Enhancement of active MMP release and invasive activity of lymph node metastatic tongue cancer cells by elevated signaling via the TNF-α-TNFR1-NF-κB pathway and a possible involvement of angiopoietin-like 4 in lung metastasis

  • Authors:
    • Takuya Tanaka
    • Takahisa Imamura
    • Masakazu Yoneda
    • Atsushi Irie
    • Hidenao Ogi
    • Masashi Nagata
    • Ryoji Yoshida
    • Daiki Fukuma
    • Kenta Kawahara
    • Masanori Shinohara
    • Hideki Nakayama
  • View Affiliations

  • Published online on: August 10, 2016     https://doi.org/10.3892/ijo.2016.3653
  • Pages: 1377-1384
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

To study the role of TNF-α in tongue cancer metastasis, we made highly metastatic cells from a human oral squamous cell carcinoma cell line (SAS) by repeating the passage in which the cells were injected into a nude mouse tongue and harvested from metastasized cervical lymph nodes. Cancer cells after 5 passages (GSAS/N5) increased invasive activity 7-fold in a TNF-α receptor 1 (TNFR1)-dependent manner and enhanced mRNA expression of TNF-α and TNFR1. In the highly metastatic cells, NF-κB activation was upregulated via elevated phosphorylation of Akt and Ikkα/β in the signaling pathway and secretion of TNF-α, active MMP-2 and MMP-9 increased. Suppression of increase of TNF-α mRNA expression and MMP secretion by NF-κB inhibitor NBD peptide suggested a positive feedback loop in GSAS/N5 cells; TNF-α activates NF-κB and activated NF-κB induces further TNF-α secretion, leading to increase of active MMP release and promotion of invasion and metastasis of the cells. GSAS/N5 cells that had been injected into the nude mouse tongue and harvested from metastasized lungs multiplied angiopoietin-like 4 (angptl4) expression with enhanced migration activity, which indicated a possible involvement of angptl4 in lung metastasis of the cells. These results suggest that TNF-α and angptl4 promote metastasis of the oral cancer cells, thus, these molecules may be therapeutic targets for patients with tongue cancer.

Introduction

The American Cancer Society estimated 45,780 new cases of oral cavity and pharyngeal cancer, and 8,650 deaths from these tumors, in 2015 in the United States (1). By advances in surgery and radiation therapy, the 5-year survival rate for oropharyngeal cancer has increased to 66%, but the rate is still unsatisfactory in comparison with some other site cancers including prostate, thyroid and breast; the rates of these types of cancer are >90% (1). A primary cause for the unfavorable prognosis is patient death from the cancer metastasized at regional and distant sites (25). Squamous cell carcinoma (SCC) accounts for approximately 90% of oral and oropharyngeal malignancies in the United States and tongue is a common site of the malignant diseases (6,7). The rate of nodal metastasis is higher in tongue cancer patients than oral cavity cancer patients whose rate is 30% on their initial evaluation (8,9). Several studies have shown a high rate of occult nodal metastasis (20–40%) in tongue SCC patients with no evidence of regional spread on clinical or radiographic evaluation (8,1015). There is a tendency that tongue cancer increases in young females in recent 2–3 decades (1618). Thus, metastasis suppression is a main and urgent subject in the treatments of patients with tongue SCC.

The process of metastasis is complex and involves tumor growth, the extra-cellular matrix breakdown, invasion to the vessels, escape from immune surveillance, transport to other sites with adhesion to the vessel, subsequent invasion into an organ where tumor cells proliferate, grow and spread. Various molecules participate in the process but their roles remain incompletely understood. Tumor necrosis factor (TNF)-α is one of major regulators of inflammation, playing in the cytokine network. TNF-α is synthesized primarily by immune cells as a 34-kDa type II transmembrane protein (19) and a soluble form of the C-terminal 17 kDa portion is released from cells through cleavage by TNF-α-converting enzyme (20). TNF-α forms a homotrimer that activates cells via two distinct receptors (21). TNFR1 (p55, CD120a) binds the soluble ligand and is expressed on most cells, and TNFR2 (p75, CD120b) primarily binds the transmembrane form and is found on hematopoietic cells (22). TNF-α required high doses or injection to the tumor tissue for induction of hemorrhagic tumor necrosis (19). In contrast, TNF-α at low doses exerted angiogenic activity in both the rabbit cornea and chick chorioallantoic membrane models (23,24). By treating tumor cells or mice TNF-α augmented the metastatic activity of transplanted tumor cells (25,26). These reports suggest TNF-α activity for cancer progression. Thus, whether TNF-α is an anticancer molecule or therapeutic target is an important issue in the treatment of cancer including tongue SCC.

To study a relationship between TNF-α and tongue cancer metastasis, we made highly metastatic oral squamous cell carcinoma (OSCC) cells by repeated implantation of lymph node-metastasized OSCC cells into a nude mouse tongue (27) and investigated secretion of TNF-α and MMPs, and expression of TNF-α receptors and molecules involved in TNF-α signaling pathway. Moreover, mRNA expression in highly metastatic OSCC cells after lung metastasis was measured by DNA micro-array method, and migration activity by wound healing assay.

