International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Gastric cancer (GC) is one of the most common malignant tumors and the third most common cause of death from malignancies worldwide (1). Despite intensive investigations of anticancer treatments for GC, the prognosis of unresectable advanced or recurrent GC remains poor. The median overall survival of GC patients has reached only ~1 year using conventional cytotoxic chemotherapy (2–4). Trastuzumab, a monoclonal antibody against human epidermal growth factor receptor (EGFR) 2 (HER2), used in combination with chemotherapy has shown a survival benefit when used as a first-line treatment in patients with HER2-positive advanced GC (5). However, HER2 overexpression has only been reported in 13–23% of GC cases (6–8). Fibroblast growth factor receptor 2 amplification, MET amplification and RhoA mutations have been anticipated as new molecular targets in GC, but these aberrations are relatively infrequent (9–12). Therefore, new therapeutic modalities are still needed.
The mitogen-activated protein kinase (MAPK) signal pathway cascade and its downstream factors promote cancer cell proliferation, differentiation and survival. The three-tiered kinase cascade consisting of RAF, mitogen-activated protein kinase kinase (MEK), and extracellular signal-regulated kinase (ERK) is frequently dysregulated in malignancies as a result of activating mutations in the upstream RAS (KRAS, NRAS and HRAS) (13,14). The activating BRAF mutation has been detected in a variety of human cancers (15), and the success of RAF inhibitors in BRAF-mutated melanoma has revealed a new modality and has substantiated the contribution of the MAPK signal to carcinogenesis (16,17). Somatic oncogenic MEK1 mutations have also been identified in several human malignancies (18–21). In addition, our previous study demonstrated that MEK1 mutations in poorly differentiated GC cell lines that are hypersensitive to MEK inhibitors have transformational abilities and that the growth of these cancer cells is dependent on these mutations (22). Considering the addiction of cancer cells to active MEK1 mutations for proliferation, GC with such oncogenic MEK1 mutations might be suitable for targeted therapy with MEK inhibitors.
A persistent problem is the development of resistance to molecular-targeted therapies. A series of resistance mechanisms for MEK inhibition that operate ERK-dependently or ERK-independently have been reported, including MEK mutations, elevated RAS or RAF protein levels, and the activation of an alternative PI3K/AKT or STAT3 pathway (23–25). Currently, the phosphorylation of EGFR after the inhibition of the MAPK signal has been suggested as another potential mechanism responsible for the resistance to MEK inhibition in various cancers, and combination therapy with EGFR inhibitors yielded synergistic effects (26,27). In this study, we observed the phosphorylation of EGFR and HER2 after MEK inhibition in a MEK1-mutated GC cell line. Then, the relevancy of this mechanism to MEK inhibitor resistance was validated, and combinations with other tyrosine kinase inhibitors were tested to develop new therapeutic possibilities.
Trametinib (GSK1120212) and lapatinib (GW572016) were purchased from Selleck Chemicals (Houston, TX, USA) and were dissolved in dimethyl sulfoxide (DMSO) for the in vitro experiments. Recombinant human epidermal growth factor (EGF) was obtained from R&D Systems (Minneapolis, MN, USA) and was constituted in sterile phosphate-buffered saline (PBS).
Rabbit-antibodies specific for ERK1/2, EGFR, HER2, phospho-ERK1/2 (pERK1/2), phospho-EGFR (pEGFR), phospho-HER2 (pHER2), poly (ADP-ribose) polymerase (PARP), caspase-3, cleaved PARP (cPARP), cleaved caspase-3 (cCaspase-3), and β-actin were obtained from Cell Signaling Technology (Beverly, MA, USA).
A poorly differentiated GC cell line harboring the MEK1 Q56P mutation, OCUM-1, was propagated in RPMI-1640 (Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Gibco BRL, Grand Island, NY, USA) and 1% Penicillin-Streptomycin Mixed Solution (Nacalai Tesque, Kyoto, Japan) in a humidified atmosphere of 5% CO2 at 37°C.
The screening of 49 phosphorylated tyrosine kinases in the OCUM-1 cell line was performed using the Human Phospho-RTK Array kit (R&D Systems). Whole lyses of OCUM-1 cells incubated in the absence (DMSO) or presence of 1 nM trametinib for 72 h were compared in accordance with the manufacturer’s recommendation. Protein detection was accomplished using an anti-phospho-tyrosine-HRP detection antibody and an enhanced chemiluminescence system (Image Quant LAS4000; GE Healthcare Life Science, Buckinghamshire, UK).
