Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
August-2015 Volume 47 Issue 2

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
August-2015 Volume 47 Issue 2

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

EGFR and HER2 signals play a salvage role in MEK1-mutated gastric cancer after MEK inhibition

  • Authors:
    • Takuro Mizukami
    • Yosuke Togashi
    • Shunsuke Sogabe
    • Eri Banno
    • Masato Terashima
    • Marco A De Velasco
    • Kazuko Sakai
    • Yoshihiko Fujita
    • Shuta Tomida
    • Takako Eguchi Nakajima
    • Narikazu Boku
    • Kazuto Nishio
  • View Affiliations / Copyright

    Affiliations: Department of Genome Biology, Kinki University School of Medicine, Osaka-Sayama, Osaka, Japan, Department of Clinical Oncology, St. Marianna University School of Medicine, Kawasaki, Kanagawa, Japan
  • Pages: 499-505
    |
    Published online on: June 16, 2015
       https://doi.org/10.3892/ijo.2015.3050
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Since the prognosis of unresectable advanced gastric cancer remains poor, novel therapeutic strategies are needed. Somatic MEK1 gene mutations have been reported as oncogenic activating mutations in gastric cancer, and MEK inhibitors can be effective against such gastric cancers. In the present study, however, activated EGFR and HER2 signals after treatment with a MEK inhibitor (trametinib) were found in a MEK1-mutated gastric cancer cell line (OCUM-1 cell line) using a phospho-receptor tyrosine kinase array. The phosphorylation of EGFR and HER2 reactivated ERK1/2, which had been inhibited by trametinib, and EGF stimulation led to resistance to trametinib in this cell line. Lapatinib, an EGFR and an HER2 inhibitor, reversed the activation of ERK1/2 by inhibiting the phosphorylation of EGFR and HER2 and cancelled the resistance. The combination of trametinib and lapatinib synergistically inhibited the cell growth of the OCUM-1 cell line and strongly induced apoptosis by inhibiting the activated EGFR and HER2 signals. These results suggest that the EGFR and HER2 signals play a salvage role and are related to resistance to MEK inhibitors in MEK1‑mutated gastric cancer. Moreover, combination therapy with trametinib and lapatinib can exhibit a synergistic effect and may contribute to overcoming the resistance to MEK inhibitors.

Introduction

Gastric cancer (GC) is one of the most common malignant tumors and the third most common cause of death from malignancies worldwide (1). Despite intensive investigations of anticancer treatments for GC, the prognosis of unresectable advanced or recurrent GC remains poor. The median overall survival of GC patients has reached only ~1 year using conventional cytotoxic chemotherapy (2–4). Trastuzumab, a monoclonal antibody against human epidermal growth factor receptor (EGFR) 2 (HER2), used in combination with chemotherapy has shown a survival benefit when used as a first-line treatment in patients with HER2-positive advanced GC (5). However, HER2 overexpression has only been reported in 13–23% of GC cases (6–8). Fibroblast growth factor receptor 2 amplification, MET amplification and RhoA mutations have been anticipated as new molecular targets in GC, but these aberrations are relatively infrequent (9–12). Therefore, new therapeutic modalities are still needed.

The mitogen-activated protein kinase (MAPK) signal pathway cascade and its downstream factors promote cancer cell proliferation, differentiation and survival. The three-tiered kinase cascade consisting of RAF, mitogen-activated protein kinase kinase (MEK), and extracellular signal-regulated kinase (ERK) is frequently dysregulated in malignancies as a result of activating mutations in the upstream RAS (KRAS, NRAS and HRAS) (13,14). The activating BRAF mutation has been detected in a variety of human cancers (15), and the success of RAF inhibitors in BRAF-mutated melanoma has revealed a new modality and has substantiated the contribution of the MAPK signal to carcinogenesis (16,17). Somatic oncogenic MEK1 mutations have also been identified in several human malignancies (18–21). In addition, our previous study demonstrated that MEK1 mutations in poorly differentiated GC cell lines that are hypersensitive to MEK inhibitors have transformational abilities and that the growth of these cancer cells is dependent on these mutations (22). Considering the addiction of cancer cells to active MEK1 mutations for proliferation, GC with such oncogenic MEK1 mutations might be suitable for targeted therapy with MEK inhibitors.

A persistent problem is the development of resistance to molecular-targeted therapies. A series of resistance mechanisms for MEK inhibition that operate ERK-dependently or ERK-independently have been reported, including MEK mutations, elevated RAS or RAF protein levels, and the activation of an alternative PI3K/AKT or STAT3 pathway (23–25). Currently, the phosphorylation of EGFR after the inhibition of the MAPK signal has been suggested as another potential mechanism responsible for the resistance to MEK inhibition in various cancers, and combination therapy with EGFR inhibitors yielded synergistic effects (26,27). In this study, we observed the phosphorylation of EGFR and HER2 after MEK inhibition in a MEK1-mutated GC cell line. Then, the relevancy of this mechanism to MEK inhibitor resistance was validated, and combinations with other tyrosine kinase inhibitors were tested to develop new therapeutic possibilities.