Materials and methods

Preparation of highly metastatic cell lines from a GFP-expressing OSCC cell line

The human OSCC cell line SAS cells were transfected with the pAcGFP1-C1 vector (Clontech Laboratories, Mountain View, CA, USA) using FuGENE 6 (Roche Diagnostics, Indianapolis, IN, USA), then the cells with strong GFP fluorescence were isolated by flow cytometry. The cells were selected in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 1 mg/ml G418 (Life Technologies, Grand Island, NY, USA). The cells with bright GFP were designated GSAS and used as the parental cells. Highly metastatic cell lines were prepared according the method previously described (27). Briefly, GSAS cells (5.0×105 in 50 μl serum-free DMEM medium were injected into the tongue of a nude mouse and after 21 days were harvested from metastasized cervical lymph nodes. These GSAS cells were cultured in DMEM medium supplemented with 10% FBS and transplanted into the tongue of another nude mouse. This procedure was repeated and GSAS cells after 5 passages were referred to as GSAS/N5. To obtain a lung metastatic cell line, GSAS/N5 was injected into the tongue of a nude mouse. The cells that metastasized to the lungs (GSAS/L) were cultured for use.

TNF-α assay

TNF-α in the GSAS culture medium was assessed by enzyme-linked immunosorbent assay (ELISA) using Human TNF-α Quatikaine ELISA kit (R&D Systems, Inc., Minneapolis, MN, USA). Cells (2.0×106) were cultured in serum-free DMEM medium for 24 h and 25 μl of the supernatant was incubated in an anti-TNF-α antibody-adsorbed well for 4 h at room temperature, followed by washing. Biotin-labeled anti-TNF-α antibody was poured into the well, and after washing streptavidin-labeled peroxidese was incubated for 10 min in the well. After washing, 100 μl of TMB solution was added and incubated for 10 min, followed by 50 μl of 2 M HCl. The absorbance of the solution was measured at 450 nm.

Total RNA extraction and reverse transcription-PCR

The cells were incubated in serum-free DMEM in the presence or absence of 100 μM NBD peptide (Imgenex Corp., San Diego, CA, USA). After 24 h, total RNA was isolated using the RNeasy Mini kit (Qiagen, Valencia, CA, USA). The RNA quantity, purity, and integrity were evaluated using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Inc., Waltham, MA, USA). Complementary DNA was synthesized from total RNA using the PrimeScript RT reagent kit (Takara Bio Inc., Shiga, Japan). Gene-specific primer sets were designed using the Custom Primers software program (Invitrogen, Carlsbad, CA, USA). The primer sequences and the amplification conditions are shown in Table I. The expression of β-actin was used as an internal control.

Table I

RT-PCR conditions.

Table I

RT-PCR conditions.

GenePrimer sequences (5′-3′)Annealing temperature (°C)Cycles
TNF-αForward: CGGGACGTCGAGCTGGCCGAGGAG
Reverse: TTGCAGTGTGTTATCCGTGCTGTC
5035
TNFR-1Forward: TACATTGCAGCCTCTGCCTC
Reverse: AGAGCTTGGACTTCCACCGT
5035
TNFR-2Forward: ACATCAGACGTGGTGTGCAA
Reverse: CCAACTGGAAGAGCGAAGTC
5035
Angptl4Forward: CCTCAGGGGTCTCCGCCATTTT
Reverse: GGGCCGGTTGAAGTCCACTGA
6030
β-actinForward: CCAAGGCCAACCGCGAGAAGATTGAC
Reverse: AGGGTACATGGTGGTGCCGCCAGAC
5727
Flow cytometry

GSA/L cells were treated for 30 min with a rabbit anti-Angptl4 antibody (Abgent, Inc., San Diego, CA, USA) or a control rabbit IgG (Dako Corp., Carpinteria, CA, USA), followed by washing with PBS twice and incubation with phycoerythrin-conjugated anti-rabbit IgG (Santa Cruz Biotechnology). Angptl4 antigen was quantified by FACScan (BD Biosciences, San Jose, CA, USA).

Western blotting

GSAS, GSAS/N3 and GSAS/N5 cells (2.0×106) were cultured in serum-free DMEM medium for 24 h. Cell extracts were analyzed in an SDS-polyacrylamide gel and transferred onto a nitrocellulose membrane (Bio-Rad Laboratories, Hercules, CA, USA). After blocking with 5% skim milk, the membrane was incubated overnight with the first antibody against Akt (1:1,000; Cell Signaling Technology, Boston, MA, USA), phosho-Akt (1:1,000; Santa Cruz Biotechnology, Dallas, TX, USA), phospho-IKKα/β (1:1,000; Cell Signaling Technology), or β-actin (1:5,000; Sigma-Aldrich, St. Louis, MO, USA). After washing, the membrane was treated for 1 h with HRP-labeled second antibody (EnVision+, Dako Corp.). Bands were visualized using ECL (GE Healthcare, Buckinghamshire, UK).

