Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
October 2013 Volume 43 Issue 4

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October 2013 Volume 43 Issue 4

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Curcumin-loaded nanoparticles induce apoptotic cell death through regulation of the function of MDR1 and reactive oxygen species in cisplatin-resistant CAR human oral cancer cells

  • Authors:
    • Pei-Ying Chang
    • Shu-Fen Peng
    • Chao-Ying Lee
    • Chi-Cheng Lu
    • Shih-Chang Tsai
    • Tzong-Ming Shieh
    • Tian-Shung Wu
    • Ming-Gene Tu
    • Michael Yuanchien Chen
    • Jai-Sing Yang
  • View Affiliations / Copyright

    Affiliations: Department of Dentistry, China Medical University, Taichung 404, Taiwan, R.O.C., Department of Biological Science and Technology, China Medical University, Taichung 404, Taiwan, R.O.C., School of Pharmacy, China Medical University, Taichung 404, Taiwan, R.O.C., Department of Pharmacology, China Medical University, Taichung 404, Taiwan, R.O.C., Department of Dental Hygiene, China Medical University, Taichung 404, Taiwan, R.O.C., Department of Chemistry, National Cheng Kung University, Tainan 701, Taiwan, R.O.C., Dental Department and Division of Oral Maxillofacial Surgery, China Medical University Hospital, Taichung 40447, Taiwan, R.O.C.
  • Pages: 1141-1150
    |
    Published online on: August 5, 2013
       https://doi.org/10.3892/ijo.2013.2050
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Curcumin is a polyphenolic compound which possesses anticancer potential. It has been shown to induce cell death in a variety of cancer cells, however, its effect on CAL27‑cisplatin-resistant human oral cancer cells (CAR cells) has not been elucidated to date. The low water solubility of curcumin which leads to poor bioavailability, however, has been highlighted as a major limiting factor. In this study, we utilized water-soluble PLGA curcumin nanoparticles (Cur-NPs), and investigated the effects of Cur-NPs on CAR cells. The results showed Cur-NPs induced apoptosis in CAR cells but exhibited low cytotoxicity to normal human gingival fibroblasts (HGFs) and normal human oral keratinocytes (OKs). Cur-NPs triggered DNA concentration, fragmentation and subsequent apoptosis. Compared to untreated CAR cells, a more detectable amount of Calcein-AM accumulation was found inside the treated CAR cells. Cur-NPs suppressed the protein and mRNA expression levels of MDR1. Both the activity and the expression levels of caspase-3 and caspase-9 were elevated in the treated CAR cells. The Cur-NP-triggered apoptosis was blocked by specific inhibitors of pan-caspase (z-VAD-fmk), caspase-3 (z-DEVD-fmk), caspase-9 (z-LEHD-fmk) and antioxidant agent (N-acetylcysteine; NAC). Cur-NPs increased reactive oxygen species (ROS) production, upregulated the protein expression levels of cleaved caspase-3/caspase-9, cytochrome c, Apaf-1, AIF, Bax and downregulated the protein levels of Bcl-2. Our results suggest that Cur-NPs triggered the intrinsic apoptotic pathway through regulating the function of multiple drug resistance protein 1 (MDR1) and the production of reactive oxygen species (ROS) in CAR cells. Cur-NPs could be potentially efficacious in the treatment of cisplatin-resistant human oral cancer.

Introduction

Head and neck squamous cell carcinoma (HNSCC) ranks the sixth most common cancer in the world, and the survival rate has not improved significantly in the last 20 years despite the countless studies on this malignancy (1,2). In Taiwan, HNSCC has become the fourth most common cause of cancer death in males (3,4). Most of Taiwanese victims of HNSCC are diagnosed with oral squamous cell carcinoma (OSCC) due to the wide prevalence of betel-quid chewing (3,5). Depending on tumor staging, the treatment options of OSCC include surgery, radiotherapy and chemotherapy (6,7). The significant morbidities caused by cisplatin-based chemotherapy have led to continuing research on less toxic therapeutic agents (8,9). Drug resistance to cisplatin in patients with recurrent or metastatic OSCC is another challenge in oncology clinical practice (10,11).

Curcumin is a hydrophobic polyphenol derived from the plant Curcuma longa (tumeric) and has been used in Traditional Oriental Medicine for thousands of years (12–14). It is reported to possess a variety of pharmacologic effects including anti-amyloid, anti-bacterial, anti-depressant, anti-inflammatory, antioxidant and anticancer properties (12,13,15). It has also been proven to be a modulator of intracellular signaling pathways and to target multiple molecules that inhibit cancer cell proliferation, induce apoptosis (activation of caspases and downregulation of anti-apoptotic gene products) (16–20) or autophagy (18,19,21), to inhibit invasion (MMP-9 and cell adhesion molecules) (22–24) and to suppress inflammation molecules (such as NF-κB, TNF, IL-6, IL-1, COX-2 and 5-LOX) (25,26). The anticancer potential of curcumin has entered into phase II and phase III clinical trials for colon and pancreatic cancers (27,28).

Various animal models and human studies proved that curcumin is non-toxic even at high doses (13,29). In spite of its efficacy and safety, the low water solubility, which leads to poor bio-availability of curcumin has been considered to be a major limiting factor (30–32). The contributing reasons for reduced bio-availability of curcumin are poor absorption, high rate of metabolism and rapid systemic elimination (30–32). New drug delivery systems by oral administration are one of the means to enhance the bio-availability of curcumin. Poly(lactic-co-glycolic acid) (PLGA), a bio-degradable and bio-compatible copolymer that is approved by US Food and Drug Administration (FDA) as a therapeutic device, has been reported as a carrier of curcumin through oral administration improving bio-availability of curcumin at different levels (33–39), however, the molecular mechanism is still unclear. The factors that can affect oral bio-availability of drugs include permeability, efflux transporters (e.g., P-glycoprotein, P-gp, MDR), and enzyme induction or inhibition on intestinal epithelial cells (40,41). Studies show that the intestinal P-gp efflux pump and enterocyte-based metabolism make for a major barrier to the oral bioavailability for various compounds (40,42,43).

To improve the oral bio-availability of curcumin, we designed and developed Cur-NPs (PLGA nanoparticles loaded with curcumin) (Fig. 1A). The purpose of the research was to investigate the molecular mechanisms triggered by Cur-NPs in CAR (CAL27-cisplatin resistant) cell line which was established in our laboratory and is unique in its resistance to cisplatin treatment, and to clarify the mechanism of CUR-PLGA-NPs to enhance bioavailability.

Figure 1.

(A). The schematic diagram of Cur-NPs preparation. The curcumin was encapsulated in the PLGA by single emulsion. (B). Morphology observation of Cur-NPs by TEM. The Cur-NPs show spherical in shape.

