Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
October-2015 Volume 47 Issue 4

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2015 Volume 47 Issue 4

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

miRNA-99b-3p functions as a potential tumor suppressor by targeting glycogen synthase kinase-3β in oral squamous cell carcinoma Tca-8113 cells

  • Authors:
    • Kang He
    • Dongdong Tong
    • Si Zhang
    • Donghui Cai
    • Lumin Wang
    • Yang Yang
    • Ling Gao
    • Su'e Chang
    • Bo Guo
    • Tusheng Song
    • Ang Li
    • Chen Huang
  • View Affiliations / Copyright

    Affiliations: Department of Periodontology, Stomatology Hospital of Xi'an Jiaotong University College of Medicine, Xi'an, Shaanxi 710004, P.R. China, Department of Genetics and Molecular Biology, Key Laboratory of Environment and Genes Related to Diseases, College of Medicine, Xi'an Jiaotong University, Xi'an, Shaanxi 710061, P.R. China, Department of Stomatology, First Affiliated Hospital of Xi'an Medical University, Xi'an, Shaanxi 710077, P.R. China, Department of Oral Maxillofacial Surgery, Stomatology Hospital of Xi'an Jiaotong University College of Medicine, Xi'an, Shaanxi 710004, P.R. China
  • Pages: 1528-1536
    |
    Published online on: August 27, 2015
       https://doi.org/10.3892/ijo.2015.3135
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Dysregulation of microRNAs (miRNAs) has been associated with carcinogenesis in oral squamous cell carcinoma (OSCC). In the present study, we investigated the expression and function of miR-99b-3p in human OSCC. We found that the expression levels of miR-99b-3p decreased in 21 clinical OSCC samples (84%). Furthermore, ectopic expression of miR-99b-3p inhibited OSCC cell proliferation by downregulating glycogen synthase kinase-3β (GSK3β), an miR-99b-3p' target gene, at the mRNA and protein levels, both in vitro and in vivo. Moreover, the silencing of GSK3β recapitulated the cellular and molecular effects in a similar manner to the overexpression of miR-99b-3p, which included inhibition of OSCC cell proliferation and suppression of p65 (RelA) and G1 regulators (cyclin D1, CDK4 and CDK6) in vitro. Our data suggest that miR-99b-3p functions as a tumor suppressor in OSCC via GSK3β downregulation.

Introduction

OSCC is the 6th most common malignancy and is a major cause of cancer morbidity and mortality (1). OSCC accounts for ~90% of all oral cancers. Despite the advances in diagnosis and treatment, only ~50% of the patients with OSCC survived for 5 years in the past decade (2). Oral carcinogenesis arises as a result of the activation of some oncogenes or the inactivation of tumor suppressor genes (3). Growing evidence has shown that non-coding small RNAs play an important role in OSCC pathogenesis, which provides new insights into the treatment of this cancer.

MicroRNAs (miRNAs) are an abundant class of short RNAs, which are 19–24 nucleotides in length; miRNAs were shown to affect complementarity by binding at the 3′ untranslated region (UTR) of target genes, resulting in degradation of target mRNAs and inhibition of translation (4). Many studies have shown that miRNA dysregulation occurs in various human diseases, especially cancer. miRNAs are involved in crucial cellular processes, including development, differentiation, proliferation and apoptosis (5). Several studies have suggested that dysregulation of miRNAs, including miR-29b, miR-9, miR-29a, is related with OSCC initiation and development (6–8).

miRNA-99b is a member of the miR-125a~let-7e cluster that is involved in a series of cellular activities such as cell proliferation, differentiation and invasion (9–11). Recent studies have shown that miR-125a expression decreased in non-small cell lung cancer and breast cancer (12,13). Previously, it has been found that miR-99b-3p is expressed in the Helicobacter pylori infection-dependent gastric cancer (14) and that the miR-99b-3p is considered to be a new tumor marker. This predicts the relapse-free survival in patients with the follicular variant of papillary thyroid carcinoma (15). However, the function of miR-99b-3p in cancer, particularly in the pathogenesis of OSCC, has not yet been reported.

The aim of the present study was to determine the role of miR-99b-3p in OSCC. The potential mechanisms underlying the regulation of the biological behavior of OSCC by miR-99b-3p were also investigated. Our findings will contribute to understanding of the function of miR-99b-3p in the progression of OSCC.

Materials and methods

Tissue samples

Formaldehyde-fixed, paraffin-embedded (FFPE) tissue samples were obtained from surgical specimens from 25 patients (15 male, 10 female, 59.07±10.69 and 53.62±15.29 years of age, respectively) diagnosed with OSCC, between January 1987 and June 2011 at the Stomatological Hospital, College of Medicine, Xi'an Jiaotong University (Table I). Before the operation none of the patients had received radiotherapy or chemotherapy. The non-tumor tissues were taken more than 2 cm from the tumor to be used as controls and were confirmed by an experienced pathologist. The study was approved by our institutional review board, and an informed consent was given by all the patients.

Table I

Relationship between clinicopathological factors and miR-99b-3p expression levels.

Table I

Relationship between clinicopathological factors and miR-99b-3p expression levels.

CharacteristicsNo. of casesmiR-99b-3p expressionP-value

HighLow
Age (years)0.260
 ≥60909
 <6016412
Gender0.656
 Male15213
 Female1028
Histology0.357
 Well17314
 Moderate523
 Poor303
pTNM stage0.552
 I918
 II514
 III211
 IV918
Cell lines

Tca-8113, established in Ninth People's Hospital, Shanghai Second Medical University in 1981, was purchased from the Shanghai GeneChem Co., Ltd. (Shanghai, China) and grown in RPMI-1640 medium (PAA Laboratories GmbH) supplement with 10% FBS (PAA Laboratories GmbH) at 37°C in a humidified atmosphere of 95% air and 5% CO2.