Electrophoretic mobility shift assay (EMSA)

GSAS, GSAS/N3 and GSAS/N5 cells (2.0×106) were cultured in serum-free DMEM medium for 24 h. Nuclear extracts were prepared using the NE-PER™ Nuclear and Cytoplasmic Extraction reagents (Pierce Chemical Co., Dallas, TX, USA). The DNA binding reaction was performed with a biotin end-labeled NF-κB oligonucleotide (5′-AGCTTGGGGACTTTCCGAG-3′) using a LightShift™ Chemiluminescent EMSA kit (Pierce Chemical). A total of 20 μl of the extracts was electrophoresed in 6% polyacrylamide gels and transferred onto a nitrocellulose membrane (Bio-Rad Laboratories). Biotin-labeled DNA was detected with the Chemiluminescent Nucleic Acid Detection Module (Pierce Chemical). For supershift reactions, extracts were preincubated with an anti-p65 antibody (Santa Cruz Biotechnology) for 20 min. All of the above procedures were done according to the manufacturer’s protocols.

Gelatin zymography

Cells were seeded in a well of a 24-well plate to form a subconfluent sheet, then cultured in serum-free DMEM medium containing 0.5% BSA for 24 h, followed by a 24-h incubation in 10 ng/ml TNF-α in the presence or absence of 100 μM NBD peptide. The supernatant was obtained by centrifugation. To adjust the sample conditions, cells in a well were treated with 50 mM Tris-HCl, pH 6.8, 2% SDS, 10% glycerol and protein amount was measured using DC protein assay (Bio-Rad Laboratories). Supernatant samples were diluted with 50 mM Tris-HCl, pH 6.8, 10% SDS, 50% glycerol to adjust to a same concentration per the protein amount of the cells in a well and 40 μl of the sample was electrophoresed in a 10% SDS polyacrylamide gel containing 1 mg/ml gelatin. After washing twice in 10 mM Tris-HCl, pH 8.0, 2.5% Triton X-100, the gel was incubated in 50 mM Tris-HCl, pH 8.0, 0.5 mM CaCl2, 1 μM ZnCl2 at 37°C for 16 h. Then, the gel was stained in Coomassie brilliant blue solution. To determine the MMPs, standard pro-MMP-2, active MMP-2 and pro-MMP-9 (Cosmo Bio Co., Ltd., Tokyo, Japan) were electrophoresed in the same gel together with the samples.

Invasion assay

CytoSelect™ 24-well Cell Invasion Assay (Cell Biolabs, Inc., San Diego, CA, USA) was used to measure cancer cell invasion activity according to the manufacturer’s instructions. Cells (2.0×105) were suspended in serum-free DMEM, and then seeded into the upper chamber in the presence or absence of 100 μM NBD peptide. Serum-free DMEM was placed in the lower chamber. After incubation for 24 h, cells that invaded through Matrigel (BD Biosciences) layer to the lower surface of the 8 μm-pored membrane partitioning the chambers were fixed in 100% methanol, stained with 1% toluidine blue and counted in 4 microscopic fields (×400). The average cell number per a field in triplicate assay is shown.

Gene expression microarrays

Total RNA of GSAS, GSAS/N3, GSAS/N5 or GSAS/L cells was isolated using the RNeasy Mini kit (Qiagen). The RNA quantity, purity, and integrity were evaluated using a NanoDrop spectrophotometer (Thermo Fisher Scientific). The cRNA was amplified, labelled, and hybridised by an Agilent Human GE 4×44K v2 Microarray (Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s instructions. Signals of probes in all hybridised microarrays were scanned by an Agilent scanner and calculated using Feature Extraction Software version 9.5.1.1 (Agilent Technologies).

Wound healing assay

GSAS, GSAS/N3 and GSAS/N5 cells (5.0×105) were seeded in 6-well plates and were cultured in DMEM containing 10% of FBS for 24 h. A line was scratched with a yellow pipette tip in the 70–80% confluent monolayer, and the cellular debris were removed by washing with serum-free DMEM. Then, the cell sheets were incubated in serum-free DMEM and the cell migration into the wound area was photographed with a phase-contrast microscope for 24 h. The distance between the cell migration fronts of both sides was measured vertically against the initial scratch border at three points at random after 24 h from scratching and the percentage of the average distance vs. the distance between the initial scratch borders was calculated. All the assays were performed as a set of three independent experiments.

Statistical analysis

Statistical analysis was performed using the unpaired Student’s t-test. Values are expressed as means ± SD.

Results

Enhancement of invasive activity of GSAS/N5 cells

High invasiveness facilitates spread and metastasis of cancer cells, thus, invasive activity was measured for GSAS cells and GSAS/N5 cells and compared between them. Invasive activity of GSAS/N5 cells was >7-fold higher than that of GSAS cells (Fig. 1). The invasive activity of GSAS/N5 cells was mostly inhibited in the presence of soluble TNF-R1 and the inhibitory effect of the receptor was decreased by TNF-α addition (Fig. 1B). The result indicated that invasive activity was enhanced in GSAS/N5 cells and the enhanced invasive activity of the highly metastatic cancer cells was mainly dependent on TNF-R1.

