![Open Access](/resources/images/iconopenaccess.png)
Role of miR‑181a‑5p in cancer (Review)
- Authors:
- Published online on: August 3, 2023 https://doi.org/10.3892/ijo.2023.5556
- Article Number: 108
-
Copyright: © Li et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
Abstract
1. Introduction
MicroRNA (miRNAs/miRs) are small non-coding (nc) RNAs with the size of 17-25 nucleotides. The first miRNA was identified in 1993 when a small ncRNA was discovered in Caenorhabditis elegans heterochronic gene lin-4 (1). Subsequently, other small RNAs were found in Caenorhabditis elegans, Drosophila and humans (2-4). Later, researchers realized that small ncRNAs are functional products that have an impact on development outside of translating proteins (5-7). The discovery of miRNAs shed light on post-transcriptional regulation of gene expression. Briefly, miRNA genes are transcribed into primary miRNAs and processed into mature miRNA duplexes by pol-II, Drosha and Dicer. Then, the miRNA duplex is loaded into argonaute protein to form the RNA-induced silencing complex, which navigates the mature miRNA to the 3'UTR of their targeted mRNA through base pairing, resulting in mRNA transcriptional inhibition or mRNA degradation (8). In the past few years, studies on miRNAs have increased, and as of June 2023, 38,589 miRNAs have been annotated in the miRBase miRNA database (https://www.mirbase.org/). Abundant studies have substantiated the intricate association between dysregulated miRNAs and a multitude of diseases, notably carcinogenesis (9,10). These miRNAs are powerful regulators of various cellular processes including cell proliferation, differentiation, development and apoptosis (11,12). As a pivotal constituent of the ncRNA network, miRNAs possess the ability to occupy numerous nodes owing to their capacity to target a considerable number of mRNAs (13). With the development of computational and sequencing technology, researchers can easily predict the target genes of a miRNA through its sequence for target recognition called the 'seed sequence', which is the nucleotides 2-8 of a miRNA (13,14). In recent years, studies have deciphered the biological function of miRNAs extensively, but understanding of the role of miRNAs still requires a tremendous amount of work.
MiR-181a-5p has been extensively studied as a regulatory miRNA with altered expression in various diseases. For instance, studies have revealed that miR-181a-5p alleviates vascular inflammation, atherosclerosis and inflammatory response in monocrotaline-induced pulmonary arterial hypertension (15,16). In addition, it is associated with obesity and insulin resistance (17). Currently, numerous research has identified upregulated or downregulated expression levels of miR-181a-5p in different tumors, highlighting its role in regulating tumorigenesis through post-transcriptional suppression of its targeted genes (18,19). The present review summarizes the recent studies on miR-181a-5p, explain its role in cancer and chemotherapy and outlines its potential as a biomarker.
2. Regulation of miR-181a-5p in cancer
MiR-181a-5p is a conserved miRNA belonging to the miR-181 family, which comprises four mature miRNAs. These mature miRNAs, namely miR-181a, miR-181b, miR-181c and miR-181d, all share the identical 'seed' sequence 'ACAUUCA'. In humans, miR-181a is located in chromosome 1. MiR-181a-5p is a mature single strand of miR-181a with the sequence 'AACAUUCAACGCUGUCGGUGAGU', while miR-181a-3p is a passenger strand (15,20).
Numerous studies have suggested that dysregulation of miR-181a-5p in tumors is regulated the following factors:
Competing endogenous RNAs (ceRNAs). MicroRNAs have the ability to bind to specific sequences on target RNA transcripts called microRNA recognition elements (MREs). Through these MREs, ncRNAs that are upstream mediators of miRNAs, such as lncRNAs and circRNAs, can bind to miRNA and function as a miRNA sponge to inhibit its expression (21,22). Numerous ncRNAs, such as colon cancer-associated transcript 1 (CCAT1) and nuclear enriched abundant transcript 1 (NEAT1), have been demonstrated to be sponges of miR-181a-5p in multiple systems of cancer (23-25).
Transcription factors (TFs). NF-κB is positively correlated with the expression of miR-181a-5p. NF-κB short interfering (si)RNA decreases the expression of miR-181a-5p (26). In addition, STAT1 inhibits the expression of miR-181a-5p by binding to its promoter (27). These results indicate that activation or downregulation of miR-181a-5p is modulated by TFs.
DNA methylation. DNA methylation occurs in the CpG island of the promoter region. It is a crucial mechanism of miRNA downregulation. In colorectal cancer, hypermethylation of CpG islands transcriptionally represses the expression of miR-181a-5p (28).
Other factors. Hypoxia also leads to the dysregulation of miR-181a-5p. However, the effects of hypoxia for miR-181a-5p were reversed in different types of cancer. Moreover, the concrete mechanism has not yet been clarified (29,30).
3. MiR-181a-5p in different types of cancer
The growth of cancer is associated with its malignant cell hallmarks, which include the capabilities for sustaining proliferative signaling, evading growth suppressors, resisting cell death, enabling replicative immortality, inducing/accessing vasculature, activating invasion and metastasis, reprogramming cellular metabolism and avoiding immune destruction (31). MiR-181a-5p exerts its influence on various tumor properties, including cell proliferation, metasitasis, angiogenesis, epithelial-mesenchymal transition (EMT) and autophagy (Fig. 1). It is important to note that the expression of miR-181a-5p is specific to certain tissues and it can simultaneously target multiple genes, potentially playing dual roles. The function of miR-181a-5p is not reliant on a specific target, but rather on the collective impact of its targets, which may encompass both tumor suppressor genes and oncogenes (32). The present study summarizes the existing studies on miR-181a-5p in different tumors and has described them in various systems. The summary of results is provided in (Table I).
Tumors of the digestive system
Colorectal cancer
Colorectal cancer (CRC) is the third most common cancer worldwide and also the most frequent tumor of the digestive tract. The high migratory and invasive properties of CRC cells promote the progression of CRC and lead to poor prognosis of patients with CRC (33).
MiR-181a-5p inhibits proliferation and induces apoptosis
In CRC, results indicate that miR-181a-5p suppresses tumor growth by regulating the Wnt/β-catenin signaling pathway. It has been observed to inhibit cell proliferation, 5-FU sensitivity and promote apoptosis (34,35). The inhibitory effect of miR-181a-5p has also been confirmed in microsatellite-instable CRC, where its expression of miR-181a-5p is reduced and miR-181a-5p directly binds to the 3'UTR of pleomorphic adenoma gene 1 (PLAG1) (28). Another well-established target of miR-181a-5p is p53. Upregulation of miR-181a-5p promotes apoptosis by modulating Bax and Bcl-2 (24). In addition, a previous study revealed that lncRNA-ANRIL can sponge miR-181a-5p, inhibiting apoptosis and radiosensitivity in colon cancer cells (36).
MiR-181a-5p inhibits migration and invasion
The lncRNA-SNHG6 has been identified to be positively correlated with tumor progression and distant metastasis (37). MiR-181a-5p is the direct target of both SNHG6 and E2F5. By inhibiting E2F5, miR-181a-5p induces G0/G1 arrest and suppresses CRC cell migration and invasion (38). Additionally, a study revealed that miR-181a-5p reverses the effects of circRNA-NSUN2 on promoting cell proliferation and migration by binding to the 3'UTR of Rho-associated coiled-coil-containing protein kinase 2 (ROCK2) (39).
MiR-181a-5p promotes CRC growth and metastasis
MiR-181a-5p have been demonstrated to be associated with liver metastasis of CRC. This may be attributed to the enrichment of miR-181a-5p in extracellular vesicles of CRC, which alters the tumor environment (TME) (40). MiR-181a-5p promotes motility, invasion and tumor growth by directly targeting Wnt inhibitory factor 1 (WIF-1). Notably, it participates in the regulation of EMT, which is considered a crucial process in cancer metastasis (41). MiR-181a-5p also promotes metastasis and cell proliferation in CRC by inhibiting PTEN, a tumor suppressor gene (42). Multiple studies have showed that miR-181a-5p binds to the 3'UTR of PTEN mRNA, leading to reduced PTEN expression and subsequent activation of the phosphorylated (p)-AKT pathway (27,43). In these cases, the expression of miR-181a-5p is upregulated by IL-1β/NF-kb signaling (26), while STAT1 acts as an inhibitor of miR-181a-5p (27). Furthermore, miR-181a-5p induces metabolic shifts in CRC, favoring glycolysis over oxidative pathways and resulting in increased lactic acid release (43). Finally, angiogenesis is an important feature for tumor growth and metastasis. The pro-angiogenic ability of miR-181a-5p has been demonstrated, and it inhibits the expression of SRC kinase signaling inhibitor 1 (SRCIN1) and reversion-inducing cysteine-rich protein with Kazal motifs (RECK) to promote angiogenesis (Fig. 2) (44,45).