Quantitative real-time reverse transcription PCR

Total RNA from Tca-8113 cells and prepared tissues sample was isolated using the TRIzol reagent (Invitrogen) and RecoverAll™ Total Nucleic Acid Isolation kit (Ambion, Austin, TX, USA) according to the manufacturer's protocol. The cDNA was synthesized according to the manufacturer's protocol (MBI Fermentas). Quantitative real-time PCR (qRT-PCR) was performed using a Maxima SYBR-Green qPCR Master Mixes (MBI Fermentas) and PCR-specific amplification was conducted in the Roche LightCycler® 480 II real-time PCR. The relative expression of genes (miR-99b-3p, U6, GSK3B and β-actin) was calculated with the 2−ΔΔCt method (16). The primers used are: qRT-PCR, miR-99b-3p-F5′-ATCC AGTGCGTGTCGTG-3′, miR-99b-3p-R5′-TGCTCAAGCT CGTGTCTGT-3′; GSK3β-F5′-CCTCTGGCTACCATCCT TATTC-3′, GSK3β-R5′-TTATTGGTCTGTCCACGGT CTC-3′; U6-F5′-TGCGGGTGCTCGCTTCGGCAGC-3′, U6-R5′-CCAGTGCAGGGTCCGAGGT-3′; β-actin-F5′-CG TGACATTAAGGAGAAGCTG-3′, β-actin-R5′-CTAGAAG CATTTGCGGTGGAC-3′.

Construction of expression plasmids

The miR-99b-3p expression vector (pre-miR-99b) and control vector were constructed with synthetic oligonucleotides and cloned between the EcoRI and HindIII sites of the pcDNA6.2-GW/EmGFP vector (Invitrogen): pre-miR-99b-F′-AATTCGGCACCCACCCG TAGAACCGACCTTGCGGGGCCTTCGCCGCACACAAG CTCGTGTCTGTGGGTCCGTGTCA-3′; R-5′-AGCTTGAC ACGGACCCACAGACACGAGCTTGTGTGCGGCGAAGG CCCCGCAAGGTCGGTTCTACGGGTGGGTGCCG-3′. Primers contained 5′EcoRI and 3′HindIII restriction sites to facilitate cloning into the vector. The inhibitor of miR-99b-3p and small interfering RNA (siRNA) targeting GSK3β were purchased from GenePharma. The siRNA-GSK3B target sequence GAUGAGGUCUAUCUUAAUC (nt:1353–1371) (17).

Bioinformatic analysis

The information of human miR-99b-3p was registered, and obtained from miRBase (http://www.miRBase.org/). We used the publicly available programs: RegRNA(http://regrna.mbc.nctu.edu.tw/), miRanda(http://www.microrna.org/) to acquire the prediction of miRNA targets.

Stable transfection of miR-99b expression vector

The day before transfection, Tca-8113 cells were plated in antibiotic-free medium at ~25%. Pre-miR-99b and control vector were transfected into Tca-8113 cells using LipoFiter™ (Hanbio, Shanghai, China) in accordance with the manufacturer's procedure, cultured by selection with 8 μg/ml blasticidin (Invitrogen) containing medium for 2 weeks. Single cell clones were picked and cultured in medium (RPIM-1640) containing 4 μg/ml blasticidin for further study. The expression level of miR-99b-3p in transfected Tca-8113 cells was identified by quantitative real-time PCR after further selection and expansion.

Lentivirus infection

Lentivirus Luc was synthesized by Shanghai GeneChem. Stability enhanced pre-miR-99b Tca-8113 cells were infected by lentiviruses according to the manufacturer's protocol.

Cell proliferation assay

The Tca-8113 cells (5,000 cells/well) were seeded into 96-well plates with 200 μl of 1640 medium, and cultured 24–72 h after transfecting with vector control, pre-miR-99b expression vector, inhibitor control, miR-99b-3p inhibitor, siRNA control and GSK3β siRNA. Cells washed with warm DMEM and MTT (Sigma) working solution were incubated at 37°C for 4 h. Using acidic isopropanol (0.04 M HCl in absolute isopropanol) solubilized the converted dye. Absorbance of the converted dye was measured at a wavelength of 490 nm with FLUOstar Optima (BMG).

Cell cycle analysis

The Tca-8113 cells at 1×106 cells/well were cultured in 12-well plates in triplicate and transfected with DNA vectors or siRNAs for 24 h. Cells were harvested by trypsinization, then washed in PBS, and fixed in ice-cold ethanol at 4°C overnight. Then cells were washed twice in PBS and incubated in 1 ml of staining solution (20 mg/ml propidium iodide and 10 U/ml RNaseA) for 30 min at room temperature. Cell cycle distribution was evaluated by fluorescence-activated cell sorting by flow cytometry (FACSort; Becton-Dickinson).

Dual luciferase assay

HEK293 cells were seeded in a 96-well plate at a density of 1×104 cells/well one day before transfection. miR-99b-3p expression vector was co-transfected with wild or mutated 3′-UTR of GSK3β reporter constructs and a blank pmirGLO Dual-luciferase as a positive control group. After 24 h, the Dual-luciferase reporter assay system (Promega) was used to measure the reporter activity according to the manufacturer's protocol.

Colony formation assay

The transfected Tca-8113 cells were seeded into 6-well plates at a density of 1,000/well, incubated for two weeks. Colonies were then stained with 0.1% crystal violet for 30 min, counted and normalized to the control group.

Western blot analysis

All Tca-8113 cells or tissue were lysed using RIPA buffer, supplemented with protease inhibitor (Invitrogen). Protein was then separated with 10% SDS polyacrylamide gels, and electrophoretically transferred to polyvinylidene difluoride membrane (Millipore). The membrane was incubated with primary antibodies to GSK3β (Abcam; antibody dilutions: 1:1,500), p65, cyclin D1, CDK4, CDK6, Lamin B1 (Proteintech, antibody dilutions: 1:1,000), β-actin antibody (CST, antibody dilutions: 1:2,000). The blots were scanned and the band density was measured on Quantity One imaging software.

