Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
January-2017 Volume 50 Issue 1

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2017 Volume 50 Issue 1

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Baicalin attenuates DDP (cisplatin) resistance in lung cancer by downregulating MARK2 and p-Akt

  • Authors:
    • Zhiwei Xu
    • Ju Mei
    • Yan Tan
  • View Affiliations / Copyright

    Affiliations: Department of Cardiothoracic Surgery, Xinhua Hospital, Shanghai Jiaotong University School of Medicine, Shanghai, P.R. China, Department of Intensive Care Unit, Shanghai Pudong Hospital, Fudan University Pudong Medical Center, Pudong, Shanghai 201399, P.R. China
  • Pages: 93-100
    |
    Published online on: November 15, 2016
       https://doi.org/10.3892/ijo.2016.3768
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

DDP (cisplatin) resistance in lung cancer has been widely reported. Baicalin is a flavone glycoside found in genus Scutellaria. However, the effects of baicalin on DDP resistance in lung cancer are unclear. The aim of present study was to investigate effects of combination of baicalin and DDP on proliferation and invasion of human lung cancer cells, and explore possible mechanisms. MTT assay was utilized to evaluate effects of baicalin and DDP on the proliferation of A549 and A549/DPP (DPP-resistant) human lung cancer cells. The probability sum method was used to determine effects of the drug combination. Transwell invasion assay was utilized to detect tumor cell invasion. The mRNA expression of MARK2 in A549 and A549/DPP cells was detected by qPCR. Protein expression of MARK2, p-Akt and Akt was detected by western blot analysis. Baicalin and DPP when used alone inhibited the proliferation of A549 and A549/DDP cells in a dose-dependent manner at 24 and 48 h. For A549 cells, baicalin (8 µg/ml) antagonized DDP (1, 2, 4 and 8 µg/ml) at 24 h. For A549/DDP cells, baicalin and DDP were additive when the concentration of DDP was 4 µg/ml at 24 h. Effects of baicalin and DDP on proliferation inhibition were additive and synergistic when concentrations of DDP were 8 and 4 µg/ml, respectively, at 48 h for both A549 and A549/DDP cells. When baicalin (8 µg/ml) and DDP (4 µg/ml) were combined, the inhibitory rate of tumor cell invasion increased markedly compared to DPP or baicalin alone groups in both A549 and A549/DDP cells. A549/DDP cells had significantly higher MARK2 mRNA levels and protein expression of MARK2 and p-Akt. Baicalin decreased MARK2 mRNA and protein expression of MARK2 and p-Akt in A549/DDP cells dose-dependently. In conclusion, baicalin and DDP were synergistic at inhibiting proliferation and invasion of human lung cancer cells at appropriate dosages and incubation time in the presence or absence of DDP resistance. The attenuation of DDP resistance was associated with downregulation of MARK2 and p-Akt.

Introduction

Lung cancer is the most common cancer in men worldwide, and is the fourth most frequent cancer in women (1). The standard therapy of intermediate and advanced lung cancer is based on the combination of Cis-diamminedichloroplatinum (DDP, cisplatin) and other chemotherapy agents (2,3). DDP is a DNA cross-linking agent, which is used to treat cancers such as lung, ovarian and cervical cancers (4–6). Cisplatin, carboplatin and oxaliplatin induce cross-links between guanine bases. Cisplatin and carboplatin form an identical cross-link, whereas the cross-link of oxaliplatin is structurally different because of the bulky 1,2-diaminocyclohexane group. However, DDP resistance in lung cancer has been widely reported (7–9).

Baicalin is a flavone glycoside found in several species in the genus Scutellaria, such as Scutellaria baicalensis and Scutellaria lateriflora. Baicalin and its aglycone baicalein are positive allosteric modulator of benzodiazepine and non-benzodiazepine sites of GABAA receptor (10,11). Baicalin was shown to display anxiolytic effects without sedative effects in mice (12,13). Moreover, baicalin was revealed to inhibit prolyl endopeptidase (14), and induce apoptosis in pancreatic cancer cells (15). Baicalin also inhibited proliferation of other malignant tumors, such as hepatocellular carcinoma and glioma (16,17). However, the effects of baicalin on DDP resistance in lung cancer are unclear.

Microtubule affinity-regulating kinase 2 (MARK2) is serine/threonine-protein kinase that is involved in the control of cancer, microtubule stability, and cell polarity. MARK2 has been shown to interact with Akt (18). The phosphoinositide 3 kinase (PI3K)/Akt mammalian target of rapamycin (mTOR) regulates cell cycling, and is associated with cellular proliferation and the development of cancer. Once activated, PI3K phosphorylates and activates Akt, which has numerous downstream effects, including activating mTOR (19). Over-activation of the mTOR pathway leads to increased cell proliferation and reduced levels of cellular apoptosis involved in the pathogenesis of cancer. p-Akt is the activated form of Akt that has biological function. Therefore, we examined the expressions of MARK2 and p-Akt as a means of exploring the effects of combination of baicalin and DDP on proliferation and invasion of human lung cancer cells.

Materials and methods

Cells and reagents
Cells

A549 cells (human lung cancer cells) and A549/DDP cells (DDP-resistant human lung cancer cells) were purchased from MeiXuan Biological Science and Technology, Inc. (Shanghai, China), and cultured at 37°C in F12K medium supplemented with 100 ml/l fetal bovine serum (FBS), 100 kU/l penicillin, and 100 mg/l chloramphenicol in a cell incubator with 5% CO2. Drugs: the baicalin powder (Ronghe Inc., Shanghai, China) and cisplatin (DDP; Macklin Inc., Shanghai, China) were dissolved in dimethyl sulfoxide (DMSO). Both solutions were stored at −80°C.