Gastric cancer
Gastric cancer (GC) is a major health burden worldwide. It is the second cause of cancer-related mortalities after lung cancer (46).
MiR-181a-5p promotes GC cell proliferation
A previous study has reported an elevation of miR-181a-5p in GC tissues, which is corelated with tumor progression (47). Meanwhile, TGF-β level is decreased in GC tissues compared with normal tissues. Experimental results indicate that miR-181a-5p directly interacts with TGF-β, thereby facilitating tumor cell proliferation in vivo and in vitro (48). The Ras association domain family (RASSF) is a crucial contributor in the formation of tumors. Another study has demonstrated that miR-181a-5p promotes GC cell proliferation and G1/S transition, and suppresses apoptosis by inhibiting RASSF1A (49). MiR-181a-5p also inhibits ATP4B and tyrosine-protein phosphatase megakaryocyte 2 to promote GC tumor growth (50,51).
MiR-181a-5p promotes GC metastasis
MiR-181a-5p modulates the RASSF6/MAPK pathway, promoting proliferation, migration, invasion, metastasis and inducing EMT in GC (52). The role of miR-181a-5p in promoting metastasis in GC is further confirmed by evidence showing that it inhibits caprin-1 to promote cell proliferation, invasion and migration, while reducing apoptosis in vitro and in vivo (53).
MiR-181a-5p inhibits GC growth and metastasis
MiR-181a-5p has been reported to negatively regulate autophagy of cisplatin resistant cells. MiR-181a-5p increases sensitivity of drug-resistant cells to cisplatin and the tumor volume of nude mice. In this context, ATG5 is a potential target of miR-181a-5p (54). Lin et al also revealed that miR-181a-5p blocks GC cell proliferation, migration and invasion (55). Oncogenic factor, Prox1, was considered to be a downstream target of miR-181a-5p (55). In gastric adenocarcinoma, miR-181a-5p has been indicated to inhibit cell proliferation and increase apoptosis by modulating the AKT pathway (Fig. 2) (56).
Hepatocellular carcinoma
Hepatocellular carcinoma (HCC) is the most common type of liver cancer, accounting for 75-85% of all types of liver cancer, which caused ~830,000 mortalities worldwide as of 2020 (46). Several experimental results indicate that miR-181a-5p may plays its role as a tumor inhibitor in HCC (Fig. 2).
MiR-181a-5p suppresses HCC metastasis
MiR-181a-5p inhibits c-Met to promote branching-morphogenesis and invasion of HCC cells (18). Additionally, it induces glucose metabolism reprogramming, which is associated with the progression and early lung metastasis of HCC. Mechanistically, miR-181a-5p reduces the expression of mitochondrially encoded (mt)-Cytochrome B and mt-Cytochrome C oxidase subunit 2 proteins, thus decreasing the electron transport chain (ETC). This reduction in ETC activity results in an increase in hexokinase 2 (HK2) and glucose transporter 1, enhancing glucose uptake, lactic acid release and LDH activity (57).
MiR-181a-5p inhibits HCC growth
Early growth response factor1 (Egr1) plays a crucial role in cancer progression by activating the TGF-β/Smad pathway. Evidence has demonstrated that miR-181a-5p inhibits Egr1 by binding to its 3'UTR, resulting in tumor proliferation suppression in HCC (58). Assays have showed that miR-181a-5p inhibits HCC cell autophagy by targeting ATG7, which is positively correlated with autophagy (59).
However, a previous report suggested that lncRNA-XIST increases the cancer suppressor gene PTEN through the inhibition of miR-181a-5p. Restored miR-181a-5p expression promotes the HCC cell proliferation and invasion (60).
Esophageal adenocarcinoma
MiR-181a-5p inhibits cisplatin resistance in esophageal adenocarcinoma. In comparison with constructed cisplatin-resistant EAC cells, the miR-181a-5p expression is significantly higher in normal EAC cells. Furthermore, miR-181a-5p exhibits stronger cisplatin-induced inhibition of proliferation and promotion of apoptosis. In addition, CBLB, which is involved in ubiquitination to aggravate cisplatin resistance, is identified as a direct target of miR-181a-5p (Fig. 2) (61).
Pancreatic cancer
Pancreatic cancer (PC) is the most malignant tumor of the digestive system, which is extremely aggressive (62). Although early findings have revealed that miR-181a-5p, which indirectly inhibits the PTEN and MAP2K4, enhances the invasion capability of PC (63), another report after 8 years revealed that miR-181a-5p inhibits PC by targeting high mobility group box 1 (HMGB1). It inhibits PC cell proliferation, invasion, migration and resistance of gemcitabine, while reducing the expression of miR-181a-5p attenuates these effects. In addition, lncRNA-ANRIL decreases HMGB1 by sponging miR-181a-5p to activate cell autophagy (Fig. 2) (64).
Respiratory system tumors
Non-small cell lung cancer (NSCLC)
Lung cancer is the most commonly diagnosed cancer in the world and is characterized by a high rate of metastasis and delayed diagnosis (65). NSCLC accounts for 80-85% of all types of lung cancer (66). The following studies indicate that miR-181a-5p is a tumor inhibitor in NSCLC. It can inhibit tumor growth and metastasis by targeting multiple pro-tumorigenic factors. MiR-181a-5p targets the recognized oncogene Kras by binding to its 3'UTR, thereby slowing cell proliferation and migration (67). It has also been found to target CDK1 and E2F7, which regulate the cell cycle and promote tumor proliferation (68,69). Additionally, miR-181a-5p has been demonstrated to target HMGB2 to inhibit NSCLC cell migration and invasion (25). It is worth mentioning that NF-κB has been indicated to promote miR-181a-5p expression in colorectal cancer (26). However, a report has demonstrated that IL-17 inhibits miR-181a-5p by activating NF-κB (70). Furthermore, vascular cell adhesion molecule 1 has been demonstrated to be a direct target of miR-181a-5p. This laterally proves that miR-181a-5p can reduce vascular oxygen supply (70). In these cases, lncRNA NEAT1 and SNHG7 have been demonstrated to be up-stream regulators of miR-181a-5p as a miRNA sponge (25,69,71). Notably, miR-181a-5p can alleviate immunosuppression and anti-PD-1 resistance of NSCLC, providing a novel strategy for enhancing the efficacy of immunotherapy (72).
Laryngeal cancer
MiR-181a-5p has a tumor suppressor property in laryngeal cancer. Myc target protein 1 (MYCT1) is known to regulate cell apoptosis (73). Recently, Wang et al revealed that MYCT1 collaborates with MYC-associated protein X to enhance the promoter of miR-181a-5p, which binds to the 3'UTR of nucleophosmin 1 (NPM1), thus inhibiting laryngeal cancerous cell viability, colony formation and promoting apoptosis (74). Another study has demonstrated that miR-181a-5p inhibits EMT of laryngeal cancer by targeting Snai2 (75).
Cancer of the reproductive system
Breast cancer (BC)
BC is one of the leading causes of mortality among women worldwide (76).
MiR-181a-5p promotes tumor growth of BC
Exosome-derived miR-181a-5p is upregulated in BC. By targeting PIAS3, it promotes the expansion of early-stage myeloid-derived suppressor cells, which in turn exacerbate cell proliferation, induce tumor growth and evade immune destruction (19). In addition, miR-181a-5p increases the level of p-AKT by co-targeting PH-domain leucine-rich repeat-containing protein phosphatase 2 and Inositol polyphosphate 4-phosphatase type II phosphatases in luminal breast cancer, resulting in cell proliferation and S phase entry (77). TGF-β has been demonstrated to upregulate the expression of miR-181a-5p through mediation of its transcription. Increased miR-181a-5p reduces apoptosis and sensitivity to anoikis (78).