Immunohistochemistry

Immunohistochemistry (IHC) was performed according to the methods previously described (18). The tissue sections were incubated in the primary antibodies overnight. Staining intensity was assessed by Leica Q550 image analysis system.

In vivo tumor xenograft model

Six-week-old male nude mice (BALB/c-nude) were used to analyse tumorigenicity. Tca-8113 cells were stably tranfected with pre-miR-99b and control vector which were infected with LV-Luc and resuspended in PBS, then 1×107 cells were injected subcutaneously into both posterior flanks of nude mice. Tumor size was measured every 3 days. At 18 days after injection, mice from the pre-miR-99b group (n=3) and control group (n=3) were subjected in vivo to endpoint experiments, the bioluminescence images in vivo were obtained by the system of photobiology (Xenogen).

Statistical analysis

We repeated each experiment at least 3 times independently. Numercial data are presented as mean ± SD. Differences between 2 groups were calculated with the Student's t-test (two-tailed). The associations between clinicopathological factors and miR-99b-3p levels were analyzed using the Chi-square test. P<0.05 was considered to be significant.

Results

Aberrant miR-99b-3p expression in human OSCC

To validate the expression of miR-99b-3p in human OSCC, we analyzed the expression of miR-99b-3p in 25 paired human OSCC tissue samples and adjacent non-cancerous oral mucosa using real-time PCR. Compared with their peritumor counterparts, we observed significant downregulation of miR-99b-3p in 84% (21/25) of the OSCC samples (Fig. 1A). Moreover, miR-99b-3p was significantly downregulated in Tca-8113 cells compared with normal human oral epithelial cells (Fig. 1B). This indicated that the miR-99b-3p may play a role as a tumor suppressor in the OSCC. Therefore, we analyzed the relationship between miR-99b-3p levels and clinicopathological factors in OSCC samples (Table I). There was no significant difference between low expression of miR-99b-3p and clinicopathological factors such as age (P=0.260), gender (P=0.656), histology (P=0.357) and pT stage (P=0.552).

Figure 1

Low expression of miR-99b-3p in 25 oral squamous cell carcinoma (OSCC) tissue samples and OSCC cell line (Tca-8113) compared with non-cancerous samples and normal human oral epithelial cells. Overexpression and inhibition of miR-99b-3p affect OSCC progression in vitro: (A) expression of miR-99b-3p in OSCC tissue samples (84% OSCC tissue is upregulation), (B) expression of miR-99b-3p in Tca-8113 cell line. (*P<0.05, Student's t-test). (C) qRT-PCR analysis of miR-99b-3p in Tca-8113 cells transfected with pre-miR-99b overexpression construct and empty vector. (D and E) The effects of pre-miR-99b vector or miR-99b-3p inhibitor on Tca-8113 cell proliferation were determined by MTT assay at 24, 48 and 72 h after transfection with pre-miR-99b or miR-99b-3p inhibitor, with empty vector or ASO-NC, respectively. (F and G) Histogram represented the percentage of cells in G0-G1, S, and G2-M cell cycle phases after transfection for 48 h based on the flow cytometric analysis. (H) Representative micrographs of crystal violet-stained cell colonies were analyzed by colony formation assay at day 14 after transfection. (I) Expression of the cell cycle regulators transfected by pre-miR-99b or miR-99b-3p inhibitor in Tca-8113 was analysis by western blot experiments.

Overexpression of miR-99b-3p suppresses Tca-8113 cell growth and induces G1-S arrest in vitro

To explore the role of miR-99b-3p in OSCC, Tca-8113 cells were transfected with an miR-99b precursor overexpression vector or negative controls. The efficiency of vector transfection was monitored with a GFP-label and an average of 70% efficiency was observed at a concentration of 100 nmol/l without causing obvious cell toxicity. qRT-PCR was performed to determine the expression levels of miR-99b-3p after transfection of the miR-99b-3p precursor construct vector. The results showed that the expression of miR-99b-3p in the pre-miR-99b-transfected cells was ~8-fold higher than that in the control vector-transfected cells (Fig. 1C). The MTT assay and colony formation assay indicated significant inhibition of cell growth and colony formation after pre-miR-99b transfection, as compared to that seen for cells transfected with the empty vector (Fig. 1D and H). The next cell cycle experiment demonstrated that miR-99b-3p overexpression caused cell cycle arrest at G1-S in Tca-8113 cells (Fig. 1F). To further explore the potential molecular mechanisms of miR-99b-3p-induced cell proliferation and cell cycle arrest, we analyzed the protein levels of related G1 regulators after miR-99b-3p overexpression in Tca-8113 by using western blot analysis. Our results showed that miR-99b-3p expression may reduce the expression of cyclin D1, CDK4, and CDK6, which are the essential regulators of the G1-S phase transition (Fig. 1I).

Loss-of-function studies were also performed by using anti-miR-99b-3p oligonucleotides to silence the expression of miR-99b-3p (Fig. 1E, G and H). Unexpectedly, inhibition of miR-99b-3p could only slightly increase the expression of these proteins in Tca-8113 cells (Fig. 1I). The low expression of endogenous miR-99b-3p in Tca-8113 cells may account for this phenomenon. These results suggest that miR-99b-3p inhibits the proliferation of Tca-8113 cells and arrests the cell cycle by controlling cell cycle-related gene expression.