Main reagents

F12K culture medium; RPMI-1640 culture medium; fetal bovine serum (FBS); trypsin and antibodies (all from Gibco Inc., Grand Island, NY, USA); MTT cell proliferation and toxicity assay kits (Aladdine Inc., Shanghai, China); primary antibodies against GAPDH (Abcam Inc., Cambridge, MA, USA); primary antibodies against Akt and p-Akt (Cell Signaling Technology Inc., Danvers, MA, USA); primary antibodies against MARK2 (Proteintech Inc., Rosemont, IL, USA); goat anti-rabbit antibody (Invitrogen Inc., Grand Island, NY, USA); Martrigel (Becton-Dickinson Inc., Franklin Lakes, NJ, USA); Transwell (Corning Inc., Corning, NY, USA); TRIzol (Invitrogen Inc., Grand Island, NY, USA); Takara Reverse Transcriptase M-MLV; qPCR kit (Tiangen Biotech, Inc., Beijing, China); and specific primers for MARK2 and β-actin (Sangon Biotech Inc., Shanghai, China).

Main pieces of equipment: light microscope (Olympus Inc., Tokyo, Japan); microplate reader (Kehua Inc., Shanghai, China); table-type refrigerated centrifuge (USTC Zonkia Inc., Hefei, China); cell incubator (Thermo Scientific Inc., Waltham, MA, USA); vertical and horizontal electrophoresis system (Liuyi, Inc., Beijing, China); electric thermostatic drying oven (Huyue, Inc., Shangyu, China); PCR machine (Bio-Rad Inc., Irvine, CA, USA); and Step One Plus quantitative PCR machine (Applied Biosystems, Inc., Waltham, MA, USA).

MTT assay

A549/DDP cells were cultured for 24 h before baicalin was added. The final concentrations of baicalin were 1, 2, 4 and 8 µg/ml (n=3 wells/each concentration). The final concentrations of DDP were 1, 2, 4 and 8 µg/ml. No drug was added in control group. Meanwhile, other aliquots of cells were treated with baicalin (8 µg/ml), DDP (1, 2, 4 and 8 µg/ml), and baicalin (8 µg/ml) combined with DDP (1, 2, 4 and 8 µg/ml) respectively (n=3 wells/each concentration). Following addition of drugs, cells were cultured in a 37°C incubator with 5% CO2 for periods of 24 and 48 h, respectively. Following culture, 20 µl of MTT solution (5 mg/ml) was added to each well, and the cells were cultured at 37°C for an additional 4 h. Following culture, the cell supernatants were removed and discarded, and 150 µl of DMSO was added to each well. The plates were then shaken for 15 min to dissolve crystals, and the absorbance of each sample was detected at 570 nm (A570) using an ELISA microplate reader. The degree of cell proliferation inhibition in each sample was calculated using the following formula: cell proliferation inhibition (%) = (1-absorbance of the experimental group/absorbance of the control group) ×100%. The probability sum method was utilized to look for evidence of synergism achieved by combining baicalin with cisplatin (20). The formula used for this purpose was q=EAB/(EA+EB-EAxEB), where EAB is the effect achieved (e.g., inhibition rate) when drug A and B are combined, and EA and EB are the effects of drug A and B, respectively, when applied separately. A q-value between 0.85 and 1.15 indicates that the effects of drug A and B are additive. A q-value >1.15 indicates that the effects of drug A and B are synergistic, while a q-value <0.85 indicates that drug A and B have antagonistic effects.

Transwell invasion assay

A549 and A549/DDP cells were treated with baicalin (8 µg/ml), DDP (4 µg/ml), and baicalin (8 µg/ml) combined with DDP (4 µg/ml) for 48 h, respectively (n=3/group). No drugs were added in control groups. Cells were digested by trypsin-ethylene diamine tetraacetic acid (EDTA) solution (0.25% EDTA) and centrifuged. The cells were then diluted to make concentration of 5×105/ml. The membrane of the upper compartment was coated with 50 µl of Matrigel (1 g/l), and incubated at 37°C for 1 h in order to reconstruct its structure into basal membrane. Two hundred microliters of A549 and A549/DPP cell suspension were incubated in upper compartment of Transwell respectively, and 600 µl of 20% FBS were added into lower compartment. Cells were incubated at a humid incubator with 5% CO2 for 48 h. Following culture, 4% paraformaldehyde was utilized to fix the microporous membrane. Cells were stained with 0.05% crystal violet for 10 min, and washed with phosphate-buffered saline (PBS) twice. Cells were then observed under microscope (×400), and the number of cells that penetrated the membrane were counted. The inhibition of tumor cell invasion was calculated utilizing the following formula: inhibition of cell invasion (%) = (1-the average number of cells that penetrated the membrane in the experimental group/the average number of cells that penetrated the membrane in the control group) ×100%.