Elevation of TNF-R1-NF-κB pathway and TNF-α secretion in GSAS/N cells

TNFR1-dependent enhancement of GSAS/N5 cell invasive activity suggested involvement of TNF-α-TNF-R1 system and elevation of the TNF-R1-initiated signaling pathway in the highly metastatic cancer cells. Hence, this system of the cancer cells was investigated. TNF-α and the receptor TNF-R1 mRNA expression increased in GSAS/N3 and GSAS/N5 cells in comparison with GSAS cells, but TNF-R2 mRNA expression did not change among the three GSAS cells (Fig. 2A). Suppression of TNF-α mRNA expression by NBD peptide (Fig. 2B) that inhibits NF-κB activation (28) indicated that increase of TNF-α mRNA expression was caused by NF-κB activation. The signaling pathway triggered by binding of TNF-α to TNFR1 mediates NF-κB activation in human head and neck squamous cell carcinoma (29). Thus, molecules participating in the signaling pathway from TNFR1 to NF-κB (30) were examined. Phospho-Akt protein increased in GSAS/N3 and GSAS/N5 cells, but Akt expression did not change (Fig. 3A). Phospho-IKKα/β was significantly increased in the highly metastatic cells, whereas it was negligible in GSAS cells (Fig. 3A). Expression of p50/p65, components of NF-κB (29), was enhanced in GSAS/N5 cells (Fig. 3B). These results indicated elevation of the signaling pathway to NF-κB and resultant increase of NF-κB activation in the highly metastatic oral SCC cells. NF-κB activation leads to TNF-α production in cancer cells (31,32), thus, TNF-α secretion from the cancer cells was measured. In agreement with increased TNF-α mRNA expression (Fig. 2A) GSAS/N5 secreted significantly more TNF-α into the culture medium than GSAS and GSAS/N3 (Fig. 4).

Enhancement of active MMP release from GSAS/N5 cells by TNF-α and its inhibition by NBD peptide

Elevation of TNF-R1-NF-κB pathway in GSAS/N5 cells suggested that TNF-α stimulation was associated with enhanced invasive activity of the cells. We previously showed that elevated mRNA expression of MMP-2 and MMP-9 in GSAS/N5 cells (27). We examined whether the cancer cells secreted active forms of these MMPs by TNF-α. By stimulation with TNF-α, cancer cells secreted active MMPs that were converted from latent forms; GSAS/N5 cells released more active MMPs than other cells (Fig. 5). NBD peptide induced pronounced inhibition of TNF-α-elicited active MMP-2 and MMP-9 secretion from the cancer cells (Fig. 5), which indicated a close association of TNF-α-triggered NF-κB activation to upregulation of active MMP release from the cancer cells.

Elevated angiopoietin-like 4 (Angptl4) expression and mobility of GSAS/L cells

To study tongue cancer metastasis further, we made another highly metastatic GSAS cell line (GSAS/L), which were GSAS/N5 cells that metastasized to the lung by implantation into a nude mouse tongue. GSAS, GSAS/N5 and GSAS/L cells were examined for exhaustive mRNA expression by the microarray assay and mRNAs that increased in comparison with GSAS cell mRNAs were sought. Table II shows the ten highest increase ratio mRNAs of GSAS/L cell and corresponding mRNAs of GSAS/N5 cells. This assay revealed mRNA elevation of several genes in the highly metastatic cells and Angptl4 increased most among the mRNAs. Angptl4 mRNA expression of GSAS/L increased 141-fold for GSAS and 25-fold for GSAS/N5. Indeed, high expression of Angptl4 mRNA and the protein were confirmed in GSAS/L cells but GSAS cell Angptl4 mRNA expression was faint (Fig. 6). To study GSAS/L cells further, migration activity of the cells was investigated. In the scratch assay GSAS/L cells migrated more rapidly than GSAS/N5 and GSAS cells (Fig. 7). These results may suggest that the lung metastatic activity of GSAS/L is associated with enhancement of Angptl4 expression and cell mobility.

Table II

Gene expression microarrays.

Table II

Gene expression microarrays.

SignalGSAS/N5 vs. GSASGSAS/L vs. GSAS



GeneGSASGSAS/N5GSAS/LRatioZ-scoreRatioZ-score
Angptl4120.180677.89017002.5025.643.6141.4814.8
HSPA1A1692.24816530.23867702.4499.776.240.0113.3
VNN110.54446.645388.4484.422.136.844.8
GJB477.626301.3862711.9843.882.834.948.9
HSPA1B1255.0945619.18420255.9744.484.116.148.3
NLRP323.420123.228291.0845.262.312.435.6
TNFAIP3104.419305.6991274.0842.932.212.206.3
ZBED216.635187.705183.02711.283.311.003.2
GRHL349.419190.636485.3793.862.89.825.1
ZMAT43.17749.33331.06615.532.59.782.1

[i] Angptl4, angiopoietin-like 4; HSPA1A, heat shock 70 kDa protein 1A; VNN1, vanin 1; GJB4, gap junction protein, β 4; HSPA1B, heat shock 70 kDa protein 1B; NLRP3, NLR family pyrin domain containing 3; TNFAIP3, tumor necrosis factor α-induced protein 3; ZBED2, zinc finger BED-type containing 2; GRHL3, grainyhead-like 3; ZMAT4, zinc finger matrin-type 4.