Materials and methods

Chemicals and reagents

Cisplatin, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), poly(D,L-lactide-co-glycolide) (PLGA, copolymer ratio 75:25; molecular weight, 66,000–92,000), polyvinyl alcohol (PVA; average molecular weight, 30,000–70,000) and curcumin were purchased from Sigma-Aldrich Corp. (St. Louis, MO, USA). Fetal bovine serum (FBS), L-glutamine, penicillin G, trypsin-EDTA, 4′,6-diamidino-2-phenylindole (DAPI), 2′,7′-dichlorodihydrofluorescein diacetate (H2DCFDA) and calcein-AM were obtained from Life Technologies (Carlsbad, CA, USA). Caspase-3 and caspase-9 activity assay kits were purchased from R&D Systems Inc. (Minneapolis, MN, USA). The primary antibodies against caspase-3, caspase-9, Endo G and Bcl-2 were obtained from Cell Signaling Technology Inc. (Beverly, MA, USA). All other antibodies used in this study and horseradish peroxidase (HRP)-conjugated secondary antibodies against rabbit or mouse immunoglobulin were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA). The specific caspase inhibitors (z-VAD-fmk, z-DEVD-fmk and z-LEHD-fmk) and enhanced chemiluminescence (ECL) detection kit (Immobilon Western Chemiluminescent HRP Substrate) were obtained from Merck Millipore (Billerica, MA, USA).

Cell culture

The human head and neck carcinoma cell line CAL27 was obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). The cisplatin-resistant cell line CAR (CAL27-cisplatin resistant) was established by clonal selection of CAL27 using 10 cycles of 1 passage treatment with 10–100 μM of cisplatin followed by a recovery period of another passage (44). CAR cells were cultivated in Dulbecco’s modified Eagle’s medium (DMEM, Life Technologies) supplemented with 10% FBS, 100 μg/ml streptomycin, 100 U/ml penicillin G, 2 mM L-glutamine and 100 μM cisplatin for our study. Normal human gingival fibro-blasts cells (HGF) and normal human oral keratinocyte cells (OK) cells were kindly provided by Dr Tzong-Ming Shih (45). Normal human gingival fibroblasts cells (HGF) and normal human oral keratinocyte cells (OK) were cultivated in DMEM (Life Technologies) supplemented with 10% FBS, 100 μg/ml streptomycin, 100 U/ml penicillin G, 2 mM L-glutamine and 80 μM cisplatin.

Curcumin loaded nanoparticles

Curcumin-loaded PLGA nanoparticles (Cur-NPs) were prepared by using single emulsion solvent evaporation method. In brief, cucurmin (1 mg) and PLGA (10 mg) were dissolved in dichloromethane. The curcumin and PLGA solution (1 ml) was added to 2 ml of 10% (w/v) PVA surfactant solution to form an oil-in-water emulsion by sonication. The emulsion was carried out by setting sonication at 55 W of energy output for 3 min over an ice bath. The formed emulsion was dispersed drop-wise into the 0.5% (w/v) PVA solution and stirred for additional 4 h at room temperature on a magnetic stir plate to allow evaporation of organic solvent. Nanoparticles were collected by centrifugation at 12,000 rpm for 30 min and washed twice with double distilled water to remove PVA and un-encapsulated curcumin. The prepared nanoparticles were collected and lyophilized (46,47).

Transmission electron microscopy (TEM) observation

The morphology of test nanoparticles was examined by TEM (JEOL, Tokyo, Japan). A dilute suspension of nanoparticles (1/10 dilution) was prepared in double distilled water. One drop of this solution was placed on the TEM grid for 10 min, washed twice with double distilled water and allowed to dry overnight. The images were observed and captured at an accelerating voltage of 120 kV under a microscope (35,48,49).

Cell viability and apoptotic morphological features

The cell viability was assessed by the MTT assay. Briefly, CAR cells, normal human gingival fibroblasts cells (HGF) and normal human oral keratinocyte cells (OK) were cultured in a 96-well plate at the density of 1×104 cells per well and were incubated with 0, 10, 20, 40 and 80 μM of Cur-NPs for 24 and 48 h. After that, culture medium containing 500 μg/ml MTT was added to each well, and then incubated at 37°C for 4 h before the supernatant was removed. The formed blue formazan crystals in viable CAR cells were dissolved with isopropanol/0.04 N HCl, followed by measurement of the absorbance of each well at 570 nm with the ELISA reader with a reference wavelength of 620 nm. All experiments were performed in triplicate. The morphological examination of apoptosis in Cur-NPs-treated CAR cells was determined under a phase-contrast microscope (50).

DAPI staining for apoptosis

CAR cells (5×104 cells/well) into 12-well plates were incubated without (control) or with 10, 20 and 40 μM of Cur-NPs for 24 h. Cells were washed with PBS and permeabilized in 0.1% Triton X-100 in PBS for 30 min after being fixed in 3.8% formaldehyde for 15 min. Cells were then stained with DAPI (1 μg/ml) in PBS at 37°C for 30 min, following utilizing fluorescence microscopy as described elsewhere (51).

Internalization of curcumin

To track the internalization of Cur-NPs, cells (1×106 cells/plate) were seeded on 6-well plates and incubated overnight. Subsequently, cells were treated with Cur-NPs containing 40 μM curcumin for 24 h. Finally, the cells were washed with PBS twice, and the internalized curcumin were observed under fluorescence microscope with the filter of 488-nm excitation wavelength and 520-nm emission (30,52).

Western blot analysis

CAR cells (1×107/75-T flask) were treated with 0, 10, 20, 40 and 80 μM of Cur-NPs for 24 h or 40 μM Cur-NPs for 0, 12, 24, 36 and 48 h. Cells were then harvested, lysed and the total proteins were collected by SDS sample buffer. In brief, about 30 μg of protein from each treatment was resolved on 10% SDS-polyacrylamide gel electrophoresis (PAGE) and electro-transferred to the Immobilon-P Transfer Membrane (Merck Millipore). The transferred membranes were blocked in 5% non-fat dry milk in 20 mM Tris buffered saline/0.05% Tween-20 for 1 h at room temperature followed by incubation with appropriate primary antibodies at 4°C overnight. At the end of incubation, membranes were washed with Tris-buffered saline/Tween-20 and incubated with secondary antibodies conjugated with HRP. The blots were developed by the chemiluminescence kit and autoradiography was taken using X-ray film. Each membrane was stripped and reprobed with anti-β-actin antibody (Sigma-Aldrich Corp.) to ensure equal protein loading during the experiments (53).