Materials and methods

Reagents and ligand

Trametinib (GSK1120212) and lapatinib (GW572016) were purchased from Selleck Chemicals (Houston, TX, USA) and were dissolved in dimethyl sulfoxide (DMSO) for the in vitro experiments. Recombinant human epidermal growth factor (EGF) was obtained from R&D Systems (Minneapolis, MN, USA) and was constituted in sterile phosphate-buffered saline (PBS).

Antibodies

Rabbit-antibodies specific for ERK1/2, EGFR, HER2, phospho-ERK1/2 (pERK1/2), phospho-EGFR (pEGFR), phospho-HER2 (pHER2), poly (ADP-ribose) polymerase (PARP), caspase-3, cleaved PARP (cPARP), cleaved caspase-3 (cCaspase-3), and β-actin were obtained from Cell Signaling Technology (Beverly, MA, USA).

Cell cultures

A poorly differentiated GC cell line harboring the MEK1 Q56P mutation, OCUM-1, was propagated in RPMI-1640 (Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Gibco BRL, Grand Island, NY, USA) and 1% Penicillin-Streptomycin Mixed Solution (Nacalai Tesque, Kyoto, Japan) in a humidified atmosphere of 5% CO2 at 37°C.

Human phospho-receptor tyrosine kinase (RTK) array

The screening of 49 phosphorylated tyrosine kinases in the OCUM-1 cell line was performed using the Human Phospho-RTK Array kit (R&D Systems). Whole lyses of OCUM-1 cells incubated in the absence (DMSO) or presence of 1 nM trametinib for 72 h were compared in accordance with the manufacturer’s recommendation. Protein detection was accomplished using an anti-phospho-tyrosine-HRP detection antibody and an enhanced chemiluminescence system (Image Quant LAS4000; GE Healthcare Life Science, Buckinghamshire, UK).

Growth inhibition assay

The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used to evaluate the growth inhibitory effect of the drugs, as previously described (28). When the effect of EGF was evaluated, 1% FBS was used.

Real-time reverse transcription polymerase chain reaction (RT-PCR)

A total of 1 μg of RNA was isolated from the cells using ISOGEN reagent (Nippon Gene, Tokyo, Japan) and then converted to cDNA using GeneAmp RNA-PCR kit (Applied Biosystems, Foster City, CA USA). Real-time PCR was performed using SYBR Premix Ex Taq and Thermal Cycler Dice (Takara, Shiga, Japan), as described previously (29). The glyceraldehyde 3-phosphate dehydrogenase (GAPD, NM_002046) gene was used to normalize the expression levels in subsequent quantitative analyses. To amplify the target genes encoding amphiregulin (AREG), EGF, heparin-binding EGF-like growth factor (HB-EGF), neuregulin 1 (NRG1), transforming growth factor α (TGFA), EGFR, HER2, HER3, and HER4 (AREG, EGF, HB-EGF, NRG1, TGFA, EGFR, ERBB2, ERBB3 and ERBB4 genes, respectively), the following primers were used: AREG-F, GTCGCTCTTGATAC TCGGCTCAG; AREG-R, TCCCAGAGTAGGTGTCATTG AGGTC; EGF-F, CAACCAGTGGCTGGTGAGGA; EGF-R, GAGCCCTTATCACTGGATACTGGAA; HB-EGF-F, CAA GGTGATTTCAGACTGCAGAGG; HB-EGF-R, TTTGGCA CTTGAAGGCTCTGG; NRG1-F, GCCAGGAATCGGCTG CAGGT; NRG1-R, AGCCAGTGATGCT TTGTTAATGCGA; TGFA-F, CTTTGGAAACCAGCAGGTCTGA; TGFA-R, CCCAAATAAGCCAGGCTGTTCTA; EGFR-F, CATCCA GGCCCAACTGTGAG; EGFR-R, CAGTGGAAGCCTT GAAGCAGAA; ERBB2-F, TGGGAGCCTGGCATTTCTG; E R BB2-R, CG G CCATG C TGAGATGTATAG GTA; ERBB3-F, GGGAGCATTTAATGGCAGCTA; ERBB3-R, GAATGGAATTGTCTGGGACTGG; ERBB4-F, GCAGCT AACTTTGAATGCCTGTCTC; ERBB4-R, GCAGCTA ACTTTGAATGCCTGTCTC; GAPD-F, GCACCGTCAAG GCTGAGAAC; and GAPD-R, ATGGTGGTGAAGACG CCAGT.