Quantitative polymerase chain reaction (qPCR)

A549/DDP cells were treated with different concentrations of baicalin (0, 1, 2, 4, 8 and 10 µg/ml) for 48 h. Total RNA of A549/DDP cells was extracted and purified by TRIzol according to manufacturer's instructions. A universal cDNA synthesis kit (Tiangen Biotech, Inc.) was utilized for reverse transcription. Each reaction contained 1 µl of random hexamer primers (0.2 µg/µl) and 40 U M-MuLV reverse transcriptase (20 U/µl). The specific primer for detection of MARK2 gene was forward, ATGCTGCCCCAGAACTCTTC and reverse, GTGCCTCTCTTGCTGGGATT. The specific primer for detection of β-actin gene was forward, AGAAAATCTGGCACCACACC and reverse, AGAGGGTACAGGGATAGCA. miRcute miRNA qPCR detection kit was used for qPCR. PCR conditions were as follows: pre-denaturing at 95°C for 15 min; denaturing at 95°C for 10 sec; and annealing and polymerization at 60–66°C for 20–32 sec. There were 40 PCR cycles. PCR was performed in an ABI Step One Plus qPCR system. The expression of MARK2 was determined as the ratio of relative optical density of target gene to β-actin.

Western blot studies

Expression levels of AKT, p-AKT and MARK2 proteins were detected by western blot analysis. A 549/DPP cells were treated with different concentrations of baicalin (1, 2, 4 and 8 µg/ml) for 48 h. No drug was added in control group. Cellular proteins were extracted and separated by electrophoresis (120 V) on a 10% SDS-polyacrylamide gel. The separated proteins were then electrophoretically (100 V for 120 min) transferred to polyvinylidene fluoride (PVDF) membranes. After being blocked with 5% non-fat milk powder for 1 h, the membranes were incubated with anti-Akt (1:1,000), anti-p-Akt (1:1,000), anti-MARK2 (1:2,000), and anti-GAPDH antibodies (1:5,000) respectively at 4°C overnight. Following incubation, membranes was washed three times (10 min each) with a solution of Tris-buffered saline and Tween-20 (TBST). The membranes were then incubated for 1 h at room temperature with goat anti-rabbit secondary antibody labeled with horseradish peroxidase (HRP) (1:3,000); after which, they were washed and incubated for a short time period in electro-chemi-luminescence (ECL) solution. The film was exposed in a dark room.

Statistical analysis

The statistical data were analyzed and the figures were created using GraphPad Prism 5.0 software (GraphPad Software Inc., La Jolla, CA, USA). All statistical results are expressed as the mean ± SEM. Differences among 3 or more groups were compared by analysis of variance (ANOVA), followed by the Bonferroni post-hoc test for multiple comparisons. p-values ≤0.05 were considered statistically significant.

Results

Baicalin and DDP inhibit the proliferation of human lung cancer cells when used alone

MTT assay was utilized to evaluate effects of baicalin and DDP on the proliferation of A549 and A549/DPP human lung cancer cells. Following addition of drugs, cells were cultured for periods of 24 and 48 h, respectively. The degree of cell proliferation inhibition was calculated as: inhibitory rate of cell proliferation (%) = (1-absorbance of the experimental group/absorbance of the control group) ×100%. Our results showed that baicalin and DPP when used alone inhibited the proliferation of A549 cells in a dose-dependent manner at 24 and 48 h, respectively (Fig. 1). Similarly, baicalin and DPP inhibited the proliferation of A549/DDP cells in a dose-dependent manner at 24 and 48 h. The ability of baicalin to inhibit tumor cell proliferation was similar between A549 and A549/DDP cells, whereas the ability of DDP to inhibit cell proliferation was lower in A549/DDP cells (Fig. 1).

Figure 1

Baicalin and DDP inhibit the proliferation of human lung cancer cells when used alone. MTT assay was utilized to evaluate effects of baicalin and DDP on the proliferation of A549 and A549/DPP human lung cancer cells respectively. Following addition of drugs, cells were cultured for 24 and 48 h, respectively. The degree of cell proliferation inhibition was calculated as: inhibitory rate of cell proliferation (%) = (1-absorbance of the experimental group/absorbance of the control group) ×100%. (A) Inhibitory rate of tumor cell proliferation at 24 h after drug treatment. (B) Inhibitory rate of tumor cell proliferation at 48 h after drug treatment. Baicalin and DPP when used alone inhibited the proliferation of A549 and A549/DDP cells in a dose-dependent manner at 24 and 48 h (mean ± SEM, n=3/group). *p<0.05, **p<0.01 and ***p<0.001, respectively when compared with the baicalin 1 µg/ml group; #p<0.05 and ##p<0.01, respectively when compared with the DPP 1 µg/ml group. DDP, cis-diamminedichloroplatinum, cisplatin.

Effects of combination of baicalin and DDP on the proliferation of human lung cancer cells

MTT assay was utilized to evaluate effects of combination of baicalin and DDP on the proliferation of A549 and A549/DPP human lung cancer cells. Following addition of drugs, cells were cultured for periods of 24 and 48 h, respectively. The probability sum method was used to determine effects of the drug combination. Formula: q=EAB/(EA+EB-EAxEB). The effects of drug A and B are additive if q is between 0.85 and 1.15. Drug A and B are synergistic if q>1.15, and antagonistic if q<0.85. Baicalin (8 µg/ml) antagonized DDP when concentrations of DDP were 1, 2, 4 and 8 µg/ml at 24 h after A549 cells were treated (q<0.85). The effects of baicalin and DDP were additive when the concentration of DDP was 8 µg/ml (0.85<q<1.15), and synergistic when the concentration of DDP was 4 µg/ml at 48 h after A549 cells were treated (q>1.15) (Table I). In addition, at 24 h after A549/DPP cells were treated, baicalin (8 µg/ml) antagonized DDP when concentrations of DDP were 1, 2 and 8 µg/ml (q<0.85), whereas effects of baicalin and DDP were additive when the concentration of DDP was 4 µg/ml (0.85<q<1.15). At 48 h after A549/DDP cells were treated, effects of baicalin and DDP were additive when the concentration of DDP was 8 µg/ml (0.85<q<1.15), and synergistic when the concentration of DDP was 4 µg/ml (q>1.15) (Table II). In conclusion, synergistic effects of baicalin and DDP on proliferation of both A549 and A549/DDP cells were observed when concentrations of baicalin and DPP were 8 and 4 µg/ml respectively. Therefore, we used the dosages to examine tumor invasion.