The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used to evaluate the growth inhibitory effect of the drugs, as previously described (28). When the effect of EGF was evaluated, 1% FBS was used.
A total of 1 μg of RNA was isolated from the cells using ISOGEN reagent (Nippon Gene, Tokyo, Japan) and then converted to cDNA using GeneAmp RNA-PCR kit (Applied Biosystems, Foster City, CA USA). Real-time PCR was performed using SYBR Premix Ex Taq and Thermal Cycler Dice (Takara, Shiga, Japan), as described previously (29). The glyceraldehyde 3-phosphate dehydrogenase (GAPD, NM_002046) gene was used to normalize the expression levels in subsequent quantitative analyses. To amplify the target genes encoding amphiregulin (AREG), EGF, heparin-binding EGF-like growth factor (HB-EGF), neuregulin 1 (NRG1), transforming growth factor α (TGFA), EGFR, HER2, HER3, and HER4 (AREG, EGF, HB-EGF, NRG1, TGFA, EGFR, ERBB2, ERBB3 and ERBB4 genes, respectively), the following primers were used: AREG-F, GTCGCTCTTGATAC TCGGCTCAG; AREG-R, TCCCAGAGTAGGTGTCATTG AGGTC; EGF-F, CAACCAGTGGCTGGTGAGGA; EGF-R, GAGCCCTTATCACTGGATACTGGAA; HB-EGF-F, CAA GGTGATTTCAGACTGCAGAGG; HB-EGF-R, TTTGGCA CTTGAAGGCTCTGG; NRG1-F, GCCAGGAATCGGCTG CAGGT; NRG1-R, AGCCAGTGATGCT TTGTTAATGCGA; TGFA-F, CTTTGGAAACCAGCAGGTCTGA; TGFA-R, CCCAAATAAGCCAGGCTGTTCTA; EGFR-F, CATCCA GGCCCAACTGTGAG; EGFR-R, CAGTGGAAGCCTT GAAGCAGAA; ERBB2-F, TGGGAGCCTGGCATTTCTG; E R BB2-R, CG G CCATG C TGAGATGTATAG GTA; ERBB3-F, GGGAGCATTTAATGGCAGCTA; ERBB3-R, GAATGGAATTGTCTGGGACTGG; ERBB4-F, GCAGCT AACTTTGAATGCCTGTCTC; ERBB4-R, GCAGCTA ACTTTGAATGCCTGTCTC; GAPD-F, GCACCGTCAAG GCTGAGAAC; and GAPD-R, ATGGTGGTGAAGACG CCAGT.
The western blot analysis was performed as described previously (28). Briefly, subconfluent cells were washed with cold PBS and harvested with Lysis A buffer containing 1% Triton X-100, 20 mM Tris-HCl (pH 7.0), 5 mM EDTA, 50 mM sodium chloride, 10 mM sodium pyrophosphate, 50 mM sodium fluoride, 1 mM sodium orthovanadate, and a protease inhibitor mix, Complete™ (Roche Diagnostics). Whole-cell lyses were separated using SDS-PAGE and were blotted onto a polyvinylidene fluoride membrane. After blocking with 3% bovine serum albumin in a TBS buffer (pH 8.0) with 0.1% Tween-20, the membrane was probed with the primary antibody. After rinsing twice with TBS buffer, the membrane was incubated with a horseradish peroxidase-conjugated secondary antibody and washed, followed by visualization using an ECL detection system and LAS-4000. When the cells were stimulated using EGF, the cells were incubated with 1% FBS medium.
The results are shown as the mean value ± standard deviation (SD) for three replicate independent experiments. The statistical analyses were performed using the Student’s t-test (two-tailed). A P-value <0.05 was considered statistically significant. The statistical analyses were two-tailed and were performed using Microsoft Excel (Microsoft, Redmond, WA, USA).