MiR-181a-5p promotes BC cell migration and invasion
It has been reported that lncRNA-SOX2 is downregulated and correlates with poor survival of BC. A tumorigenesis experiment conducted on nude mice has demonstrated that SOX2 suppresses tumor development and metastasis by sponging miR-181a-5p. In this case, miR-181a-5p promotes BC metastasis by inhibiting Tumor suppressor candidate 3 (79). MiR-181a-5p also targets the NDRG2 to reduce activation of PTEN, thus facilitating proliferation, invasion and glycolysis of BC (80).
MiR-181a-5p is an inhibitor of BC
MiR-181a-5p is upregulated in TNBC tissues and cells. This may be associated with the suppressive effect of ER-β, which modulates the expression of miRNA to inhibit TNBC. Upregulation of miR-181a-5p is an auxiliary mechanism of ER-β-induced cholesterol biosynthesis inhibition (81). In addition, miR-181a-5p has been revealed to be positively correlated with Bax and Caspase-9, which promote cell apoptosis (82,83). Functional experiment has revealed that miR-181a-5p inhibits cell proliferation, migration and invasion by targeting oncogenes Kruppel-like factor (KLF) 6, KLF15 and progesterone receptor membrane component 1 (Fig. 3) (84).
Cervical cancer (CC)
CC is the fourth leading cause of cancer-associated mortality among women, accounting for >2.6 million deaths worldwide every year (46,85).
MiR-181a-5p promotes CC cell proliferation and inhibits apoptosis
MiR-181a-5p expression is elevated in CC tissues. It negatively targets INPP5A to promote CC cell proliferation and invasion while inhibiting apoptosis (86). MiR-181a-5p also post-transcriptionally inhibits PTEN in CC. Inhibition of miR-181a-5p can impede cell cycle progression by increasing P21, P27, Bax and decreasing Bcl-2 (87). Moreover, miR-181a-5p is upregulated in human CC specimens and cell lines that are not responsive to radiation therapy. It suppresses radiation-induced apoptosis and G2/M cell cycle arrest by inhibiting protein kinase C delta type (PRKCD) (88).
MiR-181a-5p inhibits CC cell proliferation
A study revealed that miR-181a-5p is aberrantly reduced in CC and inhibits proliferation and resistance of oxaliplatin. In this case, GRP78 is identified as the direct target of miR-181a-5p (89).
MiR-181a-5p inhibits CC metastasis
MiR-181a-5p has direct binding sites with TGFβ1, promoting the expression of TGFβ1 to inhibit CC proliferation, migration and invasion (90). Another group showed that miR-181a-5p inhibits invasion, migration and EMT of CC (91). LncRNA-CCAT1 is located on chromosome 8q24, where human papillomavirus integration usually occurs (92). Overexpression of CCAT1 promotes CC cell proliferation and invasion. MiR-181a-5p is identified as a downstream target of CCAT1and decreases the expression of MMP14. CCAT1 indirectly upregulates the MMP14 by suppressing miR-181a-5p to promote CC progression (Fig. 3) (23).
Endometrial carcinoma (EC)
EC is one of the most common malignancies in women and a leading cause of cancer-associated mortalities worldwide (93).
MiR-181a-5p is a tumor inhibitor in EC
A preliminary experiment revealed that the PTEN is decreased and miR-181a-5p is increased in non-obese patients with EC, suggesting that PTEN is negatively correlated with miR-181a-5p (94). More focused work revealed that miR-181a-5p inhibits EC cell proliferation and migration, while miR-181a-5p inhibitor can neutralize these effects (95). Accumulation of HK2 in EC promotes EMT and glycolysis. MiR-181a-5p is an inhibitor of HK2. An experiment has confirmed that DLEU2 interacts with enhancer of zeste homolog 2 to silence miR-181a-5p, thus inducing EMT and glycolysis (96) (Fig. 3).
Ovarian cancer
Ovarian cancer is a common tumor of the gynecological malignancy. Clinical data has demonstrated that miR-181a-5p is increased in advanced epithelial ovarian cancer and promotes tumor development (97). In an in vivo and vitro experiment, miR-181a-5p has been further indicated to promote cell proliferation, migration, invasion and EMT. SMAD family member 7 (Smd7), an inhibitor of TGF, has been identified as a direct target of miR-181a-5p (97). In high-grade serous ovarian cancer, miR-181a-5p increases stem-cell frequency and resistance of cisplatin by activating the Wnt/β-catenin signaling pathway. This activation is achieved by directly targeting Secreted frizzled-related protein 4 (SFRP4), an inhibitor of the Wnt/β-catenin pathway (Fig. 3) (98).
Prostate cancer (PCa)
PCa is the second most frequently diagnosed cancer and the sixth leading cause of cancer-associated mortality among men worldwide (99).
MiR-181a-5p may promotes EMT and tumor growth in PCa (Fig. 3)
The inhibitory effect of miR-181a-5p on PTEN has been observed in PCa. In this context, miR-181a-5p enhances cell proliferation, migration and invasion (100). To the best of our knowledge, two studies have investigated the effect of miR-181a-5p on EMT. The results revealed that miR-181a-5p promotes EMT with high E-cadherin expression by inhibiting the EMT negative regulator, KLF17. Notably, lymphoid enhancer-binding factor 1 and migration and invasion-inhibitory protein have been identified to downregulate the expression of miR-181a-5p in PCa (101,102).
Tumors of the urinary system
Bladder cancer (BCa)
To the best of our knowledge, there is only one report focused on the role of miR-181a-5p in BCa. MiR-181a-5p is a tumor inhibitor in BCa. A group demonstrated that expression of circRNA-0068871 is increased, while miR-181a-5p is expressed at a low level in BCa. circRNA-0068871 intensifies cell proliferation, migration and suppressed apoptosis in vivo and vitro. Mechanistically, circRNA-0068871 acts as a sponge for miR-181a-5p, which directly targets EGFR3, indicating that miR-181a-5p is a tumor inhibitor in BCa (103).
Renal cancer
A preliminary experiment indicated that miR-181a-5p may play a role as an oncomiR in renal cancer. Compared with normal tissues and cells, miR-181a-5p is upregulated in both renal cancer tissues and cell lines. In vitro, miR-181a-5p inhibits apoptosis and promotes proliferation, invasion and migration of 786-O and ACHN cell lines (104). In addition, miR-181a-5p has been identified to be associated with tumor size and TNM stages in clear cell renal cell carcinoma. MiR-181a-5p directly binds to KLF6, which induces apoptosis, promoting renal cancer progression and metastasis (105).
Cancer of the endocrine system
Thyroid cancer (TC)
According to 2020 statistics, TC is the most common endocrine cancer. Papillary thyroid cancer (PTC) is the most common type of thyroid cancer, accounting for ~85% of thyroid cancer worldwide (106). The following experiments suggest that miR-181a-5p promotes the progression of TC by modulating multiple target genes. In vivo and vitro, a group demonstrated that miR-181a-5p inhibits papillary demethylase and lysine-specific demethylase 5C (KDM5C) to induce cell proliferation and migration, thus promoting the tumor growth (107). In addition, it is widely acknowledged that angiogenesis is a key factor in PTC recurrence and metastasis. By inhibiting MIL3, exosomal miR-181a-5p promotes tumor angiogenesis and growth. In this case, it decreases DACT2 and increases VEGF and YAP (29). Other reports further validated that miR-181a-5p promotes metastasis of PTC. MiR-181a-5p promotes cell proliferation, invasion and EMT to aggravate PCT metastasis, while its downstream target KLF15 and suppressor of cytokine signaling 4 can counteract these effects (108,109). In addition, miR-181a-5p reduces the efficacy of radioactive iodine treatment by suppressing sodium iodide symporter (NIS), which is a potent iodine transporter. A report has indicated that miR-181a-5p directly inhibits sodium/iodide cotransporter (SLC5A5) to regulate NIS (110).
