Sci. 101:1731–1737. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Ponta H, Sherman L and Herrlich PA: CD44: from adhesion molecules to signalling regulators. Nat Rev Mol Cell Biol. 4:33–45. 2003. View Article : Google Scholar : PubMed/NCBI | |
|
Nagano O and Saya H: Mechanism and biological significance of CD44 cleavage. Cancer Sci. 95:930–935. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Reya T, Morrison SJ, Clarke MF, et al: Stem cells, cancer, and cancer stem cells. Nature. 414:105–111. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Vermeulen L, Sprick MR, Kemper K, et al: Cancer stem cells - old concepts, new insights. Cell Death Differ. 15:947–958. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Thenappan A, Li Y, Shetty K, et al: New therapeutics targeting colon cancer stem cells. Curr Colorectal Cancer Rep. 5:2092009. View Article : Google Scholar : PubMed/NCBI | |
|
Marhaba R and Zoller M: CD44 in cancer progression: adhesion, migration and growth regulation. J Mol Histol. 35:211–231. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Subramaniam V, Vincent IR, Gardner H, et al: CD44 regulates cell migration in human colon cancer cells via Lyn kinase and AKT phosphorylation. Exp Mol Pathol. 83:207–215. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Jothy S: CD44 and its partners in metastasis. Clin Exp Metastasis. 20:195–201. 2003. View Article : Google Scholar : PubMed/NCBI | |
|
Lopez JI, Camenisch TD, Stevens MV, et al: CD44 attenuates metastatic invasion during breast cancer progression. Cancer Res. 65:6755–6763. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Lakshman M, Subramaniam V, Rubenthiran U, et al: CD44 promotes resistance to apoptosis in human colon cancer cells. Exp Mol Pathol. 77:18–25. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Zeki SS, Graham TA and Wright NA: Stem cells and their implications for colorectal cancer. Nat Rev Gastroenterol Hepatol. 8:90–100. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Wielenga VJ, Smits R, Korinek V, et al: Expression of CD44 in Apc and Tcf mutant mice implies regulation by the WNT pathway. Am J Pathol. 154:515–523. 1999. View Article : Google Scholar : PubMed/NCBI | |
|
Kim BM, Mao J, Taketo MM, et al: Phases of canonical Wnt signaling during the development of mouse intestinal epithelium. Gastroenterology. 133:529–538. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Yoshikawa R, Kusunoki M, Yanagi H, et al: Dual antitumor effects of 5-fluorouracil on the cell cycle in colorectal carcinoma cells: a novel target mechanism concept for pharmacokinetic modulating chemotherapy. Cancer Res. 61:1029–1037. 2001. | |
|
Fowler JF: The linear-quadratic formula and progress in fractionated radiotherapy. Br J Radiol. 62:679–694. 1989. View Article : Google Scholar : PubMed/NCBI | |
|
Viani GA, Stefano EJ, Soares FV, et al: Evaluation of biologic effective dose and schedule of fractionation for preoperative radiotherapy for rectal cancer: meta-analyses and meta-regression. Int J Radiat Oncol Biol Phys. 80:985–991. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Rodel C, Martus P, Papadoupolos T, et al: Prognostic significance of tumor regression after preoperative chemoradiotherapy for rectal cancer. J Clin Oncol. 23:8688–8696. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Ryan R, Gibbons D, Hyland JM, et al: Pathological response following long-course neoadjuvant chemoradiotherapy for locally advanced rectal cancer. Histopathology. 47:141–146. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Saigusa S, Tanaka K, Toiyama Y, et al: Correlation of CD133, OCT4, and SOX2 in rectal cancer and their association with distant recurrence after chemoradiotherapy. Ann Surg Oncol. 16:3488–3498. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Bijwaard KE, Aguilera NS, Monczak Y, et al: Quantitative real-time reverse transcription-PCR assay for cyclin D1 expression: utility in the diagnosis of mantle cell lymphoma. Clin Chem. 47:195–201. 2001.PubMed/NCBI | |
|
Watanabe T: Chemoradiotherapy and adjuvant chemotherapy for rectal cancer. Int J Clin Oncol. 13:488–497. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Bao S, Wu Q, McLendon RE, et al: Glioma stem cells promote radioresistance by preferential activation of the DNA damage response. Nature. 444:756–760. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Reya T and Clevers H: Wnt signalling in stem cells and cancer. Nature. 434:843–850. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Kanwar SS, Yu Y, Nautiyal J, et al: The Wnt/beta-catenin pathway regulates growth and maintenance of colonospheres. Mol Cancer. 9:2122010. View Article : Google Scholar : PubMed/NCBI | |
|
Takahashi H, Ishii H, Nishida N, et al: Significance of Lgr5(+ve) cancer stem cells in the colon and rectum. Ann Surg Oncol. 18:1166–1174. 2011. | |
|
Choi SH, Takahashi K, Eto H, et al: CD44s expression in human colon carcinomas influences growth of liver metastases. Int J Cancer. 85:523–526. 2000. View Article : Google Scholar : PubMed/NCBI | |
|
Mulder JW, Wielenga VJ, Polak MM, et al: Expression of mutant p53 protein and CD44 variant proteins in colorectal tumorigenesis. Gut. 36:76–80. 1995. View Article : Google Scholar : PubMed/NCBI |