Real-time PCR analysis

CAR cells at a density of 5×106 in T75 flasks were incubated with or without 40 and 80 μM of Cur-NPs for 24 h. Cells were collected, and total RNA was extracted by the Qiagen RNeasy mini kit (Qiagen Inc., Valencia, CA, USA). Each RNA sample was individually reverse-transcribed using the High Capacity cDNA Reverse Transcription kits according to the standard protocols (Applied Biosystems, Foster City, CA, USA) (54). Quantitative PCR was assessed for amplifications with 2X SYBR-Green PCR Master mix (Applied Biosystems) and forward (GTGTGGTGAGTCAGGAACCTGTAT) and reverse (TCTCAATCTCATCCATGGTGACA) primers for MDR1 gene (diallyl sulfide, diallyl disulfide and diallyl trisulfide affect drug resistant gene expression in colo 205 human colon cancer cells in vitro and in vivo). The 7300 Real-Time PCR (Applied Biosystems) was run in triplicate, and each value was expressed as the comparative threshold cycle (CT) method for the housekeeping gene GAPDH as described elsewhere (55).

Calcein-AM assay

CAR cells (2×105 cells/well) into 12-well plates were treated with or without 0, 10, 20, 40 and 80 μM of Cur-NPs. After a 24-h exposure, cells were washed twice, and 200 nM calcein-AM was added to each incubation medium for 30 min. The specific calcein fluorescence intensity was measured by flow cytometry, and at least ten thousand events were analyzed per sample as previously described (55).

Assays for caspase-3 and caspase-9 activities

CAR cells (approximately 1×107/75-T flask) were exposed to 0, 10, 20, 40 and 80 μM of Cur-NPs for 24 h. Subsequently, cells were harvested, and cell lysates were assessed in accordance with the manufacturer’s instruction provided in the caspase-3 and caspase-9 Colorimetric Assay kits (R&D Systems Inc.). Cell lysate containing 50 μg protein was then incubated for 1 h at 37°C with specific caspase-3 substrate (DEVD-pNA) or caspase-9 substrate (LEHD-pNA) and the reaction buffer (provided in the kits) and determined by measuring OD405 of the released pNA as previously described (56).

Detection of ROS generation

CAR cells (2×105 cells/well) were treated with 25 μM of Cur-NPs for 0, 3, 6, 12 and 24 h, harvested, and incubated with 10 μM H2DCFDA at 37°C for 30 min. DCF fluorescence oxidized by ROS was detected by flow cytometry as described elsewhere (57).

Effects of the caspase inhibitors and ROS scavenger on cell viability

CAR cells at a density of 2×105 cells/well into 12-well plates were preincubated with 10 μM z-VAD (a pan-caspase inhibitor), 10 μM z-DEVE (a caspase-3 inhibitor), 10 μM z-LEHD (a caspase-9 inhibitor) and N-acetyl-L-cysteine (NAC), a ROS scavenger for 2 h followed by treatment with or without 25 μM Cur-NPs. Cells were thereafter harvested at 24 h to investigate the percentage of viable cells as elsewhere described (57).

Statistical analysis

All the statistical results are performed as the mean ± standard error of the mean (SEM) for the indicated number of independent experiments. Statistical analyses of data were done using one-way ANOVA followed by Student’s t-test, and the levels of p<0.001 was considered significant between the treated and untreated groups (58).

Results

Cur-NPs reduce the viability of human oral cancer CAL27-cisplatin resistant (CAR) cells, but not the cytotoxic effect on normal cells

CAR cells were exposed to Cur-NPs (0, 10, 20, 40 and 80 μM) for 24 and 48 h, and cells from each treatment were collected then determined using MTT assay. Results demonstrated that even though 10 μM of Cur-NPs showed no effect on viability and the concentrations of Cur-NPs treatment (20, 40 and 80 μM) significantly decreased cell viability in CAR cells in a concentration- and time-dependent manner (bottom panels of Fig. 2A and B). The cells after Cur-NPs challenge were investigated for morphological changes such as shrinkage and rounding (an apoptotic characteristic) as can be seen in the top of Fig. 2A and B. Importantly, Cur-NPs have less toxicity (no viability impact and morphological traits) in normal cell lines, including normal human gingival fibro-blasts (HGF) and normal human oral keratinocyte cells (OK) (IC50 >80 μM) (Fig. 2C and D). These results suggest that Cur-NPs exhibit anticancer action against cisplatin-resistant oral tumor cells in vitro.

Figure 2.

Effects of Cur-NPs on cell viability in CAL27-cisplatin resistant human oral cancer cells (CAR cells) for (A) 24 or (B) 48 h, (C) normal human gingival fibroblasts (HGF) for 48 h and (D) normal human oral keratinocyte cells (OK) for 48 h. Cells were incubated in the absence or presence of 0, 10, 20, 40 and 80 μM of Cur-NPs for 24 and 48 h. Cell viability on Cur-NPs-treated cells were determined using the MTT assay as described in Materials and methods. The data are presented as mean ± SEM in triplicate by comparing between the treated and untreated control cells. ***p<0.001 compared with the control value.

Cur-NPs induce apoptosis and suppresses multiple drug resistance protein 1 (MDR1) in CAR cells

After treatment with various concentrations (10, 20 and 40 μM) of Cur-NPs for 24 h, the ability of induction of nuclear condensation was employed by DAPI staining. The results shown in Fig. 3A revealed apoptotic evidence visualized in Cur-NPs-treated CAR cells and this effect is concentration-dependent. The nanoparticle form of curcumin improves the drawback of curcumin solubility in water and increases the amount of curcumin delivered into cells. Cellular uptake of Cur-NPs was observed by visualizing the green fluorescence of curcumin using fluorescence microscopy (Fig. 3B). Intensified fluorescence was observed in the cytoplasm and nucleus of cells treated with Cur-NPs, indicating the amount of curcumin internalized to the cells. Strikingly, our data indicate attenuation of the expression of MDR1 in Cur-NP-treated CAR cells. We also found that Cur-NPs at 40 and 80 μM inhibited the level of MDR1 gene expression in CAR cells (Fig. 3C and D). Alternatively, the drug-resistance expression in CAR cells after exposure to Cur-NPs was detected by calcein-AM staining and flow cytometry. Fig. 3E shows Cur-NPs decreased drug interaction with multidrug resistance protein in CAR cells. Altogether, these results demonstrate that induction of CAR cell apoptosis occurred, as well as suppression of multiple drug resistance by Cur-NPs.

Figure 3.