Table I

Effects of baicalin and DDP on the proliferation of A549 cells.

Table I

Effects of baicalin and DDP on the proliferation of A549 cells.

A549 cellsBaicalin
(8a)
DDP
(1)
DDP
(2)
DDP
(4)
DDP
(8)
Baicalin (8) + DDP (1)Baicalin (8) + DDP (2)Baicalin (8)+ DDP (4)Baicalin (8) + DDP (8)
A549 cells/24 h
 EA0.20
 EB0.130.200.220.31
 EAB0.100.180.280.36
 q=(EAB/(EA+EB-EAxEB)0.310.500.740.80
A549 cells/48 h
 EA0.21
 EB0.170.210.260.41
 EAB0.260.290.490.50
 q=(EAB/(EA+EB-EAxEB)0.760.761.20b0.94c

{ label (or @symbol) needed for fn[@id='tfn1-ijo-50-01-0093'] } MTT assay was utilized to detect cell proliferation. Data for inhibition of cell proliferation (mean values). The probability sum method was used to determine effects of the drug combination. Formula: q=EAB/(EA+EB-EAxEB). EAB is the effect when drug A and B are combined. EA and EB are the effects of separate treatments with drug A and B alone. The effects of drug A and B are additive if q is between 0.85 and 1.15. Drug A and B are synergistic if q>1.15, and antagonistic if q<0.85. Baicalin (8 µg/ml) antagonized DDP when concentrations of DDP were 1, 2, 4 and 8 µg/ml at 24 h after A549 cells were treated. In addition, effects of baicalin and DDP were additive when the concentration of DDP was 8 µg/ml, and synergistic when the concentration of DDP was 4 µg/ml at 48 h. DDP, cis-diamminedichloroplatinum, cisplatin.

a The unit in the table is µg/ml;

b synergist effects;

c additive effects.

Table II

Effects of baicalin and DDP on the proliferation of A549/DDP cells.

Table II

Effects of baicalin and DDP on the proliferation of A549/DDP cells.

A549 cellsBaicalin
(8a)
DDP
(1)
DDP
(2)
DDP
(4)
DDP
(8)
Baicalin (8) + DDP (1)Baicalin (8) + DDP (2)Baicalin (8) + DDP (4)Baicalin (8) + DDP (8)
A549/DDP cells/24 h
 EA0.11
 EB0.100.120.130.21
 EAB0.070.090.210.21
 q=(EAB/(EA+EB-EAxEB)0.360.400.89b0.73
A549/DDP cells/48 h
 EA0.19
 EB0.110.120.190.29
 EAB0.130.240.400.41
 q=(EAB/(EA+EB-EAxEB)0.480.841.17c0.95b

{ label (or @symbol) needed for fn[@id='tfn5-ijo-50-01-0093'] } The effects of drug A and B are additive if q is between 0.85 and 1.15. Drug A and B are synergistic if q>1.15, and antagonistic if q<0.85. Baicalin (8 µg/ml) antagonized DDP when concentrations of DDP were 1, 2 and 8 µg/ml, whereas effects of baicalin and DDP were additive when the concentration of DDP was 4 µg/ml at 24 h after A549/DPP cells were treated. In addition, effects of baicalin and DDP were additive when the concentration of DDP was 8 µg/ml, and synergistic when the concentration of DDP was 4 µg/ml at 48 h. DDP, cis-diamminedichloroplatinum, cisplatin.

a The unit in the table is µg/ml;

b additive effects;

c synergist effects.

Combination of baicalin and DDP enhances the invasion of human lung cancer cells

A549 and A549/DDP cells were treated with baicalin (8 µg/ml), DDP (4 µg/ml), and baicalin (8 µg/ml) combined with DDP (4 µg/ml) for 48 h, respectively. Transwell invasion assay was used to detect the invasion of A549 and A549/DPP human lung cancer cells. When used alone, DDP and baicalin significantly inhibited the invasion of A549 (p<0.001) and A549/DDP cells (DDP, p<0.001; baicalin, p<0.01) (Fig. 2) as compared to the control group. When DDP and baicalin were combined, the inhibitory rate increased markedly as compared to DPP or baicalin single treatment groups (p<0.001) (Fig. 2).

Figure 2

Effects of baicalin and DDP on the invasion of human lung cancer cells. A549 and A549/DDP cells were treated with baicalin (8 µg/ml), DDP (4 µg/ml), and baicalin (8 µg/ml) combined with DDP (4 µg/ml) for 48 h, respectively. Transwell invasion assay was used to detect the invasion of tumor cells. (A) Microscopic images of Transwell results (×400). (B) Statistical analysis of inhibitory rates of tumor cell invasion. When used alone, DDP and baicalin significantly inhibited the invasion of A549 and A549/DDP cells as compared to the control group. When DDP and baicalin were combined, the inhibitory rate increased markedly as compared to DPP or baicalin alone groups (mean ± SEM, n=3/group). **, ***p<0.05 when compared with the control group; ###p<0.001 when compared with DDP or baicalin group. DDP, cis-diamminedichloroplatinum, cisplatin.

mRNA expression of MARK2 in human lung cancer cells

The mRNA expression of MARK2 in A549 and A549/DPP human lung cancer cells was detected by qPCR. A549/DDP cells had markedly higher MARK2 mRNA levels compared to A549 cells (p<0.001) (Fig. 3A). Therefore, we chose A549/DDP cells to examine effects of different concentrations of baicalin on MARK2 mRNA expression. Baicalin decreased MARK2 mRNA levels in A549/DDP cells dose-dependently, and higher doses of baicalin (2, 4 and 8 µg/ml) markedly inhibited MARK2 mRNA expression (p<0.05, p<0.001 and p<0.001, respectively) (Fig. 3B) when compared to the control group.