GSK3β is a direct target gene of miR-99b-3p

We searched the bioinformatic databases RegRNA and miRanda, and identified a large number of potential target genes of miR-99b-3p. GSK3β was selected for further analysis among these candidate genes. As shown in Fig. 2A, the binding site at the GSK3β 3′-untranslated region (UTR) is displayed. To confirm whether miR-99b-3p directly targets GSK3β, we constructed 3′UTR fragments of GSK3β (WT/MT) and a binding site for miR-99b-3p, which was subcloned into the pmirGLO Dual-luciferase reporter vector. HEK293 cells were cotransfected with pre-miR-99b, pmirGLO control vector, and a reporter plasmid (GSK3β WT- or MT-3′ UTR). Consequently, pre-miR-99b/GSK3β (WT)_UTR transfected cells showed significant reduction (~40%) of luciferase activity (Fig. 2B), which suggested that miR-99b-3p could suppress gene expression through its binding sequences at the 3′UTR of GSK3β.

Figure 2

GSK3β is experimentally validated as a direct target of miR-99b-3p in Tca-8113 cell line. (A) Wild-type or mutant miR-99b target sequences of the GSK3β 3′UTR. (B) Luciferase assay in HEK293 cells. Pre-miR-99b was cotransfected with target gene reporter construct (WT or MT version of pGLO constructs) or NS-control. Relative repression of luciferase expression was standardized to β-gal signal. Luciferase activity in pGLO-GSK3β-WT group was statistically decreased following ectopic expression of miR-99b-3p. (C) GSK3β protein expression level in Tca-8113 was measured by western blot analysis 48 h after transfection with pre-miR-99b vector or miR-99b-3p inhibitor. (D and E) Expression of GSK3β was determined by western blot analysis and immunohistochemical in OSCC tissues and their corresponding non-tumorous oral mucosa. (F) qRT-PCR were performed to determine the expression level of GSK3β after transfection of pre-miR-99b vector (*P<0.05, Student's t-test). (G and H) The protein expression level of p65 was detected by immunofluorescence staining and western blot analysis after transfection with pre-miR-99b vector for 48 h.

GSK3β is dysregulated in OSCC cancer cell lines and tissues

We used the Oncomine cancer microarray database, which enabled multiple comparisons among different studies, to analyze the expression profile of GSK3β mRNA in OSCC tissue. In 6 studies, OSCC tissue samples had higher GSK3β expression than normal tissue. These results showed that GSK3β expression was correlated with OSCC progress (Table II) (19–24). The protein level of GSK3β was examined in paired OSCC tissues from 3 cases by western blot analysis and immunohistochemistry. As Fig. 2D and E show, GSK3β protein levels were significantly higher in OSCC tissue than in paired adjacent tissues. Compared to the findings for control vector-transfected cells, significant reduction in GSK3β and p65 expression was observed in Tca-8113 cells when transfected with miR-99b-3p precursor (Fig. 2C, G and H). These results indicated that miR-99b-3p might directly target the 3′UTR of GSK3β mRNA and inhibit GSK3β translation. Alteration in the p65 protein expression level occurred in both the cell cytoplasm and the nucleus.

Table II

Expression of GSK3β in human normal mouth mucosa tissue and OSCC carcinoma.

Table II

Expression of GSK3β in human normal mouth mucosa tissue and OSCC carcinoma.

Cancer vs. normal (sample number)Correlation (up/down)Fold changeP-valueRef.
Tongue squamous cell carcinoma (31) vs. tongue (26)↑1.7276.19E-10(19)
Tongue squamous cell carcinoma (31) vs. tongue (26)↑1.9476.47E-9(20)
Tongue squamous cell carcinoma (26) vs. tongue (12)↑1.9803.76E-5(21)
Tongue squamous cell carcinoma (3) vs. mucosa (22)↑1.2590.049(22)
Oral cavity squamous cell carcinoma (4) vs. squamous cell (16)↑1.3410.031(23)
Oral cavity squamous cell carcinoma (57) vs. oral cavity (22)↑1.1970.002(24)

[i] Data were provided by the cancer microarray database Oncomine (www.oncomine.org).

Silencing of GSK3β suppresses Tca-8113 cell growth and induces G1-S arrest, similarly to miR-99b-3p

Next, we used RNA interference (RNAi) methods to silence GSK3β expression to determine whether GSK3β was involved in the antitumor effects of miR-99b-3p. GSK3β could be specifically knocked down by siRNA (Fig. 3A and E). Moreover, silencing of GSK3β suppressed the growth and proliferation of Tca-8113 cells and induced G1-S arrest, which is similar to the role of miR-99b-3p in Tca-8113 cells (Fig. 3B–D). Next, we analyzed protein levels of related G1 regulators after silencing the GSK3β in Tca-8113 cells in western blot analysis. As shown in Fig. 3E, the expression of NF-κB (p65) was suppressed by si-GSK3β (Fig. 3E and F). For cell cycle regulation, si-GSK3β may reduce the expression of cyclin D1, CDK4, and CDK6, which are the essential regulators of the G1-S phase transition. Thus, we speculate that GSK3β and p65 dysregulation in OSCC may promote OSCC tumorigenesis.