Effects of Cur-NPs on DNA internucleosomal fragmentation, cellular uptake, MDR1 protein and mRNA levels, and calcein-AM accumulation in CAR cells. (A) For DAPI staining, CAR cells were incubated without (control) or with 10, 20 and 40 μM of Cur-NPs for 48 h. Cells were stained with DAPI dye at 37°C for 30 min, followed by fluorescence microscopy. (B) To track the internalization of Cur-NPs, cells were incubated without (control) or with Cur-NPs containing 40 μM curcumin for 24 h. The internalized curcumin was observed under a fluorescence microscope with the filter of 488-nm excitation wavelength and 520-nm emission. (C) Cells were treated with Cur-NPs 0, 10, 20, 40 and 80 μM for 24 h then subjected to western blot analysis of MDR1 protein level in CAR cells. β-actin was detected for equivalent protein loading. (D) Cells were treated with Cur-NPs 0, 40 and 80 μM for 24 h then subjected to real-time PCR of MDR1 mRNA level in CAR cells. GAPDH was detected for equivalent protein loading. (E) For calcein-AM accumulation, CAR cells in response to 10, 20, 40 and 80 μM Cur-NPs for 24 h and the calcein-AM accumulation was analyzed by flow cytometry. The data are presented as mean ± SEM in triplicate by comparing between the treated and untreated control cells. ***p<0.001 compared with the control value.

Cur-NPs trigger intrinsic apoptotic cell death in CAR cells

To address whether Cur-NPs induce apoptosis in CAR cells, cells were treated with Cur-NPs (0, 10, 20, 40 and 80 μM) for 24 h before subjected to caspase-3/-9 activity. Our data as shown in Fig. 4A and B present that Cur-NPs stimulated caspase-3 (Fig. 4A) and caspase-9 (Fig. 4B) activity at a 24-h exposure. In order to confirm the roles of caspase cascade-mediated apoptosis by Cur-NPs, we treated CAR cells without or with z-VAD (a pan-caspase inhibitor), z-DEVE (a caspase-3 inhibitor) and z-LEHD (a caspase-9 inhibitor) before exposure to Cur-NPs to investigate viability. Our data showed that z-VAD significantly suppressed Cur-NPs-reduced viability by up to 90% in CAR cells (Fig. 4C). Moreover, both caspase protease inhibitors (z-DEVE and z-LEHD) substantially protected against Cur-NP-triggered cell death and viability of CAR cells (Fig. 4D). Based on these findings, we provide evidence that the intrinsic caspase contributed to Cur-NP-induced apoptosis in CAR cells.

Figure 4.

Effects of caspase-9 and caspase-3 are required for Cur-NP-triggered apoptosis of CAR cells. Effects of (A) caspase-9 and (B) caspase-3 activity on Cur-NP-treated CAR cells. Cells were treated with 10, 20, 40 and 80 μM Cur-NPs and then incubated for 24 h, and the whole-cell lysate was subjected to caspase activity assay. For cell viability, CAR cells were exposed to 25 μM Cur-NPs for 48 h before pretreatment with or without 10 μM of pan-caspase inhibitor (z-VAD-fmk) (C), caspase-9 (z-LEHD-fmk) and caspase-3 inhibitor (z-DEVD-fmk), respectively as described in Materials and methods. The results are shown as mean ± SEM in triplicate by comparing between the treated and untreated control cells. ***p<0.001 compared with the control value.

Cur-NP enhance ROS generation and promote mitochondria-dependent CAR cell apoptosis

We further clarified if oxidative stress regulates Cur-NP-provoked cell death, and our findings demonstrated that Cur-NPs increased ROS levels in CAR cells as shown in Fig. 5A. Results showed that the presence of NAC dramatically protected CAR cells from cell death (Fig. 5B). We further examined the effects of Cur-NPs on mitochondria-dependent signaling in CAR cells. The immunoblot analysis showed that the protein levels of cleaved caspase-3, cleaved caspase-9, cytochrome c, Apaf-1, AIF and Endo G were increased in Cur-NP-treated CAR cells (Fig. 5C). As shown in Fig. 5D, Cur-NP treatment resulted in upregulation of Bax but downregulation of Bcl-2 protein level in treated cells. Thus, we summarize the current understanding in CAR cells that after Cur-NP treatment, cell death is caused through mitochondrial caspase cascade-dependent signals in vitro.

Figure 5.

Effects of Cur-NPs caused reactive oxygen species (ROS) production and intrinsic apoptotic signaling pathways in CAR cells. (A) CAR cells in response to 25 μM Cur-NPs for 0, 3, 6, 12 and 24 h and the reactive oxygen species (ROS) production were analyzed by flow cytometry. (B) For cell viability, CAR cells were exposed to 25 μM Cur-NPs for 48 h before pretreatment with or without 10 mM of antioxidant agent (N-acetylcysteine; NAC), respectively, as described in Materials and methods. Each result is shown as mean ± SEM in triplicate by comparing between the treated and untreated control cells. ***p<0.001 compared with the control value. The effects of Cur-NPs caused protein level change on intrinsic apoptosis in CAR cells. Cells were treated with 40 μM of Cur-NPs for 0, 12, 24, 36 and 48 h then subjected to western blot analysis. The western blot analysis of (C) caspase-3, caspase-9, cytochrome c, Apaf-1, AIF, Endo G and (D) Bax, Bcl-1 expression in CAR cells. The β-actin was detected for equivalent protein loading.

Discussion

Since poor bioavailability is a major drawback of curcumin, various formulation techniques have been utilized to circumvent this pitfall (30,59,60). Use of nanoparticles is one of the means that have been investigated for this purpose. Anand et al pointed out that nanoparticle-based delivery systems are probably suitable for hydrophobic agents to enhance the solubility of poorly aqua-soluble agents like curcumin (61). In a study reported by Yallapu et al, the curcumin-loaded cellulose nanoparticles showed improved anticancer efficacy compared to free curcumin (23,52,62). Anand et al reported that curcumin-loaded PLGA nanoparticle formulation is at least as potent as, or more potent, than curcumin in inducing cancer cell apoptosis, and has enhanced cellular uptake, increased bioactivity in vitro and superior bioavailability in vivo over curcumin (48). The above-mentioned studies all indicate that Cur-NPs possess significantly greater water solubility and systemic bioavailability than free curcumin (23,27,46–48). It motivated us to design and prepare our own water-soluble curcumin nanoparticles (Cur-NPs) (Fig. 1A) which indeed exhibited anticancer properties in CAL27-cisplatin resistant human CAR oral cancer cells. In the present study, curcumin was successfully incorporated (93.7%) into PLGA nanoparticles. The morphology of the obtained particles was examined under TEM. Fig. 1B showed that the produced Cur-NPs are spherical in shape with a smooth surface. Measured with dynamic light scattering (DLS), the size of Cur-NPs was on average 180 nm in diameter (data not shown) which meets the criteria for ‘nanoparticles’.

A recent study by Yin et al demonstrated that their Cur-NPs are effective in inhibiting the growth of human lung cancer with little toxicity to normal tissues in an established A549 transplanted mouse model (63). As shown in Fig. 2A and B, the Cur-NPs used in our study also caused anti-proliferation effects on CAR cells in a dose- and time-dependent manner but little cytotoxicity to the normal human gingival fibroblasts cells (HGF) and normal human oral keratinocyte cells (OK) (Fig. 2C and D). The results suggested that Cur-NPs could represent promising candidates as a safe anti-oral cancer drug.