Figure 3

mRNA expression of MARK2 in human lung cancer cells. The mRNA expression of MARK2 in A549 and A549/DPP human lung cancer cells was detected by qPCR. (A) mRNA expression of MARK2 in A549 and A549/DDP cells. (B) Effects of different doses of baicalin on MARK2 mRNA expression in A549/DDP cells. A549/DDP cells had markedly higher MARK2 mRNA levels compared to A549 cells. Therefore, we chose A549/DDP cells to examine effects of different concentrations of baicalin on MARK2 mRNA expression. Baicalin decreased MARK2 mRNA levels in A549/DDP cells dose-dependently as compared to the control group (mean ± SEM, n=3/group). (A) ***p<0.001 as compared to A549 cells; (B) *p<0.05 and ***p<0.001 when compared with the control group. Ctrl, control; DDP, cis-diamminedichloroplatinum, cisplatin.

Protein expression of Akt, p-Akt and MARK2 in human lung cancer cells

Protein expression of Akt, p-Akt and MARK2 was detected by western blot analysis. Relative protein expression of Akt, p-Akt and MARK2 to GAPDH was calculated. There were no differences in Akt expression between A549 and A549/DDP cells. The protein expression of p-Akt and MARK2 was markedly higher in A549/DDP cells as compared to A549 cells (p-Akt: p<0.001; MARK2: p<0.01) (Fig. 4). Therefore, we chose A549/DDP cells to examine effects of different doses of baicalin on protein expression of MARK2, p-Akt, and Akt. Baicalin decreased protein expression of MARK2 and p-Akt in A549/DDP cells in a dose-dependent manner, whereas it did not alter protein expression of Akt. At higher doses (2, 4 and 8 µg/ml), baicalin significantly inhibited protein expression of MARK2 and p-Akt in A549/DDP cells as compared to the control group (p<0.01, p<0.001 and p<0.001, respectively) (Fig. 5).

Figure 4

Protein expression of Akt, p-Akt and MARK2 in A549 and A549/DDP cells. Protein expression was detected by western blot analysis. Relative protein expression of Akt, p-Akt and MARK2 to GAPDH was calculated. (A) Western blot results show protein expression of Akt, p-Akt and MARK2 in A549 and A549/DDP cells. (B) Quantification of relative fold-change in blot density when compared with density of GADPH. The protein expression of p-Akt and MARK2 was markedly higher in A549/DDP cells as compared to A549 cells (mean ± SD, n=3/group). **p<0.01 and ***p<0.001 when compared to A549 cells. DDP, cis-diamminedichloroplatinum, cisplatin.

Figure 5

Effects of baicalin on protein expression of MARK2, p-Akt and Akt in A549/DDP cells. Protein expression was detected by western blot analysis. Relative protein expression of Akt, p-Akt and MARK2 to GAPDH was calculated. (A) Western blot results show protein expression of Akt, p-Akt and MARK2 in A549/DDP cells after baicalin treatment. (B-D) Quantification of relative fold-change in blot density when compared with density of GADPH. Baicalin decreased protein expression of MARK2 and p-Akt in A549/DDP cells in a dose-dependent manner, whereas it did not alter protein expression of Akt (mean ± SD, n=3/group). **p<0.01 and ***p<0.001 when compared to the control group. DDP, cis-diamminedichloroplatinum, cisplatin; Ctrl, Control.

Discussion

We demonstrated that baicalin and DDP were synergistic at inhibiting proliferation and invasion of human lung cancer cells at appropriate dosages and incubation time in the presence or absence of DDP resistance. In addition, the attenuation of DDP resistance was associated with downregulation of MARK2 and p-Akt.

Lung cancer is the leading cause of cancer-related death worldwide (21). DDP was the first member of a class of platinum-containing anticancer drugs. These platinum complexes react in vivo and cause DNA cross-linking, which ultimately triggers cell apoptosis (22). Like other chemotherapeutic agents, resistance to DDP is inevitable and frequently occurs after several cycles of treatment. DDP resistance has been reported to be associated with mechanisms such as DNA damage/repair proteins, drug retention such as increased influx or decreased uptake, increased drug inactivation or prevention of drug to reach DNA target, growth signaling via different pathways or increase in anti-apoptotic proteins, and hypoxia-induced autophagy (23–28).

Studies have proposed measures to decrease DDP resistance. mTOR inhibitor (CCI-779) was revealed to be able to restore sensitivity to DDP in lung cancer (29). Inhibition of miR-196a reversed DDP resistance of A549/DDP cell lines, which may be linked to inhibition of drug efflux, downregulation of drug-resistant protein expression, cell apoptosis, and suppression of cell proliferation (30). Moreover, a fusion protein based on two tumstatin-derived sequences named recombinant VBMDMP (rVBMDMP) decreased cancer cell resistance to DDP in A549/DDP cell xenograft model of nude mice (31). Epigallocatechin-3-gallate (EGCG), the major polyphenol in green tea, was also shown to resensitize non-small cell lung cancer cells to DDP via demethylation of candidate genes.