Salivary adenoid cystic carcinoma
To the best of our knowledge, one study explored the role of miR-181a-5p in salivary adenoid cystic carcinoma (SACC) with lung metastasis. Compared with SACC-83 cells (cells from patients with SACC), Ju et al revealed that miR-181a-5p is decreased in SACC-LM cells (SACC patients with lung metastasis). Furthermore, miR-181a-5p is sponged by circRNA-001982, resulting in stronger ability of migration and invasion (111).
Cancer of the circulatory system
Leukemia
Leukemia, the most common circulatory system tumor, with >470,000 new cases worldwide in 2020 (46). It can be divided into myeloid leukemia and lymphocyte leukemia according to the pathological cells. Targeting miRNAs associated with leukemia may be an effective approach to treat leukemia. MiR-181a-5p has been identified to be associated with acute myeloid leukemia (AML). Clinical data has demonstrated that miR-181a-5p is decreased in children with AML, along with a decrease in TGF-β and an increase in Smad7 (112). However, there is a conflicting study that suggests miR-181a-5p promotes AML cell proliferation and G1/S transition by targeting ataxia telangiectasia mutated (113). In addition, miR-181a-5p has also been found to promote the progression of acute lymphoblastic leukemia (ALL) and lymphocyte leukemia by inhibiting WIF1 and STAT3 (114,115). However, another study revealed that miR-181a-5p has an inhibitory effect on myelogenous leukemia. MiR-181a-5p directly binds to the 3'UTR of Ra1A, thus inhibiting proliferation and promoting G2 cell cycle arrest and apoptosis (116).
Myeloma
Multiple myeloma (MM) is the second most common hematologic tumor with 176,404 new cases worldwide in 2020 (46). MM is a hematological tumor characterized by abnormal proliferation of plasma cells. MiR-181a-5p appears to be a potential therapeutic target for MM. In vitro experiments, miR-181a-5p is associated with lower CDK2, Cyclin E1 and Bcl2 and higher p21, Bax and caspase 3 to regulate proliferation and apoptosis of MM cells by inhibiting the Hippo/YAP axis (117). In addition, miR-181a-5p induces cell cycle to G0/G1 phase arrest, and directly targets homeobox transcription factor A1 (HOXA1), which has been demonstrated to promote cell growth and tumor progression (118). These findings suggest that miR-181a-5p plays a suppressive role in MM.
Lymphoma
Lymphoma is a malignant tumor originating in the lymphatic hematopoietic system. Diffuse large B-cell lymphoma (DLBCL) is the most frequent subtype of non-Hodgkin lymphoma, accounting for 31% in Europe and the USA (119). Common standard treatments cure only about half of patients. MiR-181a-5p suppresses the proliferation and survival of DLBCL, and it modulates NF-kB by directly targeting NF-kB regulatory factors caspase recruitment domain-containing protein 11, encoding nuclear factor of κ-light polypeptide gene enhancer in B-cells inhibitor-α, p50, p65 and c-Rel. Study using xenograft models revealed that miR-181a-5p prevents tumor growth rate and prolongs the animal survival in NF-kB-dependent DLBCL (120).
Cancer of the nervous system
Glioma
Glioma is a highly malignant tumor in the central nervous system, which develops rapidly and is prone to metastasis from early stage (121). The clinical data reveal a decrease in miR-181a-5p in glioma tissues and cell lines. It has been determined that circRNA 0076248 acts as an upstream regulator of miR-181a-5p, indirectly increasing the expression of Sirtuin 1 (SIRT1) (122). Overexpression of miR-181a-5p inhibits cell proliferation, invasion and sensitizes cells to Temozolomide (TMZ) (122). An investigation has also demonstrated that miR-181a-5p acts as a suppressive regulator of glioblastoma multiform (GBM), the most malignant glioma (123). In a study involving patients with GBM treated with carmustine, miR-181a-5p has been shown to enhance G1 cell cycle arrest and apoptosis by regulating caspase-9, Bcl-2 and SIRT1. Mechanistically, miR-181a-5p inhibits the PI3K/AKT signaling pathway to promote GBM cell apoptosis and carmustine sensitivity (124). MiR-181a-5p also decreases glioblastoma stem-like cells formation and Osteopontin production of GBM, thus inhibiting the tumor development and progression (125,126). In addition, miR-181a-5p has been demonstrated to increase the permeability of the blood-tumor barrier (BTB), thereby improving the delivery of therapeutic drugs (127). However, a study conducted by Liao and coworkers demonstrated that increased expression of miR-181a-5p promotes cell proliferation and TMZ sensitivity through the regulation of the PTEN/AKT signaling pathway (128).
Neuroblastoma and medulloblastoma (MB)
Neuroblastoma is the most frequent extracranial solid tumor in infants worldwide, with 25-50 cases per million individuals. More than 50% of patients already have distant metastases by the time they are diagnosed (129). In a study, researchers attributed the oncogenic role of miR-181a-5p to inhibit ABI1 mRNA. In vitro experiments, it promotes cell proliferation, migration and invasion. Furthermore, a nude mice xenograft model provided further evidence that consolidates the pro-tumorigenic effect of miR-181a-5p (130). MB is an aggressive cerebral tumor, divided into four molecular subtypes: i) WNT; ii) SHH; iii) 3 group; and iv) 4 group. Among them, 3 group has the worst prognosis and the majority of patients have metastasized at the time of diagnosis (131). A previous report provides novel treatment strategies for 3 group-MB. Experimental evidence indicates that miR-181a-5p expression is increased in 3 group-MB cells compared with SHH-MB cells. SHH-MB cells treated with 3 group-MB exosomal miR-181a-5p demonstrate increased aggressiveness and mobility. The tumor-promoting effects of exosomal miR-181a-5p are attributed to activation of the RAS/MAPK signaling pathway (132).
Skin cancer
Melanoma
Melanoma is an aggressive cancer of the skin. MiR-181a-5p promotes melanoma cell proliferation and invasion, suggesting that miR-181a-5p has a role of tumor inhibitor. Then, miR-181a-5p is found to directly bind to the 3'UTR of Plexin C1 and is sponged by lncRNA-CASC2 (133). However, another study provided evidence that miR-181a-5p reduces the expression of Bcl2 and induces apoptosis of melanoma stem cells (134).
Cutaneous squamous cell carcinoma
Cutaneous squamous cell carcinoma (cuSCC) is the second most commonly diagnosed malignant cancer of the skin after melanoma, accounting for 20% of skin cancer worldwide (135). Two reports came to opposite conclusions on the role of miR-181a-5p in CSCC. In normal epidermal keratinocytes (HaCaT), a group uncovered that expression of miR-181a-5p increases in cuSCC tissues and inhibits apoptosis of UV induced HaCaT cells. In addition, miR-181a-5p suppresses TGF R3 to increase the expression of TGF, which promotes multiple tumorigenic functions (136). The other study demonstrated that miR-181a-5p blocks the Kras/MAPK pathway to slow SCC13 cell proliferation (137). Notably, the two reports treated the cells in different ways and utilized different cell lines for in vitro experiments.
Cancer of the motor system
Osteosarcoma (OS) is a common malignant tumor in adolescents and children (138).
MiR-181a-5p is involved in the progression and metastasis of OS
In OS, miR-181a-5p has been observed to target RASSF6 to promote cell proliferation and invasion. TUSC7 and CASC2 were established as upstream regulators of miR-181a-5p (139,140). Chondrosarcoma is a primary osteosarcoma in which mortality is usually due to lung metastasis. The expression of miR-181a-5p is upregulated significantly in chondrosarcoma (141). By regulating VEGF and G-protein signaling 16, miR-181a-5p has been shown to promote angiogenesis, which is critical for the progression and metastasis of OS (22,142).
4. MiR-181a-5p as a biomarker
With the development of technology, miR-181a-5p can be accurately and conveniently quantitatively detected (143), which makes it a potential biomarker. The following studies showed the potential of using miR-181a-5p as one of the biomarkers for diagnosis, prognosis and assessment of chemotherapy response. These studies are summarized in Table II.