Western blot analysis

The western blot analysis was performed as described previously (28). Briefly, subconfluent cells were washed with cold PBS and harvested with Lysis A buffer containing 1% Triton X-100, 20 mM Tris-HCl (pH 7.0), 5 mM EDTA, 50 mM sodium chloride, 10 mM sodium pyrophosphate, 50 mM sodium fluoride, 1 mM sodium orthovanadate, and a protease inhibitor mix, Complete™ (Roche Diagnostics). Whole-cell lyses were separated using SDS-PAGE and were blotted onto a polyvinylidene fluoride membrane. After blocking with 3% bovine serum albumin in a TBS buffer (pH 8.0) with 0.1% Tween-20, the membrane was probed with the primary antibody. After rinsing twice with TBS buffer, the membrane was incubated with a horseradish peroxidase-conjugated secondary antibody and washed, followed by visualization using an ECL detection system and LAS-4000. When the cells were stimulated using EGF, the cells were incubated with 1% FBS medium.

Statistical analysis

The results are shown as the mean value ± standard deviation (SD) for three replicate independent experiments. The statistical analyses were performed using the Student’s t-test (two-tailed). A P-value <0.05 was considered statistically significant. The statistical analyses were two-tailed and were performed using Microsoft Excel (Microsoft, Redmond, WA, USA).

Results

MEK inhibition led to the phosphorylation of EGFR and HER2 in the MEK1-mutated OCUM-1 cell line

To address the phosphorylation of RTK after MEK inhibition, we used a phospho-RTK array. The arrangement of the RTK array is summarized in Fig. 1B. The phosphorylation levels of EGFR and HER2 were elevated at 72 h after treatment with a MEK inhibitor (trametinib) (Fig. 1A). Next, to validate the results of the RTK array, we evaluated the phosphorylation level of EGFR and HER2 using a western blot analysis. In addition to the inhibitory effect on the ERK signal, trametinib led to the activation of EGFR and HER2 signals similar to the results of the RTK array. In addition, the phosphorylation of ERK1/2, which had been inhibited by trametinib, was reactivated following the activation of the EGFR and HER2 signals (Fig. 2). These results suggest that the EGFR and HER2 signals are activated under MEK inhibition in MEK1-mutated GC. To investigate the mechanism responsible for the activation of the EGFR and HER2 signals, real-time RT-PCR was performed. However, no significant changes in the mRNA expression levels of the molecules relative to the EGFR and HER2 signals were observed (AREG, EGF, HB-EGF, NRG1, TGFA, EGFR, HER2, HER3 and HER4; data not shown).

Figure 1

Phosphorylation of RTKs after MEK inhibition in the OCUM-1 cell line. (A) Phospho-RTKs in MEK1-mutated OCUM-1 cells incubated in the absence (DMSO) or presence of 1 nM of trametinib for 72 h were compared using a human phospho-RTK array. Each pair of horizontal spots represents one RTK. The densities of two pairs of spots, representing the phosphorylation levels of EGFR and HER2, were greatly increased after MEK inhibition with trametinib. (B) Arrangement of phospho-RTK array. The paired spots in 3 of the 4 corners are phosphorylated tyrosine controls used as references, and the spots in the lower right corner represent PBS, which was used as a negative control.

Figure 2

Time course for the phosphorylation levels of EGFR, HER2 and ERK1/2 after MEK inhibition. The OCUM-1 cells were incubated with 1 nM of trametinib for each of the indicated time periods and were then evaluated using a western blot analysis. The phosphorylation levels of EGFR and HER2 were increased at 24 and 72 h after trametinib exposure. Trametinib antecedently inhibited the phosphorylation levels of ERK1/2 from 3 h, and inhibited ERK1/2 was re-activated in accordance with the elevation of the phosphorylation levels of EGFR and HER2. β-actin was used as an internal control. pEGFR, phospho-EGFR; pHER2, phospho-HER2; pERK1/2, phospho-ERK1/2.

Ligand-induced EGFR and HER2 activation led to the acquisition of resistance to a MEK inhibitor

To verify the contribution of EGFR and HER2 signals to MEK inhibitor resistance, the experiments were performed using recombinant human EGF (10 ng/ml) as the ligand. After the EGF-induced activation of the EGFR and HER2 signals, the OCUM-1 cell line became resistant to trametinib (Fig. 3A). Using a western blot analysis, EGF stimulation was shown to increase the phosphorylation levels of EGFR and HER2, and ERK1/2, which had been suppressed by trametinib, was re-phosphorylated (Fig. 4B).