Some traditional Chinese medicines were revealed to protect cancer patients against treatment-related complications and reduce toxicity of conventional therapy (32–34). Baicalin, a flavone glycoside, was reported to inhibit proliferation of malignant tumors including hepatocellular carcinoma and glioma (16,17). However, effects of baicalin on DDP resistance in lung cancer were unclear. The main principle of lung cancer therapy is to induce cell death or inhibit cell survival (35). Therefore, we explored effects of combination of baicalin and DDP on proliferation and invasion of human lung cancer cells.

We demonstrated in the present study that effects of baicalin and DDP on proliferation inhibition of A549 and A549/DDP cells were synergistic when concentrations of baicalin and DDP were 8 and 4 µg/ml at 48 h after incubation. At these dosages, the inhibitory rate of tumor cell invasion increased significantly compared to DPP or baicalin alone groups in both A549 and A549/DDP cells. These findings indicate that baicalin increases the sensitivity and decreases resistance of DDP in lung cancer cells, no matter whether lung cancer cells already are resistant to DDP or not. These findings provide another novel approach to decrease DDP resistance in human lung cancer.

We then unveiled that baicalin dose-dependently decreased expression of MARK2 and p-Akt in A549/DDP cells. Interestingly, we showed that DDP-resistant A549 cells had significantly higher expression of MARK2 and p-Akt as compared to non-DDP-resistant A549 cells. Hence, the decreased expression of MARK2 and p-Akt after baicalin treatment may be associated with decreased DDP resistance in human lung cancer cells.

The role of MARK2 in lung cancer was recently identified. MARK2 was shown to activate cell cycle and DNA repair. High MARK2 expression levels correlated with resistance to DDP (36). In addition, Akt is an essential kinase enzyme component of the PI3K/Akt/mTOR pathway, and is a downstream effector of PI3K (37). The PI3K/Akt/mTOR pathway is an important intracellular signaling pathway related to cellular quiescence, proliferation and cancer. Over-activation of the PI3K/Akt/mTOR pathway reduces apoptosis and stimulates proliferation, and both of these processes are involved in the pathogenesis of cancer. Akt amplification was revealed to increase DDP resistance in human lung cancer cells through the mTOR/p70S6K1 pathway (38). IL-6 signaling contributed to cisplatin resistance in non-small cell lung cancer via upregulation of anti-apoptotic molecules including Akt (39). Meanwhile, DDP resistance due to loss of fragile histidine triad (FHIT) was reported to be conquered by Akt inhibitor perifosine in xenografts of non-small cell lung cancer (28). Furthermore, sorafenib reversed resistance of human gastric cancer cell line to DDP through downregulating expression MDR1 and Akt (40). As a result, baicalin is able to decrease DDP resistance, and inhibit proliferation and invasion of human lung cancer cells by downregulating MARK2 and p-Akt expression.

In conclusion, we demonstrated for the first time that baicalin and DDP were synergistic at inhibiting proliferation and invasion of human lung cancer cells at appropriate dosages and incubation time in the presence or absence of DDP resistance. The attenuation of DDP resistance was associated with downregulation of MARK2 and p-Akt. Although future research is needed to elucidate more underlying cellular and molecular mechanisms, baicalin appears to be a promising agent for reducing DDP resistance.

References

1 

Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, Parkin DM, Forman D and Bray F: Cancer incidence and mortality worldwide: Sources, methods and major patterns in GLOBOCAN 2012. Int J Cancer. 136:E359–E386. 2015. View Article : Google Scholar

2 

Belani CP: Chemotherapy regimens in advanced non-small-cell lung cancer: Recent randomized trials. Clin Lung Cancer. 3(Suppl 1): S5–S9. 2002. View Article : Google Scholar

3 

Suehisa H and Toyooka S: Adjuvant chemotherapy for completely resected non-small-cell lung cancer. Acta Med Okayama. 63:223–230. 2009.PubMed/NCBI

4 

Li CH, Cai L, Chen XS, Meng QW and Sui GJ: DDP-sensitivity-related genes in 10 lung cancer cell lines. Zhonghua Zhong Liu Za Zhi. 30:418–421. 2008.In Chinese. PubMed/NCBI

5 

Shen Y, Ren M, Shi Y, Zhang Y and Cai Y: Octreotide enhances the sensitivity of the SKOV3/DDP ovarian cancer cell line to cisplatin chemotherapy in vitro. Exp Ther Med. 2:1171–1176. 2011.

6 

Weng Y, Wang Y, Shi Y, Zhou W, Wang H and Wang C: TLR9 expression and its role in chemosensitivity to DDP in human cervical cancer cells in vitro. J Huazhong Univ Sci Technolog Med Sci. 31:550–554. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Chen J, Solomides C, Parekh H, Simpkins F and Simpkins H: Cisplatin resistance in human cervical, ovarian and lung cancer cells. Cancer Chemother Pharmacol. 75:1217–1227. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Chen Y, Gao Y, Zhang K, Li C, Pan Y, Chen J, Wang R and Chen L: MicroRNAs as regulators of cisplatin resistance in lung cancer. Cell Physiol Biochem. 37:1869–1880. 2015. View Article : Google Scholar : PubMed/NCBI

9 

Müller CB, De Bastiani MA, Becker M, França FS, Branco MA, Castro MA and Klamt F: Potential crosstalk between cofilin-1 and EGFR pathways in cisplatin resistance of non-small-cell lung cancer. Oncotarget. 6:3531–3539. 2015. View Article : Google Scholar : PubMed/NCBI

10 

Wang H, Hui KM, Xu S, Chen Y, Wong JT and Xue H: Two flavones from Scutellaria baicalensis Georgi and their binding affinities to the benzodiazepine site of the GABAA receptor complex. Pharmazie. 57:857–858. 2002.