Overexpression of MDR1 is one of the main reasons for multidrug resistance to chemotherapeutic agents. Misra et al combined doxorubicin and curcumin in PLGA-nanoparticles and found this approach enhanced the cytotoxicity by promoting the apoptotic response in multidrug-resistant K562 leukemia cells (64). Doxorubicin-curcumin composite nanoparticle formulation inhibited the MDR and caused striking growth inhibition both in vitro and in vivo in several models of DOX-resistant myeloma, acute leukemia, prostate cancer and ovarian cancer cells (65). In our preliminary studies, real-time PCR array analysis revealed higher level of MDR1 expression (ABCB1) in untreated CAR cells than in untreated CAL27 oral cancer cells (data not shown). The results in the present research showed that the mRNA and protein level of MDR1 were both decreased in CAR cells (Fig. 3C and D) after treatment with Cur-NPs. The retention rate of Calcein-AM within Cur-NPs-treated CAR cells (Fig. 3E) indicated that Cur-NPs could reduce the interaction between drugs and multidrug resistance protein in a dose-dependent manner. The data suggested that Cur-NPs induce CAR cell apoptosis via suppressing the expression of multidrug resistance protein due to more retention of the therapeutic medicine within the cells. Some other studies also reported that curcumin downregulates P-glycoprotein (P-gp) expression in drug-resistant SKOV3 human ovarian adenocarcinoma cells through inhibiting NF-κB activity (66,67). Punfa et al demonstrated that targeting P-gp on the cell surface membrane of KB-V1 cancer cells (higher expression of P-gp) with Cur-NPs-APgp enhanced the cellular uptake and cytotoxicity of curcumin (68). These results suggested MDR1 or P-gp on the cell surface membrane is the major target of Cur-NPs.

This is the first study investigating the anti-head and neck squamous cell carcinoma effects of Cur-NPs on human CAL27-cisplatin resistant human oral cancer cells (CAR cells). Our results showed that Cur-NPs inhibited CAR cell growth and induced apoptotic cell death in a concentration and time-dependent manner. Fig. 4A and B showed Cur-NPs provoked cell apoptosis through the activation of caspase-9 and caspase-3, whereas a pretreatment of pan-caspase, caspase-9 and caspase-3 inhibitors led to increased viable CAR cells compared to the un-pretreated group (Fig. 4C and D). The results suggested that Cur-NPs-induced apoptosis in CAR cells might be carried out through the intrinsic signaling pathway, or mitochdrial-dependent pathway, which has connection with the activation of caspase-9 and caspase-3.

Various studies reported that curcumin induces apoptosis through intrinsic signaling pathways by depolarizing the mitochondrial membrane and triggering the release of cyto-chrome c (69–71). Dilnawaz et al utilized curcumin-loaded magnetic nanoparticle (Cur-MNP and Tf-Cur-MNP) formulations to address K562 cells and induced a rapid decrease in mitochondrial membrane potential with release of cyto-chrome c into cytosol, followed by cleavage of caspase-9 and caspase-3 (72). The result in Fig. 5A shows Cur-NPs provoked intrinsic apoptotic signaling in CAR cells through the production of reactive oxygen species (ROS). More viable CAR cells were preserved when being pretreated with antioxidant agent (N-acetylcysteine; NAC) compared to the un-pretreated group (Fig. 5B). Results of western blot analysis indicated that Cur-NPs elevated the protein level of active form of caspase-3 and caspase-9 (Fig. 5C), as well as that of cytochrome c, Apaf-1, AIF (Fig. 5C) and pro-apoptotic protein Bax (Fig. 5D) while Bcl-2 expression was suppressed (Fig. 5D). Our results suggested that Cur-NP-induced apoptosis could be carried out through the reactive oxygen species (ROS) production.

In summary, Cur-NPs induce cell apoptosis in CAL27-cisplatin resistance human oral cancer cells (CAR cells) and inhibit cell growth but possess little cytotoxicity to normal human gingival fibroblasts cells (HGF) and normal human oral keratinocyte cells (OK). The findings suggest that Cur-NPs trigger apoptotic cell death through regulating the function of MDR1 and the production of reactive oxygen species (ROS), and the activation of caspase-9 and caspase-3 connected to intrinsic signaling pathway is the major pharmacologic action of Cur-NPs. Cur-NPs show promise for development as a novel medicine against cisplatin resistant human oral cancer.

Acknowledgements

This study was supported in part by a research grant from the China Medical University (CMU101-N2-07) to S.-F.P.; and in part by a grant from the National Science Council of Taiwan to T.-S.W. and (102-2320-B-039-028-MY3) awarded to J.-S. Yang.

References

1. 

Nagadia R, Pandit P, Coman WB, Cooper-White J and Punyadeera C: miRNAs in head and neck cancer revisited. Cell Oncol (Dordr). 36:1–7. 2013. View Article : Google Scholar : PubMed/NCBI

2. 

Duvvuri U and Myers JN: Cancer of the head and neck is the sixth most common cancer worldwide. Curr Probl Surg. 46:114–117. 2009.PubMed/NCBI

3. 

Chen YJ, Chang JT, Liao CT, et al: Head and neck cancer in the betel quid chewing area: recent advances in molecular carcinogenesis. Cancer Sci. 99:1507–1514. 2008. View Article : Google Scholar : PubMed/NCBI

4. 

Chang PM, Chen PM, Chu PY, et al: Effectiveness of pharmacokinetic modulating chemotherapy combined with cisplatin as induction chemotherapy in resectable locally advanced head and neck cancer: phase II study. Cancer Chemother Pharmacol. 63:9–17. 2008. View Article : Google Scholar : PubMed/NCBI

5. 

Chen MK, Su SC, Lin CW, Tsai CM, Yang SF and Weng CJ: Cathepsin B SNPs elevate the pathological development of oral cancer and raise the susceptibility to carcinogen-mediated oral cancer. Hum Genet. 131:1861–1868. 2012. View Article : Google Scholar : PubMed/NCBI

6. 

Lou JL, Guo L, Zhao JQ and Wang SY: Squamous cell carcinoma of cervical lymph nodes from an unknown primary site: a retrospective analysis of treatment strategies and prognosis. Zhonghua Er Bi Yan Hou Tou Jing Wai Ke Za Zhi. 48:32–36. 2013.(In Chinese).

7. 

Bose P, Brockton NT and Dort JC: Head and neck cancer: from anatomy to biology. Int J Cancer. Feb 18–2013.(Epub ahead of print).

8. 

Kubicek GJ, Kimler BF, Wang F, Reddy EK, Girod DA and Williamson SK: Chemotherapy in head and neck cancer: clinical predictors of tolerance and outcomes. Am J Clin Oncol. 34:380–384. 2011. View Article : Google Scholar : PubMed/NCBI

9. 