To address the phosphorylation of RTK after MEK inhibition, we used a phospho-RTK array. The arrangement of the RTK array is summarized in Fig. 1B. The phosphorylation levels of EGFR and HER2 were elevated at 72 h after treatment with a MEK inhibitor (trametinib) (Fig. 1A). Next, to validate the results of the RTK array, we evaluated the phosphorylation level of EGFR and HER2 using a western blot analysis. In addition to the inhibitory effect on the ERK signal, trametinib led to the activation of EGFR and HER2 signals similar to the results of the RTK array. In addition, the phosphorylation of ERK1/2, which had been inhibited by trametinib, was reactivated following the activation of the EGFR and HER2 signals (Fig. 2). These results suggest that the EGFR and HER2 signals are activated under MEK inhibition in MEK1-mutated GC. To investigate the mechanism responsible for the activation of the EGFR and HER2 signals, real-time RT-PCR was performed. However, no significant changes in the mRNA expression levels of the molecules relative to the EGFR and HER2 signals were observed (AREG, EGF, HB-EGF, NRG1, TGFA, EGFR, HER2, HER3 and HER4; data not shown).
To verify the contribution of EGFR and HER2 signals to MEK inhibitor resistance, the experiments were performed using recombinant human EGF (10 ng/ml) as the ligand. After the EGF-induced activation of the EGFR and HER2 signals, the OCUM-1 cell line became resistant to trametinib (Fig. 3A). Using a western blot analysis, EGF stimulation was shown to increase the phosphorylation levels of EGFR and HER2, and ERK1/2, which had been suppressed by trametinib, was re-phosphorylated (Fig. 4B).
Next, to investigate the effect of lapatinib (an EGFR and HER2 dual tyrosine kinase inhibitor) on the EGF-induced resistance, a combination therapy was tested. The EGF-induced resistance to trametinib was abolished by lapatinib (Fig. 4A). The suppression of the phosphorylation levels of ERK1/2 through the inhibition of EGFR and HER2 by lapatinib can explain the restored response to trametinib (Fig. 4B). These results suggest that the activation of EGFR and HER2 signals potentially plays an important role in MEK inhibitor resistance and that lapatinib may abolish such resistance.
To investigate the role of the activated EGFR and HER2 signals during treatment with trametinib, we examined the synergistic anticancer effect of trametinib and lapatinib in the OCUM-1 cell line using an MTT assay. The combination of trametinib and lapatinib showed a synergistic effect on the inhibition of cell proliferation (Fig. 3B). Furthermore, lapatinib decreased the phosphorylation levels of EGFR and HER2, which had been activated after the treatment with trametinib, and the phosphorylation level of ERK1/2 was inhibited to a greater degree by the combination treatment than by trametinib monotherapy (Fig. 5A). Cleaved PARP and cleaved caspase-3, which are hallmarks of apoptosis, had also increased at 72 h after the trametinib and lapatinib combination therapy, compared with after trametinib monotherapy (Fig. 5B). These results suggest that activated EGFR and HER2 signals are involved in salvage pathways under MEK inhibition in MEK1-mutated GC and that trametinib and lapatinib exert a synergistic effect by inhibiting the salvage signals.
In this study, we demonstrated the reactivation of ERK1/2 via the activation of EGFR and HER2 signals after MEK inhibition with trametinib, and EGF-induced resistance in the MEK1-mutated GC cell line. Our data also identified the receptor tyrosine kinase family members EGFR and HER2 as potent targets for overcoming resistance to MEK inhibitors. Moreover, the combination of trametinib and lapatinib was more effective against a MEK1-mutated GC cell line than trametinib monotherapy. To the best of our knowledge, this is the first report to show the activation of EGFR and HER2 after MEK inhibition, the potential of combination therapy as a therapeutic strategy, and the possibility of overcoming resistance in MEK1-mutated GC.