Discussion

We revealed enhancement of invasive activity in the highly metastatic OSCC cells (Fig. 1) accompanying elevated TNF-α signaling via TNFR1 (Fig. 2A), leading to NF-κB activation through phospholylation of Akt and IKKα/β (Fig. 3). The increase of TNF-α mRNA expression (Fig. 2A) and protein secretion (Fig. 4) in relation to elevated NF-κB activation (Fig. 3B) agrees with that NF-κB activation leading to TNF-α production in tumor cells (31,32). NF-κB is a key regulator of MMP-2 and MMP-9 expression (33,34), even in SAS cells (35) used in the present study, which suggests that the high NF-κB level of GSAS/N5 cells implicated secretion enhancement of these proteases from the cells (Fig. 5). Upregulation of MMP-2 and MMP-9 expression is associated with tumor invasion and metastasis (36,37). Accordingly, elevated secretion of active forms of these proteases in the GSAS/N5 cells (Fig. 5) likely accounts for high invasive (Fig. 1) and metastatic (27) activities of the cells.

We have shown that NF-κB level was elevated as GSAS cell metastasis passage advanced (Fig. 3B). The highly metastatic GSAS cells, particularly GSAS/N5, secrete more TNF-α (Fig. 4) together with increased expression of TNFR1 (Fig. 2A), the receptor for soluble TNF-α (22). The increase of TNF-α release brings about further NF-κB activation via TNFR1 signaling pathway in the cells and resultant elevation of MMPs secretion. As an autocrine TNF-α from tumor cells stimulated by this cytokine was reported (38), TNF-α release from the highly metastatic cells is possibly amplified in an autocrine mannaer. These findings suggest an auto-activation mechanism for TNF-α-triggered NF-κB activation in these cells. This may be an underlying mechanism by which GSAS/N3 and GSAS/N5 cells exert high invasive and metastatic activities. Such a positive feedback between NF-κB and TNF-α was reported in leukemia-initiating cells and contributes to leukemia progression (32). The present study suggests that this mechanism is present in the oral cancer cells and associated with enhanced secretion of active MMPs, augmenting invasion and probably metastasis of the malignant cells. In addition, the stimulative effect of TNF-α on the epithelial-mesenchymal transition (38) may also be augmented through the auto-activation mechanism, participating in the progression of the highly metastatic cancer cells.

Angptl4 is a member of proteins which are structurally similar to the angiopoietins but they do not bind to the angiopoietin receptors, namely the tyrosine kinase with immunoglobulin-like and EGF-like domain 1 (Tie1) and the endothelial-specific receptor tyrosine kinase (TEK or Tie2) (39). Angptl4 is a critical mediator in the transmigration process (40,41) and promotes transendothelial migration of cancer cells through the upregulation of vascular endothelial adhesion molecule 1 (VCAM-1) expression on endothelial cells (42). The increase of VCAM-1 on endothelial cells facilitates the attachment of cancer cells in the circulation to the vessels, allowing subsequent extravasation and tumor establishment. Clinical studies showed correlation of Angptl4 expression with venous and lymphatic invasion in human squamous cell carcinoma (43). Moreover, Angptl4 was reported as a lung metastasis gene in breast cancer (44). Considering these Angptl4 activities to support cancer progression, a high expression of the molecule (Table II and Fig. 6) in GSAS/L cells seems to be associated with metastasis of the OSCC cells, particularly to lungs, in addition to the enhanced invasiveness (Fig. 7).

In the highly metastatic OSCC cells, the elevated TNFR1 signaling pathway enhanced resultant NF-κB activation that was amplified through the auto-activation mechanism, leading to increase of active MMP-2 and MMP-9 secretion and invasive activity. Angptl4 mRNA was multiplied 25-fold in GSAS/L cells in comparison with GSAS/N5 cells, suggesting an involvement of this molecule in lung metastasis. The high expression level of Angptl4 was predictive of poor prognosis and prognostic of poor survival in patients with tongue cancer (45). These results may indicate that TNF-α, TNFR1 and Angptl4 were therapeutic targets of OSCC, including tongue cancers. Thus, blocking the TNF-α-TNFR1 system and Angptl4 with antibodies and receptor antagonists is possibly effective on the treatment of OSCC, inhibiting progression of the cancer.

Acknowledgements

The present study was supported in part by the Japanese Science Progress Society KAKENHI Grant (26463049) to T.T.