11 

Hui KM, Wang XH and Xue H: Interaction of flavones from the roots of Scutellaria baicalensis with the benzodiazepine site. Planta Med. 66:91–93. 2000. View Article : Google Scholar : PubMed/NCBI

12 

Xu Z, Wang F, Tsang SY, Ho KH, Zheng H, Yuen CT, Chow CY and Xue H: Anxiolytic-like effect of baicalin and its additivity with other anxiolytics. Planta Med. 72:189–192. 2006. View Article : Google Scholar : PubMed/NCBI

13 

Liao JF, Hung WY and Chen CF: Anxiolytic-like effects of baicalein and baicalin in the Vogel conflict test in mice. Eur J Pharmacol. 464:141–146. 2003. View Article : Google Scholar : PubMed/NCBI

14 

Tarragó T, Kichik N, Claasen B, Prades R, Teixidó M and Giralt E: Baicalin, a prodrug able to reach the CNS, is a prolyl oligopeptidase inhibitor. Bioorg Med Chem. 16:7516–7524. 2008. View Article : Google Scholar : PubMed/NCBI

15 

Takahashi H, Chen MC, Pham H, Angst E, King JC, Park J, Brovman EY, Ishiguro H, Harris DM, Reber HA, et al: Baicalein, a component of Scutellaria baicalensis, induces apoptosis by Mcl-1 downregulation in human pancreatic cancer cells. Biochim Biophys Acta. 1813:1465–1474. 2011. View Article : Google Scholar : PubMed/NCBI

16 

Zhang Z, Lv J, Lei X, Li S, Zhang Y, Meng L, Xue R and Li Z: Baicalein reduces the invasion of glioma cells via reducing the activity of p38 signaling pathway. PLoS One. 9:e903182014. View Article : Google Scholar : PubMed/NCBI

17 

Chen K, Zhang S, Ji Y, Li J, An P, Ren H, Liang R, Yang J and Li Z: Baicalein inhibits the invasion and metastatic capabilities of hepatocellular carcinoma cells via downregulation of the ERK pathway. PLoS One. 8:e729272013. View Article : Google Scholar

18 

Dickey CA, Koren J, Zhang YJ, Xu YF, Jinwal UK, Birnbaum MJ, Monks B, Sun M, Cheng JQ, Patterson C, et al: Akt and CHIP coregulate tau degradation through coordinated interactions. Proc Natl Acad Sci USA. 105:3622–3627. 2008. View Article : Google Scholar : PubMed/NCBI

19 

Peltier J, O'Neill A and Schaffer DV: PI3K/Akt and CREB regulate adult neural hippocampal progenitor proliferation and differentiation. Dev Neurobiol. 67:1348–1361. 2007. View Article : Google Scholar : PubMed/NCBI

20 

Jin ZJ: About the evaluation of drug combination. Acta Pharmacol Sin. 25:146–147. 2004.PubMed/NCBI

21 

Parkin DM, Bray F, Ferlay J and Pisani P: Global cancer statistics, 2002. CA Cancer J Clin. 55:74–108. 2005. View Article : Google Scholar : PubMed/NCBI

22 

Apps MG, Choi EH and Wheate NJ: The state-of-play and future of platinum drugs. Endocr Relat Cancer. 22:R219–R233. 2015.PubMed/NCBI

23 

Siddik ZH: Cisplatin: Mode of cytotoxic action and molecular basis of resistance. Oncogene. 22:7265–7279. 2003. View Article : Google Scholar : PubMed/NCBI

24 

Murata T, Haisa M, Uetsuka H, Nobuhisa T, Ookawa T, Tabuchi Y, Shirakawa Y, Yamatsuji T, Matsuoka J, Nishiyama M, et al: Molecular mechanism of chemoresistance to cisplatin in ovarian cancer cell lines. Int J Mol Med. 13:865–868. 2004.PubMed/NCBI

25 

Wu HM, Jiang ZF, Ding PS, Shao LJ and Liu RY: Hypoxia-induced autophagy mediates cisplatin resistance in lung cancer cells. Sci Rep. 5:122912015. View Article : Google Scholar : PubMed/NCBI

26 

Im JY, Lee KW, Won KJ, Kim BK, Ban HS, Yoon SH, Lee YJ, Kim YJ, Song KB and Won M: DNA damage-induced apoptosis suppressor (DDIAS), a novel target of NFATc1, is associated with cisplatin resistance in lung cancer. Biochim Biophys Acta. 1863:40–49. 2016. View Article : Google Scholar

27 

Yang Y, Zhang P, Zhao Y, Yang J, Jiang G and Fan J: Decreased MicroRNA-26a expression causes cisplatin resistance in human non-small cell lung cancer. Cancer Biol Ther. 17:515–525. 2016. View Article : Google Scholar :

28 

Wu DW, Lee MC, Hsu NY, Wu TC, Wu JY, Wang YC, Cheng YW, Chen CY and Lee H: FHIT loss confers cisplatin resistance in lung cancer via the AKT/NF-κB/Slug-mediated PUMA reduction. Oncogene. 34:3882–3883. 2015. View Article : Google Scholar : PubMed/NCBI

29 

Wu C, Wangpaichitr M, Feun L, Kuo MT, Robles C, Lampidis T and Savaraj N: Overcoming cisplatin resistance by mTOR inhibitor in lung cancer. Mol Cancer. 4:252005. View Article : Google Scholar : PubMed/NCBI

30 

Li JH, Luo N, Zhong MZ, Xiao ZQ, Wang JX, Yao XY, Peng Y and Cao J: Inhibition of microRNA-196a may reverse cisplatin resistance of A549/DDP non-small-cell lung cancer cell line. Tumour Biol. 37:2387–2394. 2016. View Article : Google Scholar

31 

Wang CK, Zhang Y, Zhang ZJ, Qiu QW, Cao JG and He ZM: Effects of VBMDMP on the reversal of cisplatin resistance in human lung cancer A549/DDP cells. Oncol Rep. 33:372–382. 2015.