The serine threonine kinases BRAF, MEK, and ERK are major regulators of the MAPK signal and are frequently dysregulated in malignancies. Given the role of these kinases in cancer, the MAPK signal has become an attractive target for molecular targeted drugs (30). While a number of MAPK signal inhibitors, as well as RAF inhibitors, have been developed and are in clinical use, the acquisition of resistance has hindered the continuation of treatment, resulting in a limited survival benefit. Resistance to MAPK inhibitors is mediated by many mechanisms, including the reactivation of RAS/RAF/MEK/ERK signals, MEK mutations, and increases in the RAS or RAF protein levels, as well as increased signals through alternative pathways, including the PI3K/AKT and STAT3 pathways (31). Recently, BRAF inhibition leading to a feedback activation of EGFR and a strong synergistic effect of BRAF and EGFR inhibition were described in BRAF-mutated colorectal cancer cell lines (32). Furthermore, the combination of a MEK inhibitor and a dual EGFR and HER2 inhibitor produced a synergistic effect by inhibiting the activation of ERK signals both in vivo and in vitro in KRAS-mutated colon and lung cancer cell lines (27). These results suggest that the activation of HER family members is an important salvage signal during MAPK inhibition. Similarly, in our data, the EGFR and HER2 signals were activated after treatment with a MEK inhibitor, resulting in the re-activation of the ERK signal. In addition, EGF stimulation also activated the ERK signal via the activation of EGFR and HER2 in the MEK1-mutated GC cell line, which led to MEK inhibitor resistance. The effects of the EGFR and HER2 signals were abolished by the inhibitor. These findings indicate the possibility of a novel combination therapy comprised of a MEK inhibitor and a HER inhibitor for GC patients, similar to results observed for other malignancies.
To address how MEK inhibition by trametinib activates EGFR and HER2, we investigated the mRNA expression of the corresponding genes using real-time RT-PCR. However, no significant change in mRNA expression was observed. MEK inhibition reportedly leads to MYC degradation and HER2 and HER3 upregulation in KRAS-mutated colon and lung cancer (27). Another study has shown that CDC25c, which can bind to EGFR, may be involved in the activation of EGFR in a BRAF-mutated colorectal cancer cell line (32). However, the detailed mechanism responsible for the activation of HER signals after MEK inhibition remains unclear. Furthermore, the activation of HER signals has been reported to result not only from MAPK inhibition, but also from exposure to cytotoxic agents, including 5-FU, oxaliplatin in colorectal cancer cells, and pemetrexed in non-small cell lung cancer (33,34). These findings suggest that the activation of HER signals plays a primary salvage role in many cancers, promising that resistance to many anticancer therapies can be overcome. Therefore, further research on approaches to overcoming such resistance is needed.
In conclusion, the present study revealed that the activation of EGFR and HER2 signals after MEK inhibition may serve as a potential mechanism responsible for the resistance to a MEK inhibitor in MEK1-mutated GC. Additionally, combined treatment with trametinib and lapatinib exhibited a synergistic effect by inhibiting the activation of the EGFR and HER2 signals. These data may contribute to the development of novel therapeutic strategies for MEK1-mutated GC.
We thank Mr. Shinji Kurashimo, Mr. Yoshihiro Mine, Ms. Eiko Honda, Ms. Tomoko Kitayama and Ms. Ayaka Kurumatani for their technical assistance. This study was supported in part by the Grant-in Aid for Japan Society for Promotion of Science Fellows.
|
Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, Parkin DM, Forman D and Bray F: Cancer incidence and mortality worldwide: Sources, methods and major patterns in GLOBOCAN 2012. Int J Cancer. 136:E359–E386. 2015. View Article : Google Scholar | |
|