Abbreviations:

OSCC

oral squamous cell carcinoma

TNF-α

tumor necrosis factor-α

GSAS

GFP expressing SAS cell

GSAS/N3

lymph node metastasized GSAS after three passages

GSAS/N5

lymph node metastasized GSAS after five passages

GSAS/L

lung metastasized GSAS/N5

NBD

NEMO-binding domain

TNFR1

tumor necrosis factor-α-receptor 1

References

1 

Siegel RL, Miller KD and Jemal A: Cancer statistics, 2015. CA Cancer J Clin. 65:5–29. 2015. View Article : Google Scholar : PubMed/NCBI

2 

Kalnins IK, Leonard AG, Sako K, Razack MS and Shedd DP: Correlation between prognosis and degree of lymph node involvement in carcinoma of the oral cavity. Am J Surg. 134:450–454. 1977. View Article : Google Scholar : PubMed/NCBI

3 

Schuller DE, McGuirt WF, McCabe BF and Young D: The prognostic significance of metastatic cervical lymph nodes. Laryngoscope. 90:557–570. 1980. View Article : Google Scholar : PubMed/NCBI

4 

Snow GB, Annyas AA, van Slooten EA, Bartelink H and Hart AA: Prognostic factors of neck node metastasis. Clin Otolaryngol Allied Sci. 7:185–192. 1982. View Article : Google Scholar : PubMed/NCBI

5 

Grandi C, Alloisio M, Moglia D, Podrecca S, Sala L, Salvatori P and Molinari R: Prognostic significance of lymphatic spread in head and neck carcinomas: Therapeutic implications. Head Neck Surg. 8:67–73. 1985. View Article : Google Scholar : PubMed/NCBI

6 

Chi AC, Day TA and Neville BW: Oral cavity and oropharyngeal squamous cell carcinoma - an update. CA Cancer J Clin. 65:401–421. 2015. View Article : Google Scholar : PubMed/NCBI

7 

Sano D and Myers JN: Metastasis of squamous cell carcinoma of the oral tongue. Cancer Metastasis Rev. 26:645–662. 2007. View Article : Google Scholar : PubMed/NCBI

8 

Ho CM, Lam KH, Wei WI, Lau SK and Lam LK: Occult lymph node metastasis in small oral tongue cancers. Head Neck. 14:359–363. 1992. View Article : Google Scholar : PubMed/NCBI

9 

Myers EN and Simental AA Jr: Cancer of the oral cavity. Cancer of the head and neck. 4th edition. Myers EN, Suen JY, Myers JN and Hanna EY: Elsevier; pp. 279–319. 2004

10 

Teichgraeber JF and Clairmont AA: The incidence of occult metastases for cancer of the oral tongue and floor of the mouth: Treatment rationale. Head Neck Surg. 7:15–21. 1984. View Article : Google Scholar : PubMed/NCBI

11 

Cunningham MJ, Johnson JT, Myers EN, Schramm VL Jr and Thearle PB: Cervical lymph node metastasis after local excision of early squamous cell carcinoma of the oral cavity. Am J Surg. 152:361–366. 1986. View Article : Google Scholar : PubMed/NCBI

12 

Fakih AR, Rao RS and Patel AR: Prophylactic neck dissection in squamous cell carcinoma of oral tongue: A prospective randomized study. Semin Surg Oncol. 5:327–330. 1989. View Article : Google Scholar : PubMed/NCBI

13 

Lydiatt DD, Robbins KT, Byers RM and Wolf PF: Treatment of stage I and II oral tongue cancer. Head Neck. 15:308–312. 1993. View Article : Google Scholar : PubMed/NCBI

14 

Yuen AP, Wei WI, Wong YM and Tang KC: Elective neck dissection versus observation in the treatment of early oral tongue carcinoma. Head Neck. 19:583–588. 1997. View Article : Google Scholar : PubMed/NCBI

15 

Yuen AP, Lam KY, Chan AC, Wei WI, Lam LK, Ho WK and Ho CM: Clinicopathological analysis of elective neck dissection for N0 neck of early oral tongue carcinoma. Am J Surg. 177:90–92. 1999. View Article : Google Scholar

16 

Müller S, Pan Y, Li R and Chi AC: The Emory University Experience: Changing trends in oral squamous cell carcinoma with particular reference to young patients: 1971–2006. The Emory University experience. Head Neck Pathol. 2:60–66. 2008. View Article : Google Scholar

17 

Patel SC, Carpenter WR, Tyree S, Couch ME, Weissler M, Hackman T, Hayes DN, Shores C and Chera BS: Increasing incidence of oral tongue squamous cell carcinoma in young white women, age 18 to 44 years. J Clin Oncol. 29:1488–1494. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Toporcov TN, Znaor A, Zhang ZF, Yu GP, Winn DM, Wei Q, Vilensky M, Vaughan T, Thomson P, Talamini R, et al: Risk factors for head and neck cancer in young adults: A pooled analysis in the INHANCE consortium. Int J Epidemiol. 44:169–185. 2015. View Article : Google Scholar : PubMed/NCBI

19 

Pennica D, Nedwin GE, Hayflick JS, Seeburg PH, Derynck R, Palladino MA, Kohr WJ, Aggarwal BB and Goeddel DV: Human tumour necrosis factor: Precursor structure, expression and homology to lymphotoxin. Nature. 312:724–729. 1984. View Article : Google Scholar : PubMed/NCBI