Figure 3

Growth inhibitory effect of trametinib in the OCUM-1 cell line. (A) Influence of EGF on the sensitivity to trametinib. Cells were exposed to each concentration of trametinib for 72 h with or without 10 ng/ml of EGF [EGF (+), solid bars; EGF (−), bars with hatch lines] and were evaluated using an MTT assay using 1% FBS. The growth inhibitory effect at every concentration of trametinib was strongly weakened by EGF stimulation. Columns, mean of independent triplicate experiments; error bars, SD; *P<0.05. (B) Growth inhibitory effect of trametinib monotherapy and combination with lapatinib. The cells were exposed to each concentration of trametinib for 72 h with or without 10 μM of lapatinib (T + L, solid bars; T, bars with hatch lines) and were evaluated using an MTT assay. The combination of trametinib and lapatinib synergistically inhibited the cell growth in a significant manner. Columns, mean of independent triplicate experiments; error bars, SD; *P<0.05.

Figure 4

Effect of lapatinib on the resistance to trametinib induced by EGF. (A) Growth inhibitory effect of combination with trametinib and lapatinib in the presence of EGF. The cells were exposed to 1 nM of trametinib, 10 μM of lapatinib, and/or 10 ng/ml of EGF for 72 h and the cell growth was evaluated using an MTT assay with 1% FBS. In the presence of EGF, the inhibitory effect of trametinib was weakened significantly, while the combination of trametinib and lapatinib abolished the resistance induced by EGF. EGF or lapatinib monotherapy did not influence the cell growth. Columns, mean of independent triplicate experiments; error bars, SD; *P<0.05. (B) Phosphorylation of EGFR, HER2, and ERK1/2. When the phosphorylation levels were examined using a western blot analysis, the samples were collected 3 h after stimulation. The following concentrations were used: 1 nM of trametinib, 10 μM of lapatinib, and 10 ng/ml of EGF. EGF stimulation increased the phosphorylation levels of EGFR and HER2, resulting in the activation of ERK1/2. The decreased phosphorylation levels of ERK1/2 induced by trametinib were re-activated by EGF stimulation, and lapatinib abolished the re-activation of ERK1/2 by inhibiting the phosphorylation of EGFR and HER2. β-actin was used as an internal control. pEGFR, phospho-EGFR; pHER2, phospho-HER2; pERK1/2, phospho-ERK1/2.

Lapatinib abolished the resistance to trametinib induced by EGF

Next, to investigate the effect of lapatinib (an EGFR and HER2 dual tyrosine kinase inhibitor) on the EGF-induced resistance, a combination therapy was tested. The EGF-induced resistance to trametinib was abolished by lapatinib (Fig. 4A). The suppression of the phosphorylation levels of ERK1/2 through the inhibition of EGFR and HER2 by lapatinib can explain the restored response to trametinib (Fig. 4B). These results suggest that the activation of EGFR and HER2 signals potentially plays an important role in MEK inhibitor resistance and that lapatinib may abolish such resistance.

Combination of trametinib and lapatinib synergistically inhibits cell growth

To investigate the role of the activated EGFR and HER2 signals during treatment with trametinib, we examined the synergistic anticancer effect of trametinib and lapatinib in the OCUM-1 cell line using an MTT assay. The combination of trametinib and lapatinib showed a synergistic effect on the inhibition of cell proliferation (Fig. 3B). Furthermore, lapatinib decreased the phosphorylation levels of EGFR and HER2, which had been activated after the treatment with trametinib, and the phosphorylation level of ERK1/2 was inhibited to a greater degree by the combination treatment than by trametinib monotherapy (Fig. 5A). Cleaved PARP and cleaved caspase-3, which are hallmarks of apoptosis, had also increased at 72 h after the trametinib and lapatinib combination therapy, compared with after trametinib monotherapy (Fig. 5B). These results suggest that activated EGFR and HER2 signals are involved in salvage pathways under MEK inhibition in MEK1-mutated GC and that trametinib and lapatinib exert a synergistic effect by inhibiting the salvage signals.

Figure 5

Synergistic effect of trametinib and lapatinib on EGFR, HER2, and ERK signals and apoptosis-related molecules. (A) Phosphorylation of EGFR, HER2, and ERK1/2. For the analysis of the phosphorylation levels using a western blot analysis, the samples were collected at 72 h after exposure. The following concentrations were used: 1 nM of trametinib and 10 μM of lapatinib. The phosphorylation levels of EGFR and HER2 were elevated at 72 h after treatment with trametinib, similar to the results obtained using the phospho-RTK array. Lapatinib reduced the phosphorylation level of ERK1/2 by inhibiting the EGFR and HER2 signals, which were activated after trametinib treatment. β-actin was used as an internal control. pEGFR, phospho-EGFR; pHER2, phospho-HER2; pERK1/2, phospho-ERK1/2. (B) Expressions of apoptosis-related molecules. The cells were exposed to the inhibitors for 72 h, and apoptosis-related molecules were then examined using a western blot analysis. The following concentrations were used: 1 nM of trametinib and 10 μM of lapatinib. Trametinib increased the expressions of cleaved PARP and cleaved caspase-3 to a greater extent when used in combination with lapatinib, compared with the results for trametinib monotherapy. β-actin was used as an internal control. cPARP, cleaved PARP; cCaspase-3, cleaved caspase-3.