Biomarkers for diagnosis
Although tissue biopsies remain the gold standard for cancer diagnosis, there is evidence that miR-181a-5p can be used as a biomarker for early diagnosis. For example, serum miR-181a-5p level is decreased in patients with BC compared with normal subjects, and the sensitivity of miR-181a-5p level in early diagnosis of BC is higher compared with that of conventional tumor markers CA153 and carcinoembryonic antigen (144). Another study found that plasma exosomal miR-181a-5p is significantly increased in patients with CRC, suggesting that it has the potential as a marker for diagnosing CRC (145). In addition, miR-181a-5p can also be used to determine the subtype or stage of a certain cancer. Researchers found that compared with controls, patients with early esophageal cancer have significantly lower level of miR-181a-5p, which can be used as a novel biomarker for early diagnosis of esophageal cancer (146). In endometrial carcinoma (EC), it is identified to be increased in type I EC and type II EC, while the increase in type II EC was significantly higher compared with that in type I (147). In addition, miR-181a-5p level is elevated in the tissues of Chinese males with lung squamous cell carcinoma (148).
Biomarker for prognosis
Numerous studies have found that the level of miR-181a-5p may predict the risk of progression and survival of multiple types of cancer. In the majority of reports, increased miR-181a-5p in tumor tissue or serum is correlated with poor outcome and shorter overall survival (149-152). For example, in pediatric acute lymphoblastic leukemia, miR-181a-5p increases the risk of central nervous system of leukemia. The expression of miR-181a-5p provides a novel marker for the course of pediatric ALL. In addition, its expression in bone marrow and peripheral blood samples is significantly decreased to the 33rd day of treatment (153). But in NSCLC (154,155) and AML (156), miR-181a-5p is positively associated with an improved prognosis. Moreover, extracellular vesicle-delivered miR-181a-5p may indicate the risk of tumor metastasis. For example, miR-181a-5p is significantly upregulated in patients with bone metastatic prostate cancer (157), while in rectal cancer with lymph node metastasis, it is decreased (158).
Overall, miR-181a-5p may be an effective tool for predicting cancer prognosis. However, more studies are warranted to provide evidence for clinical application.
Biomarker for response to therapy
The level of miR-181a-5p expression can predict the treatment response of patients with cancer, which can improve the reference for the selection of clinical treatment strategy. For example, EGFR-tyrosine kinase inhibitors (TKIs), such as gefitinib, are the first-line treatment of advanced NSCLC in the presence of allergenic mutations. Circulating miR-181a-5p was quantified in plasma samples of 39 patients with advanced EGFR-mutated NSCLC treated with EGFR-TKIs, and the results showed that patients with partial/complete response (PR/CR) had higher baseline miR-181-5p compared with patients with stable/progressive disease (SD/PD) (159). This trend is similar in patients with colorectal cancer treated with EGFR-TKI. A low level of miR-181a-5p indicates poor progression-free survival (PFS) (160). Uniformly, the level of miR-181a-5p is positively associated with the outcomes of anti-tumor treatment, such as EOX (epirubicin/capecitabine/oxaliplatin) regimen, bortezomib, sorafenib or stem cell transplantation. In these cases, serum miR-181a-5p in PR patients may be significantly higher than that in PD patients (161-164). However, in advanced unresectable epithelial ovarian cancer, patients with higher miR-181a-5p expression have shorter overall survival and PFS accompanied by elevated smad2. Combined analysis of p-smad2 and miR-181a-5p may potentially identify those patients with ovarian cancer with a lower chance of responding to platinum-based neoadjuvant chemotherapy (165).
5. MiR-181a-5p in chemotherapy
Chemotherapy is one of the main therapeutic methods used against cancer, and the response of patients with cancer to chemotherapy is influenced by various factors, such as PTEN and the Wnt/β-catenin pathway (166,167). Numerous genes have been identified as being involved in chemotherapy. Therefore, miRNA can impact cancer chemotherapy by binding to chemotherapy-related targets (168,169). Recent research has focused on the role of miR-181a-5p in chemotherapy. These findings provide a foundation for the clinical use of miR-181a-5p mimics or inhibitors to enhance the sensitivity of chemotherapeutics. In this section, the present study discusses the interaction between miR-181a-5p and platinum, as well as other chemotherapeutic agents (Table III).
Platinum
Platinum drugs, such as cisplatin, carboplatin and oxaliplatin, are one of the most commonly used drugs in chemotherapy and are often used in combination with other chemotherapeutic drugs (170). A recent study has shown that miR-181a-5p can enhance the sensitivity of platinum drugs by targeting some oncogenes in certain types of cancer. It has been observed that in cisplatin resistant cells, the level of miR-181a-5p is reduced. Conversely, CUGBP Elav-like family member 1, which is inhibited by miR-181a-5p, increases in cisplatin resistant cells in lung squamous cell carcinoma and as an oncogene. MiR-181a-5p can decrease the IC50 of cells and effectually recover the cisplatin resistance (171).
Vitamin D receptor (VDR) is a nuclear receptor that regulates autophagy (172). In BC cell lines HS578T, miR-181a-5p induces autophagy to promote apoptosis and inhibit proliferation by suppressing VDR, thus increasing the sensitivity of cisplatin (173). Similarly, other studies have also demonstrated that miR-181a-5p can induce apoptosis and promote the sensitivity of cisplatin in NSCLC (174), GC (175) and esophageal cancer (61). In additon, these in vitro results were confirmed in vivo. In a mouse xenograft model, miR-181a-5p expression in tumors increased significantly in the group treated with Xiaoji decoction (XJD) combined with cisplatin comparing with the mice treated with XJD alone. In this case, transcription factor SP1, which promotes tumor progress, is a target of miR-181a-5p. Upregulation of miR-181a-5p inhibits SP1 to increase the sensitivity to cisplatin and reduce the tumor size and weight (176). In cervical cancer, miR-181a-5p indirectly binds to glucose related protein GRP78, which promotes tumor progression and resistance to oxaliplatin, thus attenuating oxaliplatin resistance in drug-resistant cells and mouse model (89). Notably, another study revealed that miR-181a-5p/SFRP4 axis activates the Wnt/β-catenin pathway to reduce cisplatin sensitivity in ovarian cancer (98). These findings suggests that the effect of miR-181a-5p on the same drugs may be different in different types of cancer.
Overall, the studies indicated that miR-181a-5p can increase the sensitivity to platinum except in ovarian cancer. Using miR-181a-5p mimics to increase the miR-181a-5p expression may be a potential strategy for platinum resistance patients.
Other chemotherapeutic agents
MiR-181a-5p showed different effects on various chemotherapeutic agents. For example, it inhibits resistance of gemcitabine (64) and Ara-c (177), but promotes gefitinib resistance (178). Wnt/β-catenin pathway promotes resistance to 5-FU in colorectal cancer. MiR-181a-5p has been identified as an inhibitor of Wnt and PLAG1, and increases the 5-FU sensitivity of colorectal cancer cells (28,34). In melanoma, miR-181a-5p decreases in BRAF inhibitor (dabrafenib) resistant patients. MiR-181a-5p mimics inhibit mitochondrial transcription factor A and reverses dabrafenib resistance (179). In addition, promoting sensitivity of chemotherapy by using miR-181a-5p has been applied in a rat-seeded retinoblastoma model, which demonstrated that using lipid nanoparticles to co-deliver miR-181a-5p and melphalan can enhance the efficacy while reducing cytotoxic side effects by inhibiting BCL-2, MAPK1 and promoting Bax (180). In addition, Carmustine and TMZ are alkylating agents for glioma, and miR-181a-5p can promote sensitivity of carmustine (124); however, results of the effect of miR-181a-5p on TMZ was opposite in two independent studies (122,128).
6. Controversies
The present study elucidates the role of miR-181a-5p in cancers of different systems. These studies helped to understand the effects of miR-181a-5p on tumor progression, chemotherapy and revealed that it has the potential to be a biomarker. However, as a kind of miRNAs, miR-181a-5p is environment-dependent. Since miR-181a-5p can simultaneously bind to multiple targets (possibly oncogenes or tumor suppressor genes), and these targets express differently in different types of cancer, scientists often get conflicting results in the study of miR-181a-5p. Due to this uncertainty, it is difficult to actually put miR-181a-5p into clinical use. More research and clinical trials are needed to provide a further understanding of miR-181a-5p.