20 

Black RA, Rauch CT, Kozlosky CJ, Peschon JJ, Slack JL, Wolfson MF, Castner BJ, Stocking KL, Reddy P, Srinivasan S, et al: A metalloproteinase disintegrin that releases tumour-necrosis factor-alpha from cells. Nature. 385:729–733. 1997. View Article : Google Scholar : PubMed/NCBI

21 

Locksley RM, Killeen N and Lenardo MJ: The TNF and TNF receptor superfamilies: Integrating mammalian biology. Cell. 104:487–501. 2001. View Article : Google Scholar : PubMed/NCBI

22 

Balkwill F: Tumour necrosis factor and cancer. Nat Rev Cancer. 9:361–371. 2009. View Article : Google Scholar : PubMed/NCBI

23 

Fràter-Schröder M, Risau W, Hallmann R, Gautschi P and Böhlen P: Tumor necrosis factor type α, a potent inhibitor of endothelial cell growth in vitro, is angiogenic in vivo. Proc Natl Acad Sci USA. 84:5277–5281. 1987. View Article : Google Scholar

24 

Leibovich SJ, Polverini PJ, Shepard HM, Wiseman DM, Shively V and Nuseir N: Macrophage-induced angiogenesis is mediated by tumour necrosis factor-alpha. Nature. 329:630–632. 1987. View Article : Google Scholar : PubMed/NCBI

25 

Malik STA, Naylor MS, East N, Oliff A and Balkwill FR: Cells secreting tumour necrosis factor show enhanced metastasis in nude mice. Eur J Cancer. 26:1031–1034. 1990. View Article : Google Scholar : PubMed/NCBI

26 

Orosz P, Echtenacher B, Falk W, Rüschoff J, Weber D and Männel DN: Enhancement of experimental metastasis by tumor necrosis factor. J Exp Med. 177:1391–1398. 1993. View Article : Google Scholar : PubMed/NCBI

27 

Tanaka T, Nakayama H, Yoshitake Y, Irie A, Nagata M, Kawahara K, Takamune Y, Yoshida R, Nakagawa Y, Ogi H, et al: Selective inhibition of nuclear factor-κB by nuclear factor-κB essential modulator-binding domain peptide suppresses the metastasis of highly metastatic oral squamous cell carcinoma. Cancer Sci. 103:455–463. 2012. View Article : Google Scholar

28 

May MJ, D’Acquisto F, Madge LA, Glöckner J, Pober JS and Ghosh S: Selective inhibition of NF-kappaB activation by a peptide that blocks the interaction of NEMO with the IkappaB kinase complex. Science. 289:1550–1554. 2000. View Article : Google Scholar : PubMed/NCBI

29 

Jackson-Bernitsas DG, Ichikawa H, Takada Y, Myers JN, Lin XL, Darnay BG, Chaturvedi MM and Aggarwal BB: Evidence that TNF-TNFR1-TRADD-TRAF2-RIP-TAK1-IKK pathway mediates constitutive NF-kappaB activation and proliferation in human head and neck squamous cell carcinoma. Oncogene. 26:1385–1397. 2007. View Article : Google Scholar

30 

Rehman AO and Wang C-Y: SDF-1α promotes invasion of head and neck squamous cell carcinoma by activating NF-kappaB. J Biol Chem. 283:19888–19894. 2008. View Article : Google Scholar : PubMed/NCBI

31 

Stathopoulos GT, Kollintza A, Moschos C, Psallidas I, Sherrill TP, Pitsinos EN, Vassiliou S, Karatza M, Papiris SA, Graf D, et al: Tumor necrosis factor-alpha promotes malignant pleural effusion. Cancer Res. 67:9825–9834. 2007. View Article : Google Scholar : PubMed/NCBI

32 

Kagoya Y, Yoshimi A, Kataoka K, Nakagawa M, Kumano K, Arai S, Kobayashi H, Saito T, Iwakura Y and Kurokawa M: Positive feedback between NF-κB and TNF-α promotes leukemia-initiating cell capacity. J Clin Invest. 124:528–542. 2014. View Article : Google Scholar : PubMed/NCBI

33 

Epanchintsev A, Shyamsunder P, Verma RS and Lyakhovich A: IL-6, IL-8, MMP-2, MMP-9 are overexpressed in Fanconi anemia cells through a NF-κB/TNF-α dependent mechanism. Mol Carcinog. 54:1686–1699. 2015. View Article : Google Scholar

34 

Shi M, Cao M, Song J, Liu Q, Li H, Meng F, Pan Z, Bai J and Zheng J: PinX1 inhibits the invasion and metastasis of human breast cancer via suppressing NF-κB/MMP-9 signaling pathway. Mol Cancer. 14:662015. View Article : Google Scholar

35 

Lai WW, Hsu SC, Chueh FS, Chen YY, Yang JS, Lin JP, Lien JC, Tsai CH and Chung JG: Quercetin inhibits migration and invasion of SAS human oral cancer cells through inhibition of NF-κB and matrix metalloproteinase-2/-9 signaling pathways. Anticancer Res. 33:1941–1950. 2013.PubMed/NCBI