Figure 3

Silencing of GSK3β suppresses Tca-8113 growth and induces G1-S arrest. (A) qRT-PCR was performed to determine the expression level of GSK3β after transfection with GSK3β siRNA. (B–D) MTT assay/cell cycle/clone formation were performed to determine the impact of Tca-8113 cells treated with siRNA of GSK3β. (E and F) Expression analysis for GSK3β and p65 proteins expression in Tca-8113 cells at 48 h after transfected with control siRNA or GSK3β siRNA by western blot analysis and immunofluorescence staining. β-actin and lamin B1 was used as a housekeeping control. Statistical differences were analyzed with the Wilcoxon signed-rank test (*P<0.05; Student's t-test).

miR-99b-3p inhibits OSCC tumor growth in vivo

To further confirm the growth-inhibitory function of miR-99b-3p in OSCC, we tested the effects of miR-99b-3p on tumor growth in an in vivo xenograft model. Cells from stably transfected cell lines developed from miR-99b-3p- and miR-control-transfected Tca-8113 cells were injected subcutaneously into the posterior flank of the same nude mice. After injection, palpable tumors developed at 1 week and were measured every 3 days. As shown in Fig. 4A–C, tumor growth was significantly suppressed by pre-miR-99b-treated cells as compared to that seen for control vector-treated cells, during the experiments. This trend was confirmed by the size and weight of tumors excised from the animals. On day 18, the average volume of pre-miR-99b-treated tumors was lesser than that for the control group. The average tumor weights for the control and the miR-99b-3p groups on day 27 were 1.35 g and 0.84 g, respectively. Next, we assessed the expression levels of miR-99b-3p and GSK3β in the tumor tissues by qRT-PCR and western blot analyses. We found that the tumors transfected with pre-miR-99b had an ~4-fold increase in miR-99b-3p, as compared to the control group (Fig. 4D). The in vivo data showed that the expression level of NF-κB (p65), cyclin D1, CDK4 and CDK6 proteins all decreased in pre-miR-99b-treated tumors, which was consistent with the in vitro data (Fig. 4F). These data indicated that miR-99b-3p expression is capable of inhibiting tumor growth by inhibiting GSK3β expression levels in vivo.

Figure 4

miR-99b-3p inhibits Tca-8113 cells progression in vivo. (A) At day 18, small animal imaging analysis was used to assess the tumor volume in situ during the tumor development. (A) The flanks of nude mice were injected with NC-transfected (left flank) and miR-99b-transfected cells (right flank) in 3 nude mice, respectively. (B) The gross morphology of tumors showed the morphology of mice injected with miR-99b and miR-ctrl. (C) At day 18 after the first measure, the mice were anesthetized and sacrificed at the experimental endpoint and tumors infected with pre-miR-99b and control vector were weighted. (D) The expression levels of miR-99b-3p were detected by qRT-PCR analysis in the tumor tissues from the nude mice. (E) Tumor growth curves. (F) Overexpression of miR-99b-3p in the xenografts decreased the GSK3β protein level and subsequently reduced the expression of p65 and G1 regulators as determined using western blot analysis.

Discussion

During the past 10 years, dysregulation of miRNAs has been reported to be a common event that controls cell proliferation (25), cell cycle (26) and metastasis (27) in OSCC. The miR-99b gene, located on chromosome 19q13.41, produces two mature forms (miR-99b-3p and miR-99b-5p). Some recent reports suggested that miR-99b-5p could influence the sensitivity of pancreatic cancer cells to radiotherapy and suppress the growth rate of lung cancer (28,29). Very little research has been focused on miR-99b-3p, except for the study by Chang et al (14) and Dettmer et al (15) showing that miRNA-99b-3p is correlated with papillary thyroid carcinoma and H. pylori-positive gastric cancer. In the present study, we found that miR-99b-3p was commonly downregulated in OSCC tissue samples and Tca-8113 cells, indicating that miR-99b-3p might be a novel tumor suppressor miRNA. In a series of cell experiments, gain and loss of function studies showed that miR-99b-3p was able to inhibit cell proliferation by arresting cells in the G1-S transition in vitro. The luciferase assay showed that GSK3β is a direct target of miR-99b-3p in OSCC.

Oncomine algorithms were utilized in a preliminary study to confirm higher expression of GSK3β in OSCC as compared to that in normal mucosa, which concurred with our experimental result. GSK3β is an isoform splice variant of GSK3, which has been reported to phosphorylate over a dozen transcription factors (30). GSK3β is recognized as an important component in a large number of cellular processes and diseases. The exact physiological effect of GSK3β in cancer is unclear, but accumulated data have shown that GSK3β plays an important role in tumorigenesis. Dysregulation of GSK3β, that is, either overexpression (31) or inhibition (32,33) by a pharmacological inhibitor, is a frequent oncogenic event in human mechanisms. Several studies support that GSK3β functions as a tumor suppressor. The tumor suppressor action is exemplified by GSK3β-mediated phosphorylation and subsequent degradation of β-catenin, which is a transcriptional co-activator that often promotes cellular proliferation (34). However, some studies suggest that GSK3β may promote tumorigenesis. The expression of GSK3β is upregulated in multiple cancers, including ovarian, pancreatic and colorectal cancers (31,33,35). GSK3β regulates cell proliferation via activation of NF-κB-dependent gene transcription in ovarian and pancreatic cancers (31). p65(RelA) is one of the subunits of NF-κB, which is capable of mediating interactions with basal transcription factors and cofactors (36). p65 is typically sequestered in the cell cytoplasm by IκB proteins (37). It has been reported that GSK3β is a key component involved in inducing activation of the IKK complex and degradation of IκB in pancreatic cancer cells (32). After degradation of IκB proteins, the released p65 proteins are further activated, and they translocate to the nucleus where they bind to specific DNA sequences and promote transcription of target genes (38,39). p65 is necessary for the positive regulation of gene expression through cyclin D1, CDK4 and CDK6 (40–42). These 3 proteins could be considered as active cell cycle regulators. When quiescent cells are stimulated to enter the cell cycle, expression of cyclin D1 promotes progression through the G1 phase through association and activation of CDK4 and CDK6 (43). In our research, GSK3β expression was inversely correlated with miR-99b-3p. GSK3β inhibition by siRNA had the same effect on OSCC cell growth as overexpression of miR-99b-3p. Our data are consistent with recent studies on the regulation of cell proliferation by GSK3β though an NF-κB-dependent pathway, as we observed that the manipulation of GSK3β expression may result in suppression of p65 and decrease in the expression of cell cycle proteins (cyclin D1, CDK4 and CDK6).