7. Conclusions
The present review summarizes some interesting studies on miR-181a-5p for its role in different systems of cancer. The dysregulation of miR-181a-5p has been implicated in various types of cancer and functions as an oncomiR or tumor inhibitor. Mechanistically, miR-181a-5p targets multiple mRNAs to regulate intricate and diverse signaling pathways. Additionally, numerous factors, such as ncRNAs and TFs, serve as upstream regulators that modulate the expression of miR-181a-5p. MiR-181a-5p is capable of mediating cellular processes, such as proliferation, apoptosis, autophagy, angiogenesis and the regulation of tumor growth in xenograft models. It can also either promote or suppress the cell migration, invasion, EMT and tumor metastasis. In addition, miR-181a-5p shows promise as a potential biomarker and target to increase the sensitivity for chemotherapy. These findings may provide implications for oncological research and treatment strategies of cancer.
Availability of data and materials
Not applicable.
Authors' contributions
JL wrote the major parts of the manuscript and prepared the figures and tables. JS and YZ revised the manuscript. FD, ML, XW and YC prepared the manuscript. SW and ZX oversaw the process and wrote the manuscript. ZW conceptualized the study and oversaw the process. Data authentication is not applicable. All authors have read and approved the final manuscript.
Ethics approval and consent to participate
Not applicable.
Patient consent for publication
Not applicable.
Competing interests
Authors declare that they have no competing interests.
Acknowledgments
Not applicable.
Funding
This work was supported by the Project of Science and Technology Department of Sichuan Province (grant no. 2021YJ0445).
References
Lee RC, Feinbaum RL and Ambros V: The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75:843–854. 1993. View Article : Google Scholar : PubMed/NCBI | |
Lagos-Quintana M, Rauhut R, Lendeckel W and Tuschl T: Identification of novel genes coding for small expressed RNAs. Science. 294:853–858. 2001. View Article : Google Scholar : PubMed/NCBI | |
Lau NC, Lim LP, Weinstein EG and Bartel DP: An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science. 294:858–862. 2001. View Article : Google Scholar : PubMed/NCBI | |
Lee RC and Ambros V: An extensive class of small RNAs in Caenorhabditis elegans. Science. 294:862–864. 2001. View Article : Google Scholar : PubMed/NCBI | |
Cable J, Heard E, Hirose T, Prasanth KV, Chen LL, Henninger JE, Quinodoz SA, Spector DL, Diermeier SD, Porman AM, et al: Noncoding RNAs: Biology and applications-a keystone symposia report. Ann N Y Acad Sci. 1506:118–141. 2021. View Article : Google Scholar : PubMed/NCBI | |
Bejerano G, Pheasant M, Makunin I, Stephen S, Kent WJ, Mattick JS and Haussler D: Ultraconserved elements in the human genome. Science. 304:1321–1325. 2004. View Article : Google Scholar : PubMed/NCBI | |
Reinhart BJ, Slack FJ, Basson M, Pasquinelli AE, Bettinger JC, Rougvie AE, Horvitz HR and Ruvkun G: The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature. 403:901–906. 2000. View Article : Google Scholar : PubMed/NCBI | |
Hill M and Tran N: miRNA interplay: Mechanisms and consequences in cancer. Dis Model Mech. 14:dmm0476622021. View Article : Google Scholar : PubMed/NCBI | |
Rivera-Barahona A, Pérez B, Richard E and Desviat LR: Role of miRNAs in human disease and inborn errors of metabolism. J Inherit Metab Dis. 40:471–480. 2017. View Article : Google Scholar : PubMed/NCBI | |
Rupaimoole R and Slack FJ: MicroRNA therapeutics: Towards a new era for the management of cancer and other diseases. Nat Rev Drug Discov. 16:203–222. 2017. View Article : Google Scholar : PubMed/NCBI | |
Jeffries J, Zhou W, Hsu AY and Deng Q: miRNA-223 at the crossroads of inflammation and cancer. Cancer Lett. 451:136–141. 2019. View Article : Google Scholar : PubMed/NCBI | |
Zhang L, Liao Y and Tang L: MicroRNA-34 family: A potential tumor suppressor and therapeutic candidate in cancer. J Exp Clin Cancer Res. 38:532019. View Article : Google Scholar : PubMed/NCBI | |
Bartel DP: MicroRNAs: Target recognition and regulatory functions. Cell. 136:215–233. 2009. View Article : Google Scholar : PubMed/NCBI | |
Rani V and Sengar RS: Biogenesis and mechanisms of microRNA-mediated gene regulation. Biotechnol Bioeng. 119:685–692. 2022. View Article : Google Scholar : PubMed/NCBI | |
Su Y, Yuan J, Zhang F, Lei Q, Zhang T, Li K, Guo J, Hong Y, Bu G, Lv X, et al: MicroRNA-181a-5p and microRNA-181a-3p cooperatively restrict vascular inflammation and atherosclerosis. Cell Death Dis. 10:3652019. View Article : Google Scholar : PubMed/NCBI | |
Zhao H, Guo Y, Sun Y, Zhang N and Wang X: miR-181a/b-5p ameliorates inflammatory response in monocrotaline-induced pulmonary arterial hypertension by targeting endocan. J Cell Physiol. 235:4422–4433. 2020. View Article : Google Scholar | |
Lozano-Bartolomé J, Llauradó G, Portero-Otin M, Altuna-Coy A, Rojo-Martínez G, Vendrell J, Jorba R, Rodríguez-Gallego E and Chacón MR: Altered expression of miR-181a-5p and miR-23a-3p Is associated with obesity and TNFα-induced insulin resistance. J Clin Endocrinol Metab. 103:1447–1458. 2018. View Article : Google Scholar | |
Korhan P, Erdal E and Atabey N: MiR-181a-5p is downregulated in hepatocellular carcinoma and suppresses motility, invasion and branching-morphogenesis by directly targeting c-Met. Biochem Biophys Res Commun. 450:1304–1312. 2014. View Article : Google Scholar : PubMed/NCBI | |
Jiang M, Zhang W, Zhang R, Liu P, Ye Y, Yu W, Guo X and Yu J: Cancer exosome-derived miR-9 and miR-181a promote the development of early-stage MDSCs via interfering with SOCS3 and PIAS3 respectively in breast cancer. Oncogene. 39:4681–4694. 2020. View Article : Google Scholar : PubMed/NCBI | |
Yang Z, Wan X, Gu Z, Zhang H, Yang X, He L, Miao R, Zhong Y and Zhao H: Evolution of the mir-181 microRNA family. Comput Biol Med. 52:82–87. 2014. View Article : Google Scholar : PubMed/NCBI | |
Smillie CL, Sirey T and Ponting CP: Complexities of post-transcriptional regulation and the modeling of ceRNA crosstalk. Crit Rev Biochem Mol Biol. 53:231–245. 2018. View Article : Google Scholar : PubMed/NCBI | |
Salmena L, Poliseno L, Tay Y, Kats L and Pandolfi PP: A ceRNA hypothesis: The Rosetta Stone of a hidden RNA language? Cell. 146:353–358. 2011. View Article : Google Scholar : PubMed/NCBI | |
Shen H, Wang L, Xiong J, Ren C, Gao C, Ding W, Zhu D, Ma D and Wang H: Long non-coding RNA CCAT1 promotes cervical cancer cell proliferation and invasion by regulating the miR-181a-5p/MMP14 axis. Cell Cycle. 18:1110–1121. 2019. View Article : Google Scholar : PubMed/NCBI | |