Discussion

In this study, we demonstrated the reactivation of ERK1/2 via the activation of EGFR and HER2 signals after MEK inhibition with trametinib, and EGF-induced resistance in the MEK1-mutated GC cell line. Our data also identified the receptor tyrosine kinase family members EGFR and HER2 as potent targets for overcoming resistance to MEK inhibitors. Moreover, the combination of trametinib and lapatinib was more effective against a MEK1-mutated GC cell line than trametinib monotherapy. To the best of our knowledge, this is the first report to show the activation of EGFR and HER2 after MEK inhibition, the potential of combination therapy as a therapeutic strategy, and the possibility of overcoming resistance in MEK1-mutated GC.

The serine threonine kinases BRAF, MEK, and ERK are major regulators of the MAPK signal and are frequently dysregulated in malignancies. Given the role of these kinases in cancer, the MAPK signal has become an attractive target for molecular targeted drugs (30). While a number of MAPK signal inhibitors, as well as RAF inhibitors, have been developed and are in clinical use, the acquisition of resistance has hindered the continuation of treatment, resulting in a limited survival benefit. Resistance to MAPK inhibitors is mediated by many mechanisms, including the reactivation of RAS/RAF/MEK/ERK signals, MEK mutations, and increases in the RAS or RAF protein levels, as well as increased signals through alternative pathways, including the PI3K/AKT and STAT3 pathways (31). Recently, BRAF inhibition leading to a feedback activation of EGFR and a strong synergistic effect of BRAF and EGFR inhibition were described in BRAF-mutated colorectal cancer cell lines (32). Furthermore, the combination of a MEK inhibitor and a dual EGFR and HER2 inhibitor produced a synergistic effect by inhibiting the activation of ERK signals both in vivo and in vitro in KRAS-mutated colon and lung cancer cell lines (27). These results suggest that the activation of HER family members is an important salvage signal during MAPK inhibition. Similarly, in our data, the EGFR and HER2 signals were activated after treatment with a MEK inhibitor, resulting in the re-activation of the ERK signal. In addition, EGF stimulation also activated the ERK signal via the activation of EGFR and HER2 in the MEK1-mutated GC cell line, which led to MEK inhibitor resistance. The effects of the EGFR and HER2 signals were abolished by the inhibitor. These findings indicate the possibility of a novel combination therapy comprised of a MEK inhibitor and a HER inhibitor for GC patients, similar to results observed for other malignancies.

To address how MEK inhibition by trametinib activates EGFR and HER2, we investigated the mRNA expression of the corresponding genes using real-time RT-PCR. However, no significant change in mRNA expression was observed. MEK inhibition reportedly leads to MYC degradation and HER2 and HER3 upregulation in KRAS-mutated colon and lung cancer (27). Another study has shown that CDC25c, which can bind to EGFR, may be involved in the activation of EGFR in a BRAF-mutated colorectal cancer cell line (32). However, the detailed mechanism responsible for the activation of HER signals after MEK inhibition remains unclear. Furthermore, the activation of HER signals has been reported to result not only from MAPK inhibition, but also from exposure to cytotoxic agents, including 5-FU, oxaliplatin in colorectal cancer cells, and pemetrexed in non-small cell lung cancer (33,34). These findings suggest that the activation of HER signals plays a primary salvage role in many cancers, promising that resistance to many anticancer therapies can be overcome. Therefore, further research on approaches to overcoming such resistance is needed.

In conclusion, the present study revealed that the activation of EGFR and HER2 signals after MEK inhibition may serve as a potential mechanism responsible for the resistance to a MEK inhibitor in MEK1-mutated GC. Additionally, combined treatment with trametinib and lapatinib exhibited a synergistic effect by inhibiting the activation of the EGFR and HER2 signals. These data may contribute to the development of novel therapeutic strategies for MEK1-mutated GC.

Acknowledgements

We thank Mr. Shinji Kurashimo, Mr. Yoshihiro Mine, Ms. Eiko Honda, Ms. Tomoko Kitayama and Ms. Ayaka Kurumatani for their technical assistance. This study was supported in part by the Grant-in Aid for Japan Society for Promotion of Science Fellows.