Our findings suggest that miR-99b-3p may function as a cell cycle suppressor by targeting GSK3β in Tca-8113 cells. The above results suggest that miR-99b-3p may act as a therapeutic intervention in Tca-8113 cells. Further animal studies indicate that miR-99b-3p can suppress the growth of OSCC xenografts in nude mice and the expression of GSK3β in tumors. Our observations that miR-99b-3p targets GSK3β and suppresses Tca-8113 cells growth in vitro are also supported by the in vivo studies.

In conclusion, to the best of our knowledge, the present study is the first to report downregulation of miR-99b-3p in Tca-8113 cells and clinical samples. Moreover, we explored the role of miR-99b-3p, its target gene GSK3β, and their potential molecular mechanisms in suppressing tumorigenicity of OSCC. These data suggest that miR-99b-3p may be a novel tumor suppressor that inhibits the growth of OSCC through NF-κB signaling pathways by targeting GSK3β (Fig. 5). Thus, miR-99b-3p could provide a potential therapeutic strategy for the treatment of OSCC in the future.

Figure 5

Proposed model for the effects of miR-99b-3p-mediated GSK3β on the NF-κB pathways, and suppression of proliferation. GSK3β is important for the activation of direct IκB phosphorylation and degradation. p65(RelA) translocates into the nuclei to activate the transcription of cyclin D1, CDK4 and CDK6. As a result of the cyclin activation, the NF-κB pathway is involved in promoting proliferation.

Acknowledgements

The present study was financially supported by the Key Science and Technology Major Program of Shaanxi Province, China (2010ZDKG-50), the National Natural Science Foundation of China (81171398 and 31100921), and The Program for Chang Jiang Scholars and Innovative Research Team in University (PCSIRT; 1171).

References

1 

Parkin DM, Bray F, Ferlay J and Pisani P: Estimating the world cancer burden: Globocan 2000. Int J Cancer. 94:153–156. 2001. View Article : Google Scholar : PubMed/NCBI

2 

Funk GF, Karnell LH, Robinson RA, Zhen WK, Trask DK and Hoffman HT: Presentation, treatment, and outcome of oral cavity cancer: A National Cancer Data Base report. Head Neck. 24:165–180. 2002. View Article : Google Scholar : PubMed/NCBI

3 

Croce CM: Oncogenes and cancer. N Engl J Med. 358:502–511. 2008. View Article : Google Scholar : PubMed/NCBI

4 

Bartel DP: MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 116:281–297. 2004. View Article : Google Scholar : PubMed/NCBI

5 

Karp X and Ambros V: Developmental biology. Encountering microRNAs in cell fate signaling. Science. 310:1288–1289. 2005. View Article : Google Scholar : PubMed/NCBI

6 

Yang CN, Deng YT, Tang JY, Cheng SJ, Chen ST, Li YJ, Wu TS, Yang MH, Lin BR, Kuo MY, et al: MicroRNA-29b regulates migration in oral squamous cell carcinoma and its clinical significance. Oral Oncol. 51:170–177. 2015. View Article : Google Scholar

7 

Yu T, Liu K, Wu Y, Fan J, Chen J, Li C, Yang Q and Wang Z: MicroRNA-9 inhibits the proliferation of oral squamous cell carcinoma cells by suppressing expression of CXCR4 via the Wnt/β-catenin signaling pathway. Oncogene. 33:5017–5027. 2014. View Article : Google Scholar

8 

Lu L, Xue X, Lan J, Gao Y, Xiong Z, Zhang H, Jiang W, Song W and Zhi Q: MicroRNA-29a upregulates MMP2 in oral squamous cell carcinoma to promote cancer invasion and anti-apoptosis. Biomed Pharmacother. 68:13–19. 2014. View Article : Google Scholar

9 

Mitra D, Das PM, Huynh FC and Jones FE: Jumonji/ARID1 B (JARID1B) protein promotes breast tumor cell cycle progression through epigenetic repression of microRNA let-7e. J Biol Chem. 286:40531–40535. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Zhu WY, Luo B, An JY, He JY, Chen DD, Xu LY, Huang YY, Liu XG, Le HB and Zhang YK: Differential expression of miR-125a-5p and let-7e predicts the progression and prognosis of non-small cell lung cancer. Cancer Invest. 32:394–401. 2014. View Article : Google Scholar : PubMed/NCBI

11 

Ninio-Many L, Grossman H, Levi M, Zilber S, Tsarfaty I, Shomron N, Tuvar A, Chuderland D, Stemmer SM, Ben-Aharon I, et al: MicroRNA miR-125a-3p modulates molecular pathway of motility and migration in prostate cancer cells. Oncoscience. 1:250–261. 2014.

12 

Jiang L, Huang Q, Zhang S, Zhang Q, Chang J, Qiu X and Wang E: Hsa-miR-125a-3p and hsa-miR-125a-5p are downregulated in non-small cell lung cancer and have inverse effects on invasion and migration of lung cancer cells. BMC Cancer. 10:3182010. View Article : Google Scholar : PubMed/NCBI

13 

O'Day E and Lal A: MicroRNAs and their target gene networks in breast cancer. Breast Cancer Res. 12:2012010. View Article : Google Scholar : PubMed/NCBI

14 

Chang H, Kim N, Park JH, Nam RH, Choi YJ, Lee HS, Yoon H, Shin CM, Park YS, Kim JM, et al: Different microRNA expression levels in gastric cancer depending on Helicobacter pylori infection. Gut Liver. 9:188–196. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Dettmer M, Perren A, Moch H, Komminoth P, Nikiforov YE and Nikiforova MN: Comprehensive MicroRNA expression profiling identifies novel markers in follicular variant of papillary thyroid carcinoma. Thyroid. 23:1383–1389. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−ΔΔC(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar

17 

Grassilli E, Narloch R, Federzoni E, Ianzano L, Pisano F, Giovannoni R, Romano G, Masiero L, Leone BE, Bonin S, et al: Inhibition of GSK3B bypass drug resistance of p53-null colon carcinomas by enabling necroptosis in response to chemotherapy. Clin Cancer Res. 19:3820–3831. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Lai KW, Koh KX, Loh M, Tada K, Subramaniam MM, Lim XY, Vaithilingam A, Salto-Tellez M, Iacopetta B, Ito Y, et al; Singapore Gastric Cancer Consortium. MicroRNA-130b regulates the tumour suppressor RUNX3 in gastric cancer. Eur J Cancer. 46:1456–1463. 2010. View Article : Google Scholar : PubMed/NCBI

19 

Talbot SG, Estilo C, Maghami E, Sarkaria IS, Pham DK, O-charoenrat P, Socci ND, Ngai I, Carlson D, Ghossein R, et al: Gene expression profiling allows distinction between primary and metastatic squamous cell carcinomas in the lung. Cancer Res. 65:3063–3071. 2005.PubMed/NCBI

20 

Estilo CL, O-charoenrat P, Talbot S, Socci ND, Carlson DL, Ghossein R, Williams T, Yonekawa Y, Ramanathan Y, Boyle JO, et al: Oral tongue cancer gene expression profiling: Identification of novel potential prognosticators by oligonucleotide microarray analysis. BMC Cancer. 9:112009. View Article : Google Scholar : PubMed/NCBI

21 

Ye H, Yu T, Temam S, Ziober BL, Wang J, Schwartz JL, Mao L, Wong DT and Zhou X: Transcriptomic dissection of tongue squamous cell carcinoma. BMC Genomics. 9:692008. View Article : Google Scholar : PubMed/NCBI

22 

Kuriakose MA, Chen WT, He ZM, Sikora AG, Zhang P, Zhang ZY, Qiu WL, Hsu DF, McMunn-Coffran C, Brown SM, et al: Selection and validation of differentially expressed genes in head and neck cancer. Cell Mol Life Sci. 61:1372–1383. 2004. View Article : Google Scholar : PubMed/NCBI

23 

Toruner GA, Ulger C, Alkan M, Galante AT, Rinaggio J, Wilk R, Tian B, Soteropoulos P, Hameed MR, Schwalb MN, et al: Association between gene expression profile and tumor invasion in oral squamous cell carcinoma. Cancer Genet Cytogenet. 154:27–35. 2004. View Article : Google Scholar : PubMed/NCBI

24 

Peng CH, Liao CT, Peng SC, Chen YJ, Cheng AJ, Juang JL, Tsai CY, Chen TC, Chuang YJ, Tang CY, et al: A novel molecular signature identified by systems genetics approach predicts prognosis in oral squamous cell carcinoma. PLoS One. 6:e234522011. View Article : Google Scholar : PubMed/NCBI

25 

Tiwari A, Shivananda S, Gopinath KS and Kumar A: MicroRNA-125a reduces proliferation and invasion of oral squamous cell carcinoma cells by targeting estrogen-related receptor α: Implications for cancer therapeutics. J Biol Chem. 289:32276–32290. 2014. View Article : Google Scholar : PubMed/NCBI

26 

Shao Y, Qu Y, Dang S, Yao B and Ji M: MiR-145 inhibits oral squamous cell carcinoma (OSCC) cell growth by targeting c-Myc and Cdk6. Cancer Cell Int. 13:512013. View Article : Google Scholar : PubMed/NCBI

27 

Liu C, Wang Z, Wang Y and Gu W: MiR-338 suppresses the growth and metastasis of OSCC cells by targeting NRP1. Mol Cell Biochem. 398:115–122. 2015. View Article : Google Scholar

28 

Kang J, Lee SY, Lee SY, Kim YJ, Park JY, Kwon SJ, Na MJ, Lee EJ, Jeon HS and Son JW: microRNA-99b acts as a tumor suppressor in non-small cell lung cancer by directly targeting fibroblast growth factor receptor 3. Exp Ther Med. 3:149–153. 2012.PubMed/NCBI

29 

Wei F, Liu Y, Guo Y, Xiang A, Wang G, Xue X and Lu Z: miR-99b-targeted mTOR induction contributes to irradiation resistance in pancreatic cancer. Mol Cancer. 12:812013. View Article : Google Scholar : PubMed/NCBI

30 

Jope RS and Johnson GV: The glamour and gloom of glycogen synthase kinase-3. Trends Biochem Sci. 29:95–102. 2004. View Article : Google Scholar : PubMed/NCBI

31 

Cao Q, Lu X and Feng YJ: Glycogen synthase kinase-3β positively regulates the proliferation of human ovarian cancer cells. Cell Res. 16:671–677. 2006. View Article : Google Scholar : PubMed/NCBI

32 

Ougolkov AV, Fernandez-Zapico ME, Savoy DN, Urrutia RA and Billadeau DD: Glycogen synthase kinase-3beta participates in nuclear factor kappaB-mediated gene transcription and cell survival in pancreatic cancer cells. Cancer Res. 65:2076–2081. 2005. View Article : Google Scholar : PubMed/NCBI

33 

Ougolkov AV, Fernandez-Zapico ME, Bilim VN, Smyrk TC, Chari ST and Billadeau DD: Aberrant nuclear accumulation of glycogen synthase kinase-3beta in human pancreatic cancer: Association with kinase activity and tumor dedifferentiation. Clin Cancer Res. 12:5074–5081. 2006. View Article : Google Scholar : PubMed/NCBI

34 

Polakis P: The many ways of Wnt in cancer. Curr Opin Genet Dev. 17:45–51. 2007. View Article : Google Scholar : PubMed/NCBI