Shang A, Wang W, Gu C, Chen W, Lu W, Sun Z and Li D: Long non-coding RNA CCAT1 promotes colorectal cancer progression by regulating miR-181a-5p expression. Aging (Albany NY). 12:8301–8320. 2020. View Article : Google Scholar : PubMed/NCBI | |
Li S, Yang J, Xia Y, Fan Q and Yang KP: Long noncoding RNA NEAT1 promotes proliferation and invasion via targeting miR-181a-5p in non-small cell lung cancer. Oncol Res. 26:289–296. 2018. View Article : Google Scholar | |
Hai Ping P, Feng Bo T, Li L, Nan Hui Y and Hong Z: IL-1β/NF-kb signaling promotes colorectal cancer cell growth through miR-181a/PTEN axis. Arch Biochem Biophys. 604:20–26. 2016. View Article : Google Scholar : PubMed/NCBI | |
Zhang X, Li X, Tan F, Yu N and Pei H: STAT1 inhibits MiR-181a expression to suppress colorectal cancer cell proliferation through PTEN/Akt. J Cell Biochem. 118:3435–3443. 2017. View Article : Google Scholar : PubMed/NCBI | |
Shi L, Li X, Wu Z, Li X, Nie J, Guo M, Mei Q and Han W: DNA methylation-mediated repression of miR-181a/135a/302c expression promotes the microsatellite-unstable colorectal cancer development and 5-FU resistance via targeting PLAG1. J Genet Genomics. 45:205–214. 2018. View Article : Google Scholar : PubMed/NCBI | |
Wang Y, Cen A, Yang Y, Ye H, Li J, Liu S and Zhao L: miR-181a, delivered by hypoxic PTC-secreted exosomes, inhibits DACT2 by downregulating MLL3, leading to YAP-VEGF-mediated angiogenesis. Mol Ther Nucleic Acids. 24:610–621. 2021. View Article : Google Scholar : | |
Sun X, Wei L, Chen Q and Terek RM: MicroRNA regulates vascular endothelial growth factor expression in chondrosarcoma cells. Clin Orthop Relat Res. 473:907–913. 2015. View Article : Google Scholar : | |
Hanahan D: Hallmarks of cancer: New dimensions. Cancer Discov. 12:31–46. 2022. View Article : Google Scholar : PubMed/NCBI | |
Svoronos AA, Engelman DM and Slack FJ: OncomiR or tumor suppressor? The duplicity of MicroRNAs in cancer. Cancer Res. 76:3666–3670. 2016. View Article : Google Scholar : PubMed/NCBI | |
Siegel RL, Miller KD and Jemal A: Cancer statistics, 2020. CA Cancer J Clin. 70:7–30. 2020. View Article : Google Scholar | |
Han P, Li JW, Zhang BM, Lv JC, Li YM, Gu XY, Yu ZW, Jia YH, Bai XF, Li L, et al: The lncRNA CRNDE promotes colorectal cancer cell proliferation and chemoresistance via miR-181a-5p-mediated regulation of Wnt/β-catenin signaling. Mol Cancer. 16:92017. View Article : Google Scholar | |
Lv SY, Shan TD, Pan XT, Tian ZB, Liu XS, Liu FG, Sun XG, Xue HG, Li XH, Han Y, et al: The lncRNA ZEB1-AS1 sponges miR-181a-5p to promote colorectal cancer cell proliferation by regulating Wnt/β-catenin signaling. Cell Cycle. 17:1245–1254. 2018. View Article : Google Scholar : | |
Sun C, Shen C, Zhang Y and Hu C: LncRNA ANRIL negatively regulated chitooligosaccharide-induced radiosensitivity in colon cancer cells by sponging miR-181a-5p. Adv Clin Exp Med. 30:55–65. 2021. View Article : Google Scholar : PubMed/NCBI | |
Chang L, Yuan Y, Li C, Guo T, Qi H, Xiao Y, Dong X, Liu Z and Liu Q: Upregulation of SNHG6 regulates ZEB1 expression by competitively binding miR-101-3p and interacting with UPF1 in hepatocellular carcinoma. Cancer Lett. 383:183–194. 2016. View Article : Google Scholar : PubMed/NCBI | |
Yu C, Sun J, Leng X and Yang J: Long noncoding RNA SNHG6 functions as a competing endogenous RNA by sponging miR-181a-5p to regulate E2F5 expression in colorectal cancer. Cancer Manag Res. 11:611–624. 2019. View Article : Google Scholar : PubMed/NCBI | |
Chi J, Liu S, Wu Z, Shi Y, Shi C, Zhang T, Xiong B, Zeng Y and Dong X: circNSUN2 promotes the malignant biological behavior of colorectal cancer cells via the miR-181a-5p/ROCK2 axis. Oncol Rep. 46:1422021. View Article : Google Scholar : | |
Zhao S, Mi Y, Zheng B, Wei P, Gu Y, Zhang Z, Xu Y, Cai S, Li X and Li D: Highly-metastatic colorectal cancer cell released miR-181a-5p-rich extracellular vesicles promote liver metastasis by activating hepatic stellate cells and remodelling the tumour microenvironment. J Extracell Vesicles. 11:e121862022. View Article : Google Scholar : PubMed/NCBI | |
Ji D, Chen Z, Li M, Zhan T, Yao Y, Zhang Z, Xi J, Yan L and Gu J: MicroRNA-181a promotes tumor growth and liver metastasis in colorectal cancer by targeting the tumor suppressor WIF-1. Mol Cancer. 13:862014. View Article : Google Scholar : PubMed/NCBI | |
Li Z, Wang H, Xu Z, Sun Y and Han J: Expression and mechanism of microRNA-181A on incidence and survival in late liver metastases of colorectal cancer. Oncol Rep. 35:1403–1408. 2016. View Article : Google Scholar | |
Wei Z, Cui L, Mei Z, Liu M and Zhang D: miR-181a mediates metabolic shift in colon cancer cells via the PTEN/AKT pathway. FEBS Lett. 588:1773–1779. 2014. View Article : Google Scholar : PubMed/NCBI | |
Sun W, Wang X, Li J, You C, Lu P, Feng H, Kong Y, Zhang H, Liu Y, Jiao R, et al: MicroRNA-181a promotes angiogenesis in colorectal cancer by targeting SRCIN1 to promote the SRC/VEGF signaling pathway. Cell Death Dis. 9:4382018. View Article : Google Scholar : PubMed/NCBI | |
Zhang Q, Wang C, Li R, Liu J, Wang J, Wang T and Wang B: The BAP31/miR-181a-5p/RECK axis promotes angiogenesis in colorectal cancer via fibroblast activation. Front Oncol. 13:10569032023. View Article : Google Scholar : | |
Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A and Bray F: Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 71:209–249. 2021. View Article : Google Scholar : PubMed/NCBI | |
Chen G, Shen ZL, Wang L, Lv CY, Huang XE and Zhou RP: Hsa-miR-181a-5p expression and effects on cell proliferation in gastric cancer. Asian Pac J Cancer Prev. 14:3871–3875. 2013. View Article : Google Scholar | |
Ge S, Zhang H, Deng T, Sun W, Ning T, Fan Q, Wang Y, Wang X, Zhang Q, Zhou Z, et al: MiR-181a, a new regulator of TGF-β signaling, can promote cell migration and proliferation in gastric cancer. Invest New Drugs. 37:923–934. 2019. View Article : Google Scholar | |
Yu J, Qi J, Sun X, Wang W, Wei G, Wu Y, Gao Q and Zheng J: MicroRNA-181a promotes cell proliferation and inhibits apoptosis in gastric cancer by targeting RASSF1A. Oncol Rep. 40:1959–1970. 2018. | |
Ding L, Tian Y, Wang L, Bi M, Teng D and Hong S: Hypermethylated long noncoding RNA MEG3 promotes the progression of gastric cancer. Aging (Albany NY). 11:8139–8155. 2019. View Article : Google Scholar | |
Liu Z, Sun F, Hong Y, Liu Y, Fen M, Yin K, Ge X, Wang F, Chen X and Guan W: MEG2 is regulated by miR-181a-5p and functions as a tumour suppressor gene to suppress the proliferation and migration of gastric cancer cells. Mol Cancer. 16:1332017. View Article : Google Scholar : PubMed/NCBI | |