Van Cutsem E, Moiseyenko VM, Tjulandin S, Majlis A, Constenla M, Boni C, Rodrigues A, Fodor M, Chao Y, Voznyi E, et al; V325 Study Group. Phase III study of docetaxel and cisplatin plus fluorouracil compared with cisplatin and fluorouracil as first-line therapy for advanced gastric cancer: A report of the V325 Study Group. J Clin Oncol. 24:4991–4997. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Cunningham D, Starling N, Rao S, Iveson T, Nicolson M, Coxon F, Middleton G, Daniel F, Oates J and Norman AR; Upper Gastrointestinal Clinical Studies Group of the National Cancer Research Institute of the United Kingdom. Capecitabine and oxaliplatin for advanced esophagogastric cancer. N Engl J Med. 358:36–46. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Koizumi W, Narahara H, Hara T, Takagane A, Akiya T, Takagi M, Miyashita K, Nishizaki T, Kobayashi O, Takiyama W, et al: S-1 plus cisplatin versus S-1 alone for first-line treatment of advanced gastric cancer (SPIRITS trial): A phase III trial. Lancet Oncol. 9:215–221. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Bang YJ, Van Cutsem E, Feyereislova A, Chung HC, Shen L, Sawaki A, Lordick F, Ohtsu A, Omuro Y, Satoh T, et al; ToGA Trial Investigators. Trastuzumab in combination with chemotherapy versus chemotherapy alone for treatment of HER2-positive advanced gastric or gastro-oesophageal junction cancer (ToGA): A phase 3, open-label, randomised controlled trial. Lancet. 376:687–697. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Sakai K, Mori S, Kawamoto T, Taniguchi S, Kobori O, Morioka Y, Kuroki T and Kano K: Expression of epidermal growth factor receptors on normal human gastric epithelia and gastric carcinomas. J Natl Cancer Inst. 77:1047–1052. 1986.PubMed/NCBI | |
|
Yano T, Doi T, Ohtsu A, Boku N, Hashizume K, Nakanishi M and Ochiai A: Comparison of HER2 gene amplification assessed by fluorescence in situ hybridization and HER2 protein expression assessed by immunohistochemistry in gastric cancer. Oncol Rep. 15:65–71. 2006. | |
|
Gravalos C and Jimeno A: HER2 in gastric cancer: A new prognostic factor and a novel therapeutic target. Ann Oncol. 19:1523–1529. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Matsumoto K, Arao T, Hamaguchi T, Shimada Y, Kato K, Oda I, Taniguchi H, Koizumi F, Yanagihara K, Sasaki H, et al: FGFR2 gene amplification and clinicopathological features in gastric cancer. Br J Cancer. 106:727–732. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Kawakami H, Okamoto I, Arao T, Okamoto W, Matsumoto K, Taniguchi H, Kuwata K, Yamaguchi H, Nishio K, Nakagawa K, et al: MET amplification as a potential therapeutic target in gastric cancer. Oncotarget. 4:9–17. 2013.PubMed/NCBI | |
|
Wang K, Yuen ST, Xu J, Lee SP, Yan HH, Shi ST, Siu HC, Deng S, Chu KM, Law S, et al: Whole-genome sequencing and comprehensive molecular profiling identify new driver mutations in gastric cancer. Nat Genet. 46:573–582. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Kakiuchi M, Nishizawa T, Ueda H, Gotoh K, Tanaka A, Hayashi A, Yamamoto S, Tatsuno K, Katoh H, Watanabe Y, et al: Recurrent gain-of-function mutations of RHOA in diffuse-type gastric carcinoma. Nat Genet. 46:583–587. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Johnson GL and Lapadat R: Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science. 298:1911–1912. 2002. View Article : Google Scholar : PubMed/NCBI | |
|
Roberts PJ and Der CJ: Targeting the Raf-MEK-ERK mitogen-activated protein kinase cascade for the treatment of cancer. Oncogene. 26:3291–3310. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, Teague J, Woffendin H, Garnett MJ, Bottomley W, et al: Mutations of the BRAF gene in human cancer. Nature. 417:949–954. 2002. View Article : Google Scholar : PubMed/NCBI | |
|
Bollag G, Hirth P, Tsai J, Zhang J, Ibrahim PN, Cho H, Spevak W, Zhang C, Zhang Y, Habets G, et al: Clinical efficacy of a RAF inhibitor needs broad target blockade in BRAF-mutant melanoma. Nature. 467:596–599. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Flaherty KT, Puzanov I, Kim KB, Ribas A, McArthur GA, Sosman JA, O’Dwyer PJ, Lee RJ, Grippo JF, Nolop K, et al: Inhibition of mutated, activated BRAF in metastatic melanoma. N Engl J Med. 363:809–819. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Pao W and Girard N: New driver mutations in non-small-cell lung cancer. Lancet Oncol. 12:175–180. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Estep AL, Palmer C, McCormick F and Rauen KA: Mutation analysis of BRAF, MEK1 and MEK2 in 15 ovarian cancer cell lines: Implications for therapy. PLoS One. 2:e12792007. View Article : Google Scholar : PubMed/NCBI | |
|