35 

Kang T, Wei Y, Honaker Y, Yamaguchi H, Appella E, Hung MC and Piwnica-Worms H: GSK-3 β targets Cdc25A for ubiquitin-mediated proteolysis, and GSK-3 β inactivation correlates with Cdc25A overproduction in human cancers. Cancer Cell. 13:36–47. 2008. View Article : Google Scholar : PubMed/NCBI

36 

Perkins ND: The diverse and complex roles of NF-κB subunits in cancer. Nat Rev Cancer. 12:121–132. 2012.PubMed/NCBI

37 

Johnson J, Shi Z, Liu Y and Stack MS: Inhibitors of NF-kappaB reverse cellular invasion and target gene upregulation in an experimental model of aggressive oral squamous cell carcinoma. Oral Oncol. 50:468–477. 2014. View Article : Google Scholar : PubMed/NCBI

38 

Hayden MS and Ghosh S: Shared principles in NF-kappaB signaling. Cell. 132:344–362. 2008. View Article : Google Scholar : PubMed/NCBI

39 

Takada Y, Ichikawa H, Pataer A, Swisher S and Aggarwal BB: Genetic deletion of PKR abrogates TNF-induced activation of IkappaBalpha kinase, JNK, Akt and cell proliferation but potentiates p44/p42 MAPK and p38 MAPK activation. Oncogene. 26:1201–1212. 2007. View Article : Google Scholar

40 

Wang L, Kang F, Li J, Zhang J and Shan B: Overexpression of p65 attenuates celecoxib-induced cell death in MDA-MB-231 human breast cancer cell line. Cancer Cell Int. 13:142013. View Article : Google Scholar : PubMed/NCBI

41 

Tran KQ, Tin AS and Firestone GL: Artemisinin triggers a G1 cell cycle arrest of human Ishikawa endometrial cancer cells and inhibits cyclin-dependent kinase-4 promoter activity and expression by disrupting nuclear factor-κB transcriptional signaling. Anticancer Drugs. 25:270–281. 2014. View Article : Google Scholar :

42 

Iwanaga R, Ozono E, Fujisawa J, Ikeda MA, Okamura N, Huang Y and Ohtani K: Activation of the cyclin D2 and cdk6 genes through NF-kappaB is critical for cell-cycle progression induced by HTLV-I Tax. Oncogene. 27:5635–5642. 2008. View Article : Google Scholar : PubMed/NCBI

43 

Ho A and Dowdy SF: Regulation of G(1) cell-cycle progression by oncogenes and tumor suppressor genes. Curr Opin Genet Dev. 12:47–52. 2002. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
He K, Tong D, Zhang S, Cai D, Wang L, Yang Y, Gao L, Chang S, Guo B, Song T, Song T, et al: miRNA-99b-3p functions as a potential tumor suppressor by targeting glycogen synthase kinase-3β in oral squamous cell carcinoma Tca-8113 cells. Int J Oncol 47: 1528-1536, 2015.
APA
He, K., Tong, D., Zhang, S., Cai, D., Wang, L., Yang, Y. ... Huang, C. (2015). miRNA-99b-3p functions as a potential tumor suppressor by targeting glycogen synthase kinase-3β in oral squamous cell carcinoma Tca-8113 cells. International Journal of Oncology, 47, 1528-1536. https://doi.org/10.3892/ijo.2015.3135
MLA
He, K., Tong, D., Zhang, S., Cai, D., Wang, L., Yang, Y., Gao, L., Chang, S., Guo, B., Song, T., Li, A., Huang, C."miRNA-99b-3p functions as a potential tumor suppressor by targeting glycogen synthase kinase-3β in oral squamous cell carcinoma Tca-8113 cells". International Journal of Oncology 47.4 (2015): 1528-1536.
Chicago
He, K., Tong, D., Zhang, S., Cai, D., Wang, L., Yang, Y., Gao, L., Chang, S., Guo, B., Song, T., Li, A., Huang, C."miRNA-99b-3p functions as a potential tumor suppressor by targeting glycogen synthase kinase-3β in oral squamous cell carcinoma Tca-8113 cells". International Journal of Oncology 47, no. 4 (2015): 1528-1536. https://doi.org/10.3892/ijo.2015.3135
Copy and paste a formatted citation
x
Spandidos Publications style
He K, Tong D, Zhang S, Cai D, Wang L, Yang Y, Gao L, Chang S, Guo B, Song T, Song T, et al: miRNA-99b-3p functions as a potential tumor suppressor by targeting glycogen synthase kinase-3β in oral squamous cell carcinoma Tca-8113 cells. Int J Oncol 47: 1528-1536, 2015.
APA
He, K., Tong, D., Zhang, S., Cai, D., Wang, L., Yang, Y. ... Huang, C. (2015). miRNA-99b-3p functions as a potential tumor suppressor by targeting glycogen synthase kinase-3β in oral squamous cell carcinoma Tca-8113 cells. International Journal of Oncology, 47, 1528-1536. https://doi.org/10.3892/ijo.2015.3135
MLA
He, K., Tong, D., Zhang, S., Cai, D., Wang, L., Yang, Y., Gao, L., Chang, S., Guo, B., Song, T., Li, A., Huang, C."miRNA-99b-3p functions as a potential tumor suppressor by targeting glycogen synthase kinase-3β in oral squamous cell carcinoma Tca-8113 cells". International Journal of Oncology 47.4 (2015): 1528-1536.
Chicago
He, K., Tong, D., Zhang, S., Cai, D., Wang, L., Yang, Y., Gao, L., Chang, S., Guo, B., Song, T., Li, A., Huang, C."miRNA-99b-3p functions as a potential tumor suppressor by targeting glycogen synthase kinase-3β in oral squamous cell carcinoma Tca-8113 cells". International Journal of Oncology 47, no. 4 (2015): 1528-1536. https://doi.org/10.3892/ijo.2015.3135
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team