References

1 

Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, Parkin DM, Forman D and Bray F: Cancer incidence and mortality worldwide: Sources, methods and major patterns in GLOBOCAN 2012. Int J Cancer. 136:E359–E386. 2015. View Article : Google Scholar

2 

Van Cutsem E, Moiseyenko VM, Tjulandin S, Majlis A, Constenla M, Boni C, Rodrigues A, Fodor M, Chao Y, Voznyi E, et al; V325 Study Group. Phase III study of docetaxel and cisplatin plus fluorouracil compared with cisplatin and fluorouracil as first-line therapy for advanced gastric cancer: A report of the V325 Study Group. J Clin Oncol. 24:4991–4997. 2006. View Article : Google Scholar : PubMed/NCBI

3 

Cunningham D, Starling N, Rao S, Iveson T, Nicolson M, Coxon F, Middleton G, Daniel F, Oates J and Norman AR; Upper Gastrointestinal Clinical Studies Group of the National Cancer Research Institute of the United Kingdom. Capecitabine and oxaliplatin for advanced esophagogastric cancer. N Engl J Med. 358:36–46. 2008. View Article : Google Scholar : PubMed/NCBI

4 

Koizumi W, Narahara H, Hara T, Takagane A, Akiya T, Takagi M, Miyashita K, Nishizaki T, Kobayashi O, Takiyama W, et al: S-1 plus cisplatin versus S-1 alone for first-line treatment of advanced gastric cancer (SPIRITS trial): A phase III trial. Lancet Oncol. 9:215–221. 2008. View Article : Google Scholar : PubMed/NCBI

5 

Bang YJ, Van Cutsem E, Feyereislova A, Chung HC, Shen L, Sawaki A, Lordick F, Ohtsu A, Omuro Y, Satoh T, et al; ToGA Trial Investigators. Trastuzumab in combination with chemotherapy versus chemotherapy alone for treatment of HER2-positive advanced gastric or gastro-oesophageal junction cancer (ToGA): A phase 3, open-label, randomised controlled trial. Lancet. 376:687–697. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Sakai K, Mori S, Kawamoto T, Taniguchi S, Kobori O, Morioka Y, Kuroki T and Kano K: Expression of epidermal growth factor receptors on normal human gastric epithelia and gastric carcinomas. J Natl Cancer Inst. 77:1047–1052. 1986.PubMed/NCBI

7 

Yano T, Doi T, Ohtsu A, Boku N, Hashizume K, Nakanishi M and Ochiai A: Comparison of HER2 gene amplification assessed by fluorescence in situ hybridization and HER2 protein expression assessed by immunohistochemistry in gastric cancer. Oncol Rep. 15:65–71. 2006.

8 

Gravalos C and Jimeno A: HER2 in gastric cancer: A new prognostic factor and a novel therapeutic target. Ann Oncol. 19:1523–1529. 2008. View Article : Google Scholar : PubMed/NCBI

9 

Matsumoto K, Arao T, Hamaguchi T, Shimada Y, Kato K, Oda I, Taniguchi H, Koizumi F, Yanagihara K, Sasaki H, et al: FGFR2 gene amplification and clinicopathological features in gastric cancer. Br J Cancer. 106:727–732. 2012. View Article : Google Scholar : PubMed/NCBI

10 

Kawakami H, Okamoto I, Arao T, Okamoto W, Matsumoto K, Taniguchi H, Kuwata K, Yamaguchi H, Nishio K, Nakagawa K, et al: MET amplification as a potential therapeutic target in gastric cancer. Oncotarget. 4:9–17. 2013.PubMed/NCBI

11 

Wang K, Yuen ST, Xu J, Lee SP, Yan HH, Shi ST, Siu HC, Deng S, Chu KM, Law S, et al: Whole-genome sequencing and comprehensive molecular profiling identify new driver mutations in gastric cancer. Nat Genet. 46:573–582. 2014. View Article : Google Scholar : PubMed/NCBI

12 

Kakiuchi M, Nishizawa T, Ueda H, Gotoh K, Tanaka A, Hayashi A, Yamamoto S, Tatsuno K, Katoh H, Watanabe Y, et al: Recurrent gain-of-function mutations of RHOA in diffuse-type gastric carcinoma. Nat Genet. 46:583–587. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Johnson GL and Lapadat R: Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science. 298:1911–1912. 2002. View Article : Google Scholar : PubMed/NCBI

14 

Roberts PJ and Der CJ: Targeting the Raf-MEK-ERK mitogen-activated protein kinase cascade for the treatment of cancer. Oncogene. 26:3291–3310. 2007. View Article : Google Scholar : PubMed/NCBI

15 

Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, Teague J, Woffendin H, Garnett MJ, Bottomley W, et al: Mutations of the BRAF gene in human cancer. Nature. 417:949–954. 2002. View Article : Google Scholar : PubMed/NCBI

16 

Bollag G, Hirth P, Tsai J, Zhang J, Ibrahim PN, Cho H, Spevak W, Zhang C, Zhang Y, Habets G, et al: Clinical efficacy of a RAF inhibitor needs broad target blockade in BRAF-mutant melanoma. Nature. 467:596–599. 2010. View Article : Google Scholar : PubMed/NCBI