36 

Egeblad M and Werb Z: New functions for the matrix metal-loproteinases in cancer progression. Nat Rev Cancer. 2:161–174. 2002. View Article : Google Scholar : PubMed/NCBI

37 

Littlepage LE, Sternlicht MD, Rougier N, Phillips J, Gallo E, Yu Y, Williams K, Brenot A, Gordon JI and Werb Z: Matrix metalloproteinases contribute distinct roles in neuroendocrine prostate carcinogenesis, metastasis, and angiogenesis progression. Cancer Res. 70:2224–2234. 2010. View Article : Google Scholar : PubMed/NCBI

38 

Bates RC and Mercurio AM: Tumor necrosis factor-α stimulates the epithelial-to-mesenchymal transition of human colonic organoids. Mol Biol Cell. 14:1790–1800. 2003. View Article : Google Scholar : PubMed/NCBI

39 

Santulli G: Angiopoietin-like proteins: A comprehensive look. Front Endocrinol (Lausanne). 5:42014.

40 

Zhu P, Tan MJ, Huang RL, Tan CK, Chong HC, Pal M, Lam CR, Boukamp P, Pan JY, Tan SH, et al: Angiopoietin-like 4 protein elevates the prosurvival intracellular O2:H2O2 ratio and confers anoikis resistance to tumors. Cancer Cell. 19:401–415. 2011. View Article : Google Scholar : PubMed/NCBI

41 

Huang RL, Teo Z, Chong HC, Zhu P, Tan MJ, Tan CK, Lam CRI, Sng MK, Leong DTW, Tan SM, et al: ANGPTL4 modulates vascular junction integrity by integrin signaling and disruption of intercellular VE-cadherin and claudin-5 clusters. Blood. 118:3990–4002. 2011. View Article : Google Scholar : PubMed/NCBI

42 

Li H, Ge C, Zhao F, Yan M, Hu C, Jia D, Tian H, Zhu M, Chen T, Jiang G, et al: Hypoxia-inducible factor 1 alpha-activated angiopoietin-like protein 4 contributes to tumor metastasis via vascular cell adhesion molecule-1/integrin β1 signaling in human hepatocellular carcinoma. Hepatology. 54:910–919. 2011. View Article : Google Scholar : PubMed/NCBI

43 

Shibata K, Nakayama T, Hirakawa H, Hidaka S and Nagayasu T: Clinicopathological significance of angiopoietin-like protein 4 expression in oesophageal squamous cell carcinoma. J Clin Pathol. 63:1054–1058. 2010. View Article : Google Scholar : PubMed/NCBI

44 

Minn AJ, Gupta GP, Padua D, Bos P, Nguyen DX, Nuyten D, Kreike B, Zhang Y, Wang Y, Ishwaran H, et al: Lung metastasis genes couple breast tumor size and metastatic spread. Proc Natl Acad Sci USA. 104:6740–6745. 2007. View Article : Google Scholar : PubMed/NCBI

45 

Wang Z, Han B, Zhang Z, Pan J and Xia H: Expression of angiopoietin-like 4 and tenascin C but not cathepsin C mRNA predicts prognosis of oral tongue squamous cell carcinoma. Biomarkers. 15:39–46. 2010. View Article : Google Scholar

Related Articles

Journal Cover

September 2016
Volume 49 Issue 4

Print ISSN: 1019-6439
Online ISSN:1791-2423

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
APA
Tanaka, T., Imamura, T., Yoneda, M., Irie, A., Ogi, H., Nagata, M. ... Nakayama, H. (2016). Enhancement of active MMP release and invasive activity of lymph node metastatic tongue cancer cells by elevated signaling via the TNF-α-TNFR1-NF-κB pathway and a possible involvement of angiopoietin-like 4 in lung metastasis. International Journal of Oncology, 49, 1377-1384. https://doi.org/10.3892/ijo.2016.3653
MLA
Tanaka, T., Imamura, T., Yoneda, M., Irie, A., Ogi, H., Nagata, M., Yoshida, R., Fukuma, D., Kawahara, K., Shinohara, M., Nakayama, H."Enhancement of active MMP release and invasive activity of lymph node metastatic tongue cancer cells by elevated signaling via the TNF-α-TNFR1-NF-κB pathway and a possible involvement of angiopoietin-like 4 in lung metastasis". International Journal of Oncology 49.4 (2016): 1377-1384.
Chicago
Tanaka, T., Imamura, T., Yoneda, M., Irie, A., Ogi, H., Nagata, M., Yoshida, R., Fukuma, D., Kawahara, K., Shinohara, M., Nakayama, H."Enhancement of active MMP release and invasive activity of lymph node metastatic tongue cancer cells by elevated signaling via the TNF-α-TNFR1-NF-κB pathway and a possible involvement of angiopoietin-like 4 in lung metastasis". International Journal of Oncology 49, no. 4 (2016): 1377-1384. https://doi.org/10.3892/ijo.2016.3653