Rades D, Ulbricht T, Hakim SG and Schild SE: Cisplatin superior to carboplatin in adjuvant radiochemotherapy for locally advanced cancers of the oropharynx and oral cavity. Strahlenther Onkol. 188:42–48. 2012. View Article : Google Scholar : PubMed/NCBI

10. 

Mandic R, Rodgarkia-Dara CJ, Krohn V, Wiegand S, Grenman R and Werner JA: Cisplatin resistance of the HNSCC cell line UT-SCC-26A can be overcome by stimulation of the EGF-receptor. Anticancer Res. 29:1181–1187. 2009.PubMed/NCBI

11. 

Sunwoo JB: A cisplatin-resistant subpopulation of mesenchymal-like cells in head and neck squamous cell carcinoma. Cell Cycle. 10:2834–2835. 2011. View Article : Google Scholar : PubMed/NCBI

12. 

Vyas A, Dandawate P, Padhye S, Ahmad A and Sarkar F: Perspectives on new synthetic curcumin analogs and their potential anticancer properties. Curr Pharm Des. 19:2047–2069. 2013.PubMed/NCBI

13. 

Baliga MS, Joseph N, Venkataranganna MV, Saxena A, Ponemone V and Fayad R: Curcumin, an active component of turmeric in the prevention and treatment of ulcerative colitis: preclinical and clinical observations. Food Funct. 3:1109–1117. 2012. View Article : Google Scholar : PubMed/NCBI

14. 

Hanai H and Sugimoto K: Curcumin has bright prospects for the treatment of inflammatory bowel disease. Curr Pharm Des. 15:2087–2094. 2009. View Article : Google Scholar : PubMed/NCBI

15. 

Li Y and Wang P: Neuroprotective effects of curcumin. Zhongguo Zhong Yao Za Zhi. 34:3173–3175. 2009.(In Chinese).

16. 

Shishodia S: Molecular mechanisms of curcumin action: gene expression. Biofactors. 39:37–55. 2013. View Article : Google Scholar : PubMed/NCBI

17. 

Noorafshan A and Ashkani-Esfahani S: A review of therapeutic effects of curcumin. Curr Pharm Des. 19:2032–2046. 2013.PubMed/NCBI

18. 

Zhang X, Chen LX, Ouyang L, Cheng Y and Liu B: Plant natural compounds: targeting pathways of autophagy as anti-cancer therapeutic agents. Cell Prolif. 45:466–476. 2012. View Article : Google Scholar : PubMed/NCBI

19. 

Ye MX, Li Y, Yin H and Zhang J: Curcumin: updated molecular mechanisms and intervention targets in human lung cancer. Int J Mol Sci. 13:3959–3978. 2012. View Article : Google Scholar : PubMed/NCBI

20. 

Saha S, Adhikary A, Bhattacharyya P, Das T and Sa G: Death by design: where curcumin sensitizes drug-resistant tumours. Anticancer Res. 32:2567–2584. 2012.PubMed/NCBI

21. 

Gupta SC, Kismali G and Aggarwal BB: Curcumin, a component of turmeric: from farm to pharmacy. Biofactors. 39:2–13. 2013. View Article : Google Scholar : PubMed/NCBI

22. 

Gao W, Chan JY, Wei WI and Wong TS: Anti-cancer effects of curcumin on head and neck cancers. Anticancer Agents Med Chem. 12:1110–1116. 2012. View Article : Google Scholar : PubMed/NCBI

23. 

Yallapu MM, Jaggi M and Chauhan SC: Curcumin nanoformulations: a future nanomedicine for cancer. Drug Discov Today. 17:71–80. 2012. View Article : Google Scholar : PubMed/NCBI

24. 

Varinska L, Mirossay L, Mojzisova G and Mojzis J: Antiangogenic effect of selected phytochemicals. Pharmazie. 65:57–63. 2010.PubMed/NCBI

25. 

Basnet P and Skalko-Basnet N: Curcumin: an anti-inflammatory molecule from a curry spice on the path to cancer treatment. Molecules. 16:4567–4598. 2011. View Article : Google Scholar : PubMed/NCBI

26. 

Haddad M, Sauvain M and Deharo E: Curcuma as a parasiticidal agent: a review. Planta Med. 77:672–678. 2011. View Article : Google Scholar : PubMed/NCBI

27. 

Ji JL, Huang XF and Zhu HL: Curcumin and its formulations: potential anti-cancer agents. Anticancer Agents Med Chem. 12:210–218. 2012. View Article : Google Scholar : PubMed/NCBI

28. 

Shehzad A, Wahid F and Lee YS: Curcumin in cancer chemoprevention: molecular targets, pharmacokinetics, bioavailability, and clinical trials. Arch Pharm (Weinheim). 343:489–499. 2010. View Article : Google Scholar : PubMed/NCBI

29. 

Epstein J, Sanderson IR and Macdonald TT: Curcumin as a therapeutic agent: the evidence from in vitro, animal and human studies. Br J Nutr. 103:1545–1557. 2010. View Article : Google Scholar : PubMed/NCBI

30. 

Yallapu MM, Ebeling MC, Khan S, et al: Novel curcumin loaded magnetic nanoparticles for pancreatic cancer treatment. Mol Cancer Ther. May 23–2013.(Epub ahead of print).

31. 

Pawar YB, Purohit H, Valicherla GR, et al: Novel lipid based oral formulation of curcumin: development and optimization by design of experiments approach. Int J Pharm. 436:617–623. 2012. View Article : Google Scholar : PubMed/NCBI

32. 

Gupta NK and Dixit VK: Bioavailability enhancement of curcumin by complexation with phosphatidyl choline. J Pharm Sci. 100:1987–1995. 2011. View Article : Google Scholar : PubMed/NCBI

33. 

Verderio P, Bonetti P, Colombo M, Pandolfi L and Prosperi D: Intracellular drug release from curcumin-loaded PLGA nanoparticles induces G2/M block in breast cancer cells. Biomacromolecules. 14:672–682. 2013. View Article : Google Scholar : PubMed/NCBI

34. 

Tsai YM, Chang-Liao WL, Chien CF, Lin LC and Tsai TH: Effects of polymer molecular weight on relative oral bioavailability of curcumin. Int J Nanomed. 7:2957–2966. 2012. View Article : Google Scholar : PubMed/NCBI

35. 

Doggui S, Sahni JK, Arseneault M, Dao L and Ramassamy C: Neuronal uptake and neuroprotective effect of curcumin-loaded PLGA nanoparticles on the human SK-N-SH cell line. J Alzheimers Dis. 30:377–392. 2012.PubMed/NCBI

36. 

Das M and Sahoo SK: Folate decorated dual drug loaded nanoparticle: role of curcumin in enhancing therapeutic potential of nutlin-3a by reversing multidrug resistance. PLoS One. 7:e329202012. View Article : Google Scholar : PubMed/NCBI

37. 