17 

Flaherty KT, Puzanov I, Kim KB, Ribas A, McArthur GA, Sosman JA, O’Dwyer PJ, Lee RJ, Grippo JF, Nolop K, et al: Inhibition of mutated, activated BRAF in metastatic melanoma. N Engl J Med. 363:809–819. 2010. View Article : Google Scholar : PubMed/NCBI

18 

Pao W and Girard N: New driver mutations in non-small-cell lung cancer. Lancet Oncol. 12:175–180. 2011. View Article : Google Scholar : PubMed/NCBI

19 

Estep AL, Palmer C, McCormick F and Rauen KA: Mutation analysis of BRAF, MEK1 and MEK2 in 15 ovarian cancer cell lines: Implications for therapy. PLoS One. 2:e12792007. View Article : Google Scholar : PubMed/NCBI

20 

Marks JL, Gong Y, Chitale D, Golas B, McLellan MD, Kasai Y, Ding L, Mardis ER, Wilson RK, Solit D, et al: Novel MEK1 mutation identified by mutational analysis of epidermal growth factor receptor signaling pathway genes in lung adenocarcinoma. Cancer Res. 68:5524–5528. 2008. View Article : Google Scholar : PubMed/NCBI

21 

Bentivegna S, Zheng J, Namsaraev E, Carlton VE, Pavlicek A, Moorhead M, Siddiqui F, Wang Z, Lee L, Ireland JS, et al: Rapid identification of somatic mutations in colorectal and breast cancer tissues using mismatch repair detection (MRD). Hum Mutat. 29:441–450. 2008. View Article : Google Scholar : PubMed/NCBI

22 

Sogabe S, Togashi Y, Kato H, Kogita A, Mizukami T, Sakamoto Y, Banno E, Terashima M, Hayashi H, de Velasco MA, et al: MEK inhibitor for gastric cancer with MEK1 gene mutations. Mol Cancer Ther. 13:3098–3106. 2014. View Article : Google Scholar : PubMed/NCBI

23 

Emery CM, Vijayendran KG, Zipser MC, Sawyer AM, Niu L, Kim JJ, Hatton C, Chopra R, Oberholzer PA, Karpova MB, et al: MEK1 mutations confer resistance to MEK and B-RAF inhibition. Proc Natl Acad Sci USA. 106:20411–20416. 2009. View Article : Google Scholar : PubMed/NCBI

24 

Little AS, Balmanno K, Sale MJ, Newman S, Dry JR, Hampson M, Edwards PA, Smith PD and Cook SJ: Amplification of the driving oncogene, KRAS or BRAF, underpins acquired resistance to MEK1/2 inhibitors in colorectal cancer cells. Sci Signal. 4:ra172011.PubMed/NCBI

25 

Corcoran RB, Dias-Santagata D, Bergethon K, Iafrate AJ, Settleman J and Engelman JA: BRAF gene amplification can promote acquired resistance to MEK inhibitors in cancer cells harboring the BRAF V600E mutation. Sci Signal. 3:ra842010.PubMed/NCBI

26 

Walters DM, Lindberg JM, Adair SJ, Newhook TE, Cowan CR, Stokes JB, Borgman CA, Stelow EB, Lowrey BT, Chopivsky ME, et al: Inhibition of the growth of patient-derived pancreatic cancer xenografts with the MEK inhibitor trametinib is augmented by combined treatment with the epidermal growth factor receptor/ HER2 inhibitor lapatinib. Neoplasia. 15:143–155. 2013. View Article : Google Scholar : PubMed/NCBI

27 

Sun C, Hobor S, Bertotti A, Zecchin D, Huang S, Galimi F, Cottino F, Prahallad A, Grernrum W, Tzani A, et al: Intrinsic resistance to MEK inhibition in KRAS mutant lung and colon cancer through transcriptional induction of ERBB3. Cell Rep. 7:86–93. 2014. View Article : Google Scholar : PubMed/NCBI

28 

Togashi Y, Sakamoto H, Hayashi H, Terashima M, De Velasco MA, Fujita Y, Kodera Y, Sakai K, Tomida S, Kitano M, et al: Homozygous deletion of the activin A receptor, type IB gene is associated with an aggressive cancer phenotype in pancreatic cancer. Mol Cancer. 13:1262014. View Article : Google Scholar : PubMed/NCBI

29 

Kaneda H, Arao T, Tanaka K, Tamura D, Aomatsu K, Kudo K, Sakai K, De Velasco MA, Matsumoto K, Fujita Y, et al: FOXQ1 is overexpressed in colorectal cancer and enhances tumorigenicity and tumor growth. Cancer Res. 70:2053–2063. 2010. View Article : Google Scholar : PubMed/NCBI