32 

Li X, Yang G, Li X, Zhang Y, Yang J, Chang J, Sun X, Zhou X, Guo Y, Xu Y, et al: Traditional Chinese medicine in cancer care: A review of controlled clinical studies published in Chinese. PLoS One. 8:e603382013. View Article : Google Scholar : PubMed/NCBI

33 

Dong J, Su SY, Wang MY and Zhan Z: Shenqi fuzheng, an injection concocted from Chinese medicinal herbs, combined with platinum-based chemotherapy for advanced non-small cell lung cancer: A systematic review. J Exp Clin Cancer Res. 29:1372010. View Article : Google Scholar : PubMed/NCBI

34 

Lichti-Kaiser K and Staudinger JL: The traditional Chinese herbal remedy tian xian activates pregnane X receptor and induces CYP3A gene expression in hepatocytes. Drug Metab Dispos. 36:1538–1545. 2008. View Article : Google Scholar : PubMed/NCBI

35 

Sui X, Chen R, Wang Z, Huang Z, Kong N, Zhang M, Han W, Lou F, Yang J, Zhang Q, et al: Autophagy and chemotherapy resistance: A promising therapeutic target for cancer treatment. Cell Death Dis. 4:e8382013. View Article : Google Scholar : PubMed/NCBI

36 

Hubaux R, Thu KL, Vucic EA, Pikor LA, Kung SH, Martinez VD, Mosslemi M, Becker-Santos DD, Gazdar AF, Lam S, et al: Microtubule affinity-regulating kinase 2 is associated with DNA damage response and cisplatin resistance in non-small cell lung cancer. Int J Cancer. 137:2072–2082. 2015. View Article : Google Scholar : PubMed/NCBI

37 

Sarbassov DD, Guertin DA, Ali SM and Sabatini DM: Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science. 307:1098–1101. 2005. View Article : Google Scholar : PubMed/NCBI

38 

Liu LZ, Zhou XD, Qian G, Shi X, Fang J and Jiang BH: AKT1 amplification regulates cisplatin resistance in human lung cancer cells through the mammalian target of rapamycin/p70S6K1 pathway. Cancer Res. 67:6325–6332. 2007. View Article : Google Scholar : PubMed/NCBI

39 

Duan S, Tsai Y, Keng P and Chen Y, Lee SO and Chen Y: IL-6 signaling contributes to cisplatin resistance in non-small cell lung cancer via the upregulation of anti-apoptotic and DNA repair associated molecules. Oncotarget. 6:27651–27660. 2015. View Article : Google Scholar : PubMed/NCBI

40 

Huang YS, Xue Z and Zhang H: Sorafenib reverses resistance of gastric cancer to treatment by cisplatin through downregulating MDR1 expression. Med Oncol. 32:4702015. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Xu Z, Mei J and Tan Y: Baicalin attenuates DDP (cisplatin) resistance in lung cancer by downregulating MARK2 and p-Akt. Int J Oncol 50: 93-100, 2017.
APA
Xu, Z., Mei, J., & Tan, Y. (2017). Baicalin attenuates DDP (cisplatin) resistance in lung cancer by downregulating MARK2 and p-Akt. International Journal of Oncology, 50, 93-100. https://doi.org/10.3892/ijo.2016.3768
MLA
Xu, Z., Mei, J., Tan, Y."Baicalin attenuates DDP (cisplatin) resistance in lung cancer by downregulating MARK2 and p-Akt". International Journal of Oncology 50.1 (2017): 93-100.
Chicago
Xu, Z., Mei, J., Tan, Y."Baicalin attenuates DDP (cisplatin) resistance in lung cancer by downregulating MARK2 and p-Akt". International Journal of Oncology 50, no. 1 (2017): 93-100. https://doi.org/10.3892/ijo.2016.3768
Copy and paste a formatted citation
x
Spandidos Publications style
Xu Z, Mei J and Tan Y: Baicalin attenuates DDP (cisplatin) resistance in lung cancer by downregulating MARK2 and p-Akt. Int J Oncol 50: 93-100, 2017.
APA
Xu, Z., Mei, J., & Tan, Y. (2017). Baicalin attenuates DDP (cisplatin) resistance in lung cancer by downregulating MARK2 and p-Akt. International Journal of Oncology, 50, 93-100. https://doi.org/10.3892/ijo.2016.3768
MLA
Xu, Z., Mei, J., Tan, Y."Baicalin attenuates DDP (cisplatin) resistance in lung cancer by downregulating MARK2 and p-Akt". International Journal of Oncology 50.1 (2017): 93-100.
Chicago
Xu, Z., Mei, J., Tan, Y."Baicalin attenuates DDP (cisplatin) resistance in lung cancer by downregulating MARK2 and p-Akt". International Journal of Oncology 50, no. 1 (2017): 93-100. https://doi.org/10.3892/ijo.2016.3768
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team