Xie X, Tao Q, Zou Y, et al: PLGA nanoparticles improve the oral bioavailability of curcumin in rats: characterizations and mechanisms. J Agric Food Chem. 59:9280–9289. 2011. View Article : Google Scholar : PubMed/NCBI

38. 

Bansal SS, Goel M, Aqil F, Vadhanam MV and Gupta RC: Advanced drug delivery systems of curcumin for cancer chemoprevention. Cancer Prev Res (Phila). 4:1158–1171. 2011. View Article : Google Scholar : PubMed/NCBI

39. 

Jain AK, Das M, Swarnakar NK and Jain S: Engineered PLGA nanoparticles: an emerging delivery tool in cancer therapeutics. Crit Rev Ther Drug Carrier Syst. 28:1–45. 2011. View Article : Google Scholar : PubMed/NCBI

40. 

Berginc K, Trontelj J, Basnet NS and Kristl A: Physiological barriers to the oral delivery of curcumin. Pharmazie. 67:518–524. 2012.PubMed/NCBI

41. 

Shukla S, Zaher H, Hartz A, Bauer B, Ware JA and Ambudkar SV: Curcumin inhibits the activity of ABCG2/BCRP1, a multidrug resistance-linked ABC drug transporter in mice. Pharm Res. 26:480–487. 2009. View Article : Google Scholar : PubMed/NCBI

42. 

Yue GG, Cheng SW, Yu H, et al: The role of turmerones on curcumin transportation and P-glycoprotein activities in intestinal Caco-2 cells. J Med Food. 15:242–252. 2012. View Article : Google Scholar : PubMed/NCBI

43. 

Zhou S, Lim LY and Chowbay B: Herbal modulation of P-glycoprotein. Drug Metab Rev. 36:57–104. 2004. View Article : Google Scholar

44. 

Gosepath EM, Eckstein N, Hamacher A, et al: Acquired cisplatin resistance in the head-neck cancer cell line Cal27 is associated with decreased DKK1 expression and can partially be reversed by overexpression of DKK1. Int J Cancer. 123:2013–2019. 2008. View Article : Google Scholar : PubMed/NCBI

45. 

Shih YH, Chang KW, Hsia SM, et al: In vitro antimicrobial and anticancer potential of hinokitiol against oral pathogens and oral cancer cell lines. Microbiol Res. 168:254–262. 2013. View Article : Google Scholar : PubMed/NCBI

46. 

Mathew A, Fukuda T, Nagaoka Y, et al: Curcumin loaded-PLGA nanoparticles conjugated with Tet-1 peptide for potential use in Alzheimer’s disease. PLoS One. 7:e326162012.PubMed/NCBI

47. 

Luz PP, Magalhaes LG, Pereira AC, Cunha WR, Rodrigues V and Andrade ESML: Curcumin-loaded into PLGA nanoparticles: preparation and in vitro schistosomicidal activity. Parasitol Res. 110:593–598. 2012. View Article : Google Scholar : PubMed/NCBI

48. 

Anand P, Nair HB, Sung B, et al: Design of curcumin-loaded PLGA nanoparticles formulation with enhanced cellular uptake, and increased bioactivity in vitro and superior bioavailability in vivo. Biochem Pharmacol. 79:330–338. 2010. View Article : Google Scholar : PubMed/NCBI

49. 

Koppolu B, Rahimi M, Nattama S, Wadajkar A and Nguyen KT: Development of multiple-layer polymeric particles for targeted and controlled drug delivery. Nanomedicine. 6:355–361. 2010. View Article : Google Scholar : PubMed/NCBI

50. 

Chang CM, Chang PY, Tu MG, et al: Epigallocatechin gallate sensitizes CAL-27 human oral squamous cell carcinoma cells to the anti-metastatic effects of gefitinib (Iressa) via synergistic suppression of epidermal growth factor receptor and matrix metalloproteinase-2. Oncol Rep. 28:1799–1807. 2012.

51. 

Tsai SC, Lu CC, Lee CY, et al: AKT serine/threonine protein kinase modulates bufalin-triggered intrinsic pathway of apoptosis in CAL 27 human oral cancer cells. Int J Oncol. 41:1683–1692. 2012.PubMed/NCBI

52. 

Yallapu MM, Othman SF, Curtis ET, et al: Curcumin-loaded magnetic nanoparticles for breast cancer therapeutics and imaging applications. Int J Nanomed. 7:1761–1779. 2012.PubMed/NCBI

53. 

Tsai SC, Yang JS, Peng SF, et al: Bufalin increases sensitivity to AKT/mTOR-induced autophagic cell death in SK-HEP-1 human hepatocellular carcinoma cells. Int J Oncol. 41:1431–1442. 2012.PubMed/NCBI

54. 

Mozaffarieh M, Konieczka K, Hauenstein D, Schoetzau A and Flammer J: Half a pack of cigarettes a day more than doubles DNA breaks in circulating leukocytes. Tob Induc Dis. 8:142010. View Article : Google Scholar : PubMed/NCBI

55. 

Kuo TC, Yang JS, Lin MW, et al: Emodin has cytotoxic and protective effects in rat C6 glioma cells: roles of Mdr1a and nuclear factor kappaB in cell survival. J Pharmacol Exp Ther. 330:736–744. 2009. View Article : Google Scholar : PubMed/NCBI

56. 

Huang WW, Tsai SC, Peng SF, et al: Kaempferol induces autophagy through AMPK and AKT signaling molecules and causes G2/M arrest via downregulation of CDK1/cyclin B in SK-HEP-1 human hepatic cancer cells. Int J Oncol. 42:2069–2077. 2013.PubMed/NCBI

57. 

Lan YH, Chiang JH, Huang WW, et al: Activations of both extrinsic and intrinsic pathways in HCT 116 human colorectal cancer cells contribute to apoptosis through p53-mediated ATM/Fas signaling by Emilia sonchifolia extract, a folklore medicinal plant. Evid Based Complement Alternat Med. 2012:1781782012.PubMed/NCBI

58. 

Lin C, Tsai SC, Tseng MT, et al: AKT serine/threonine protein kinase modulates baicalin-triggered autophagy in human bladder cancer T24 cells. Int J Oncol. 42:993–1000. 2013.

59. 

Taurin S, Nehoff H, Diong J, Larsen L, Rosengren RJ and Greish K: Curcumin-derivative nanomicelles for the treatment of triple negative breast cancer. J Drug Target. May 16–2013.(Epub ahead of print).

60. 

Yen FL, Wu TH, Tzeng CW, Lin LT and Lin CC: Curcumin nanoparticles improve the physicochemical properties of curcumin and effectively enhance its antioxidant and antihepatoma activities. J Agric Food Chem. 58:7376–7382. 2010. View Article : Google Scholar : PubMed/NCBI

61. 