30 

Hingorani SR, Jacobetz MA, Robertson GP, Herlyn M and Tuveson DA: Suppression of BRAF(V599E) in human melanoma abrogates transformation. Cancer Res. 63:5198–5202. 2003.PubMed/NCBI

31 

Freeman AK and Morrison DK: Mechanisms and potential therapies for acquired resistance to inhibitors targeting the Raf or MEK kinases in cancer. Molecular Mechanisms of Tumor Cell Resistance to Chemotherapy: Targeted Therapies to Reverse Resistance. Bonavita B: pp. 47–67. 2013, View Article : Google Scholar

32 

Prahallad A, Sun C, Huang S, Di Nicolantonio F, Salazar R, Zecchin D, Beijersbergen RL, Bardelli A and Bernards R: Unresponsiveness of colon cancer to BRAF(V600E) inhibition through feedback activation of EGFR. Nature. 483:100–103. 2012. View Article : Google Scholar : PubMed/NCBI

33 

Van Schaeybroeck S, Karaiskou-McCaul A, Kelly D, Longley D, Galligan L, Van Cutsem E and Johnston P: Epidermal growth factor receptor activity determines response of colorectal cancer cells to gefitinib alone and in combination with chemotherapy. Clin Cancer Res. 11:7480–7489. 2005. View Article : Google Scholar : PubMed/NCBI

34 

Li T, Ling YH, Goldman ID and Perez-Soler R: Schedule-dependent cytotoxic synergism of pemetrexed and erlotinib in human non-small cell lung cancer cells. Clin Cancer Res. 13:3413–3422. 2007. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Mizukami T, Togashi Y, Sogabe S, Banno E, Terashima M, De Velasco MA, Sakai K, Fujita Y, Tomida S, Nakajima TE, Nakajima TE, et al: EGFR and HER2 signals play a salvage role in MEK1-mutated gastric cancer after MEK inhibition. Int J Oncol 47: 499-505, 2015.
APA
Mizukami, T., Togashi, Y., Sogabe, S., Banno, E., Terashima, M., De Velasco, M.A. ... Nishio, K. (2015). EGFR and HER2 signals play a salvage role in MEK1-mutated gastric cancer after MEK inhibition. International Journal of Oncology, 47, 499-505. https://doi.org/10.3892/ijo.2015.3050
MLA
Mizukami, T., Togashi, Y., Sogabe, S., Banno, E., Terashima, M., De Velasco, M. A., Sakai, K., Fujita, Y., Tomida, S., Nakajima, T. E., Boku, N., Nishio, K."EGFR and HER2 signals play a salvage role in MEK1-mutated gastric cancer after MEK inhibition". International Journal of Oncology 47.2 (2015): 499-505.
Chicago
Mizukami, T., Togashi, Y., Sogabe, S., Banno, E., Terashima, M., De Velasco, M. A., Sakai, K., Fujita, Y., Tomida, S., Nakajima, T. E., Boku, N., Nishio, K."EGFR and HER2 signals play a salvage role in MEK1-mutated gastric cancer after MEK inhibition". International Journal of Oncology 47, no. 2 (2015): 499-505. https://doi.org/10.3892/ijo.2015.3050
Copy and paste a formatted citation
x
Spandidos Publications style
Mizukami T, Togashi Y, Sogabe S, Banno E, Terashima M, De Velasco MA, Sakai K, Fujita Y, Tomida S, Nakajima TE, Nakajima TE, et al: EGFR and HER2 signals play a salvage role in MEK1-mutated gastric cancer after MEK inhibition. Int J Oncol 47: 499-505, 2015.
APA
Mizukami, T., Togashi, Y., Sogabe, S., Banno, E., Terashima, M., De Velasco, M.A. ... Nishio, K. (2015). EGFR and HER2 signals play a salvage role in MEK1-mutated gastric cancer after MEK inhibition. International Journal of Oncology, 47, 499-505. https://doi.org/10.3892/ijo.2015.3050
MLA
Mizukami, T., Togashi, Y., Sogabe, S., Banno, E., Terashima, M., De Velasco, M. A., Sakai, K., Fujita, Y., Tomida, S., Nakajima, T. E., Boku, N., Nishio, K."EGFR and HER2 signals play a salvage role in MEK1-mutated gastric cancer after MEK inhibition". International Journal of Oncology 47.2 (2015): 499-505.
Chicago
Mizukami, T., Togashi, Y., Sogabe, S., Banno, E., Terashima, M., De Velasco, M. A., Sakai, K., Fujita, Y., Tomida, S., Nakajima, T. E., Boku, N., Nishio, K."EGFR and HER2 signals play a salvage role in MEK1-mutated gastric cancer after MEK inhibition". International Journal of Oncology 47, no. 2 (2015): 499-505. https://doi.org/10.3892/ijo.2015.3050
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team