Marks JL, Gong Y, Chitale D, Golas B, McLellan MD, Kasai Y, Ding L, Mardis ER, Wilson RK, Solit D, et al: Novel MEK1 mutation identified by mutational analysis of epidermal growth factor receptor signaling pathway genes in lung adenocarcinoma. Cancer Res. 68:5524–5528. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Bentivegna S, Zheng J, Namsaraev E, Carlton VE, Pavlicek A, Moorhead M, Siddiqui F, Wang Z, Lee L, Ireland JS, et al: Rapid identification of somatic mutations in colorectal and breast cancer tissues using mismatch repair detection (MRD). Hum Mutat. 29:441–450. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Sogabe S, Togashi Y, Kato H, Kogita A, Mizukami T, Sakamoto Y, Banno E, Terashima M, Hayashi H, de Velasco MA, et al: MEK inhibitor for gastric cancer with MEK1 gene mutations. Mol Cancer Ther. 13:3098–3106. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Emery CM, Vijayendran KG, Zipser MC, Sawyer AM, Niu L, Kim JJ, Hatton C, Chopra R, Oberholzer PA, Karpova MB, et al: MEK1 mutations confer resistance to MEK and B-RAF inhibition. Proc Natl Acad Sci USA. 106:20411–20416. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Little AS, Balmanno K, Sale MJ, Newman S, Dry JR, Hampson M, Edwards PA, Smith PD and Cook SJ: Amplification of the driving oncogene, KRAS or BRAF, underpins acquired resistance to MEK1/2 inhibitors in colorectal cancer cells. Sci Signal. 4:ra172011.PubMed/NCBI | |
|
Corcoran RB, Dias-Santagata D, Bergethon K, Iafrate AJ, Settleman J and Engelman JA: BRAF gene amplification can promote acquired resistance to MEK inhibitors in cancer cells harboring the BRAF V600E mutation. Sci Signal. 3:ra842010.PubMed/NCBI | |
|
Walters DM, Lindberg JM, Adair SJ, Newhook TE, Cowan CR, Stokes JB, Borgman CA, Stelow EB, Lowrey BT, Chopivsky ME, et al: Inhibition of the growth of patient-derived pancreatic cancer xenografts with the MEK inhibitor trametinib is augmented by combined treatment with the epidermal growth factor receptor/ HER2 inhibitor lapatinib. Neoplasia. 15:143–155. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Sun C, Hobor S, Bertotti A, Zecchin D, Huang S, Galimi F, Cottino F, Prahallad A, Grernrum W, Tzani A, et al: Intrinsic resistance to MEK inhibition in KRAS mutant lung and colon cancer through transcriptional induction of ERBB3. Cell Rep. 7:86–93. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Togashi Y, Sakamoto H, Hayashi H, Terashima M, De Velasco MA, Fujita Y, Kodera Y, Sakai K, Tomida S, Kitano M, et al: Homozygous deletion of the activin A receptor, type IB gene is associated with an aggressive cancer phenotype in pancreatic cancer. Mol Cancer. 13:1262014. View Article : Google Scholar : PubMed/NCBI | |
|
Kaneda H, Arao T, Tanaka K, Tamura D, Aomatsu K, Kudo K, Sakai K, De Velasco MA, Matsumoto K, Fujita Y, et al: FOXQ1 is overexpressed in colorectal cancer and enhances tumorigenicity and tumor growth. Cancer Res. 70:2053–2063. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Hingorani SR, Jacobetz MA, Robertson GP, Herlyn M and Tuveson DA: Suppression of BRAF(V599E) in human melanoma abrogates transformation. Cancer Res. 63:5198–5202. 2003.PubMed/NCBI | |
|
Freeman AK and Morrison DK: Mechanisms and potential therapies for acquired resistance to inhibitors targeting the Raf or MEK kinases in cancer. Molecular Mechanisms of Tumor Cell Resistance to Chemotherapy: Targeted Therapies to Reverse Resistance. Bonavita B: pp. 47–67. 2013, View Article : Google Scholar | |
|
Prahallad A, Sun C, Huang S, Di Nicolantonio F, Salazar R, Zecchin D, Beijersbergen RL, Bardelli A and Bernards R: Unresponsiveness of colon cancer to BRAF(V600E) inhibition through feedback activation of EGFR. Nature. 483:100–103. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Van Schaeybroeck S, Karaiskou-McCaul A, Kelly D, Longley D, Galligan L, Van Cutsem E and Johnston P: Epidermal growth factor receptor activity determines response of colorectal cancer cells to gefitinib alone and in combination with chemotherapy. Clin Cancer Res. 11:7480–7489. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Li T, Ling YH, Goldman ID and Perez-Soler R: Schedule-dependent cytotoxic synergism of pemetrexed and erlotinib in human non-small cell lung cancer cells. Clin Cancer Res. 13:3413–3422. 2007. View Article : Google Scholar : PubMed/NCBI |