Anand P, Kunnumakkara AB, Newman RA and Aggarwal BB: Bioavailability of curcumin: problems and promises. Mol Pharm. 4:807–818. 2007. View Article : Google Scholar : PubMed/NCBI

62. 

Yallapu MM, Dobberpuhl MR, Maher DM, Jaggi M and Chauhan SC: Design of curcumin loaded cellulose nanoparticles for prostate cancer. Curr Drug Metab. 13:120–128. 2012. View Article : Google Scholar : PubMed/NCBI

63. 

Yin HT, Zhang DG, Wu XL, Huang XE and Chen G: In vivo evaluation of curcumin-loaded nanoparticles in a A549 xenograft mice model. Asian Pac J Cancer Prev. 14:409–412. 2013. View Article : Google Scholar : PubMed/NCBI

64. 

Misra R and Sahoo SK: Coformulation of doxorubicin and curcumin in poly(D,L-lactide-co-glycolide) nanoparticles suppresses the development of multidrug resistance in K562 cells. Mol Pharm. 8:852–866. 2011. View Article : Google Scholar : PubMed/NCBI

65. 

Pramanik D, Campbell NR, Das S, et al: A composite polymer nanoparticle overcomes multidrug resistance and ameliorates doxorubicin-associated cardiomyopathy. Oncotarget. 3:640–650. 2012.

66. 

Ganta S, Devalapally H and Amiji M: Curcumin enhances oral bioavailability and anti-tumor therapeutic efficacy of paclitaxel upon administration in nanoemulsion formulation. J Pharm Sci. 99:4630–4641. 2010. View Article : Google Scholar : PubMed/NCBI

67. 

Ganta S and Amiji M: Coadministration of Paclitaxel and curcumin in nanoemulsion formulations to overcome multidrug resistance in tumor cells. Mol Pharm. 6:928–939. 2009. View Article : Google Scholar : PubMed/NCBI

68. 

Punfa W, Yodkeeree S, Pitchakarn P, Ampasavate C and Limtrakul P: Enhancement of cellular uptake and cytotoxicity of curcumin-loaded PLGA nanoparticles by conjugation with anti-P-glycoprotein in drug resistance cancer cells. Acta Pharmacol Sin. 33:823–831. 2012. View Article : Google Scholar : PubMed/NCBI

69. 

Cort A, Ozdemir E, Timur M and Ozben T: Effects of curcumin on bleomycininduced oxidative stress in malignant testicular germ cell tumors. Mol Med Rep. 6:860–866. 2012.PubMed/NCBI

70. 

Misra J, Chanda D, Kim DK, et al: Curcumin differentially regulates endoplasmic reticulum stress through transcriptional corepressor SMILE (small heterodimer partner-interacting leucine zipper protein)-mediated inhibition of CREBH (cAMP responsive element-binding protein H). J Biol Chem. 286:41972–41984. 2011. View Article : Google Scholar

71. 

Wahl H, Tan L, Griffith K, Choi M and Liu JR: Curcumin enhances Apo2L/TRAIL-induced apoptosis in chemoresistant ovarian cancer cells. Gynecol Oncol. 105:104–112. 2007. View Article : Google Scholar : PubMed/NCBI

72. 

Dilnawaz F, Singh A and Sahoo SK: Transferrin-conjugated curcumin-loaded superparamagnetic iron oxide nanoparticles induce augmented cellular uptake and apoptosis in K562 cells. Acta Biomater. 8:704–719. 2012. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Chang P, Peng S, Lee C, Lu C, Tsai S, Shieh T, Wu T, Tu M, Chen MY, Yang J, Yang J, et al: Curcumin-loaded nanoparticles induce apoptotic cell death through regulation of the function of MDR1 and reactive oxygen species in cisplatin-resistant CAR human oral cancer cells. Int J Oncol 43: 1141-1150, 2013.
APA
Chang, P., Peng, S., Lee, C., Lu, C., Tsai, S., Shieh, T. ... Yang, J. (2013). Curcumin-loaded nanoparticles induce apoptotic cell death through regulation of the function of MDR1 and reactive oxygen species in cisplatin-resistant CAR human oral cancer cells. International Journal of Oncology, 43, 1141-1150. https://doi.org/10.3892/ijo.2013.2050
MLA
Chang, P., Peng, S., Lee, C., Lu, C., Tsai, S., Shieh, T., Wu, T., Tu, M., Chen, M. Y., Yang, J."Curcumin-loaded nanoparticles induce apoptotic cell death through regulation of the function of MDR1 and reactive oxygen species in cisplatin-resistant CAR human oral cancer cells". International Journal of Oncology 43.4 (2013): 1141-1150.
Chicago
Chang, P., Peng, S., Lee, C., Lu, C., Tsai, S., Shieh, T., Wu, T., Tu, M., Chen, M. Y., Yang, J."Curcumin-loaded nanoparticles induce apoptotic cell death through regulation of the function of MDR1 and reactive oxygen species in cisplatin-resistant CAR human oral cancer cells". International Journal of Oncology 43, no. 4 (2013): 1141-1150. https://doi.org/10.3892/ijo.2013.2050
Copy and paste a formatted citation
x
Spandidos Publications style
Chang P, Peng S, Lee C, Lu C, Tsai S, Shieh T, Wu T, Tu M, Chen MY, Yang J, Yang J, et al: Curcumin-loaded nanoparticles induce apoptotic cell death through regulation of the function of MDR1 and reactive oxygen species in cisplatin-resistant CAR human oral cancer cells. Int J Oncol 43: 1141-1150, 2013.
APA
Chang, P., Peng, S., Lee, C., Lu, C., Tsai, S., Shieh, T. ... Yang, J. (2013). Curcumin-loaded nanoparticles induce apoptotic cell death through regulation of the function of MDR1 and reactive oxygen species in cisplatin-resistant CAR human oral cancer cells. International Journal of Oncology, 43, 1141-1150. https://doi.org/10.3892/ijo.2013.2050
MLA
Chang, P., Peng, S., Lee, C., Lu, C., Tsai, S., Shieh, T., Wu, T., Tu, M., Chen, M. Y., Yang, J."Curcumin-loaded nanoparticles induce apoptotic cell death through regulation of the function of MDR1 and reactive oxygen species in cisplatin-resistant CAR human oral cancer cells". International Journal of Oncology 43.4 (2013): 1141-1150.
Chicago
Chang, P., Peng, S., Lee, C., Lu, C., Tsai, S., Shieh, T., Wu, T., Tu, M., Chen, M. Y., Yang, J."Curcumin-loaded nanoparticles induce apoptotic cell death through regulation of the function of MDR1 and reactive oxygen species in cisplatin-resistant CAR human oral cancer cells". International Journal of Oncology 43, no. 4 (2013): 1141-1150. https://doi.org/10.3892/ijo.2013.2050
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team