Mi Y, Zhang D, Jiang W, Weng J, Zhou C, Huang K, Tang H, Yu Y, Liu X, Cui W, et al: miR-181a-5p promotes the progression of gastric cancer via RASSF6-mediated MAPK signalling activation. Cancer Lett. 389:11–22. 2017. View Article : Google Scholar | |
Lu Q, Chen Y, Sun D, Wang S, Ding K, Liu M, Zhang Y, Miao Y, Liu H and Zhou F: MicroRNA-181a functions as an oncogene in gastric cancer by targeting caprin-1. Front Pharmacol. 9:15652019. View Article : Google Scholar : | |
Zhao J, Nie Y, Wang H and Lin Y: MiR-181a suppresses autophagy and sensitizes gastric cancer cells to cisplatin. Gene. 576:828–833. 2016. View Article : Google Scholar | |
Lin F, Li Y, Yan S, Liu S, Qian W, Shen D, Lin Q and Mao W: MicroRNA-181a inhibits tumor proliferation, invasiveness, and metastasis and is downregulated in gastric cancer. Oncol Res. 22:75–84. 2015. View Article : Google Scholar : PubMed/NCBI | |
Lu Z, Luo T, Pang T, Du Z, Yin X, Cui H, Fang G and Xue X: MALAT1 promotes gastric adenocarcinoma through the MALAT1/miR-181a-5p/AKT3 axis. Open Biol. 9:1900952019. View Article : Google Scholar : PubMed/NCBI | |
Zhuang X, Chen Y, Wu Z, Xu Q, Chen M, Shao M, Cao X, Zhou Y, Xie M, Shi Y, et al: Mitochondrial miR-181a-5p promotes glucose metabolism reprogramming in liver cancer by regulating the electron transport chain. Carcinogenesis. 41:972–983. 2020. View Article : Google Scholar | |
Bi JG, Zheng JF, Li Q, Bao SY, Yu XF, Xu P and Liao CX: MicroRNA-181a-5p suppresses cell proliferation by targeting Egr1 and inhibiting Egr1/TGF-β/Smad pathway in hepatocellular carcinoma. Int J Biochem Cell Biol. 106:107–116. 2019. View Article : Google Scholar | |
Guo J, Ma Y, Peng X, Jin H and Liu J: LncRNA CCAT1 promotes autophagy via regulating ATG7 by sponging miR-181 in hepatocellular carcinoma. J Cell Biochem. 120:17975–17983. 2019. View Article : Google Scholar | |
Chang S, Chen B, Wang X, Wu K and Sun Y: Long non-coding RNA XIST regulates PTEN expression by sponging miR-181a and promotes hepatocellular carcinoma progression. BMC Cancer. 17:2482017. View Article : Google Scholar : PubMed/NCBI | |
Yang S, Wang P, Wang S, Cong A, Zhang Q, Shen W, Li X, Zhang W and Han G: miRNA-181a-5p enhances the sensitivity of cells to cisplatin in esophageal adenocarcinoma by targeting CBLB. Cancer Manag Res. 12:4981–4990. 2020. View Article : Google Scholar : PubMed/NCBI | |
Ilic M and Ilic I: Epidemiology of pancreatic cancer. World J Gastroenterol. 22:9694–9705. 2016. View Article : Google Scholar : PubMed/NCBI | |
Liu J, Xu D, Wang Q, Zheng D, Jiang X and Xu L: LPS induced miR-181a promotes pancreatic cancer cell migration via targeting PTEN and MAP2K4. Dig Dis Sci. 59:1452–1460. 2014. View Article : Google Scholar : PubMed/NCBI | |
Wang L, Bi R, Li L, Zhou K and Yin H: lncRNA ANRIL aggravates the chemoresistance of pancreatic cancer cells to gemcitabine by targeting inhibition of miR-181a and targeting HMGB1-induced autophagy. Aging (Albany NY). 13:19272–19281. 2021. View Article : Google Scholar | |
Harðardottir H, Jonsson S, Gunnarsson O, Hilmarsdottir B, Asmundsson J, Gudmundsdottir I, Saevarsdottir VY, Hansdottir S, Hannesson P and Gudbjartsson T: Advances in lung cancer diagnosis and treatment-a review. Laeknabladid. 108:17–29. 2022.In Icelandic. | |
Duma N, Santana-Davila R and Molina JR: Non-small cell lung cancer: Epidemiology, screening, diagnosis, and treatment. Mayo Clin Proc. 94:1623–1640. 2019. View Article : Google Scholar : PubMed/NCBI | |
Ma Z, Qiu X, Wang D, Li Y, Zhang B, Yuan T, Wei J, Zhao B, Zhao X, Lou J, et al: MiR-181a-5p inhibits cell proliferation and migration by targeting Kras in non-small cell lung cancer A549 cells. Acta Biochim Biophys Sin (Shanghai). 47:630–638. 2015. View Article : Google Scholar | |
Shi Q, Zhou Z, Ye N, Chen Q, Zheng X and Fang M: MiR-181a inhibits non-small cell lung cancer cell proliferation by targeting CDK1. Cancer Biomark. 20:539–546. 2017. View Article : Google Scholar : PubMed/NCBI | |
Wang L, Zhang L and Wang L: SNHG7 contributes to the progression of non-small-cell lung cancer via the SNHG7/miR-181a-5p/E2F7 axis. Cancer Manag Res. 12:3211–3222. 2020. View Article : Google Scholar : PubMed/NCBI | |
Cao Y, Zhao D, Li P, Wang L, Qiao B, Qin X, Li L and Wang Y: MicroRNA-181a-5p impedes IL-17-induced nonsmall cell lung cancer proliferation and migration through targeting VCAM-1. Cell Physiol Biochem. 42:346–356. 2017. View Article : Google Scholar | |
Li L, Ye D, Liu L, Li X, Liu J, Su S, Lu W and Yu Z: Long noncoding RNA SNHG7 accelerates proliferation, migration and invasion of non-small cell lung cancer cells by suppressing miR-181a-5p through AKT/mTOR signaling pathway. Cancer Manag Res. 12:8303–8312. 2020. View Article : Google Scholar : | |
Zhang LX, Gao J, Long X, Zhang PF, Yang X, Zhu SQ, Pei X, Qiu BQ, Chen SW, Lu F, et al: The circular RNA circHMGB2 drives immunosuppression and anti-PD-1 resistance in lung adenocarcinomas and squamous cell carcinomas via the miR-181a-5p/CARM1 axis. Mol Cancer. 21:1102022. View Article : Google Scholar : PubMed/NCBI | |
Fu S, Fu Y, Chen F, Hu Y, Quan B and Zhang J: Overexpression of MYCT1 inhibits proliferation and induces apoptosis in human acute myeloid leukemia HL-60 and KG-1a cells in vitro and in vivo. Front Pharmacol. 9:10452018. View Article : Google Scholar : | |
Wang HT, Tong X, Zhang ZX, Sun YY, Yan W, Xu ZM and Fu WN: MYCT1 represses apoptosis of laryngeal cancerous cells through the MAX/miR-181a/NPM1 pathway. FEBS J. 286:3892–3908. 2019. View Article : Google Scholar : PubMed/NCBI | |
Hao YR, Zhang DJ, Fu ZM, Guo YY and Guan GF: Long non-coding RNA ANRIL promotes proliferation, clonogenicity, invasion and migration of laryngeal squamous cell carcinoma by regulating miR-181a/Snai2 axis. Regen Ther. 11:282–289. 2019. View Article : Google Scholar : | |
Wilkinson L and Gathani T: Understanding breast cancer as a global health concern. Br J Radiol. 95:202110332022. View Article : Google Scholar : | |
Strotbek M, Schmid S, Sánchez-González I, Boerries M, Busch H and Olayioye MA: miR-181 elevates Akt signaling by co-targeting PHLPP2 and INPP4B phosphatases in luminal breast cancer. Int J Cancer. 140:2310–2320. 2017. View Article : Google Scholar : PubMed/NCBI | |
Taylor MA, Sossey-Alaoui K, Thompson CL, Danielpour D and Schiemann WP: TGF-β upregulates miR-181a expression to promote breast cancer metastasis. J Clin Invest. 123:150–163. 2013. View Article : Google Scholar | |
Liu K, Xie F, Gao A, Zhang R, Zhang L, Xiao Z, Hu Q, Huang W, Huang Q, Lin B, et al: SOX2 regulates multiple malignant processes of breast cancer development through the SOX2/miR-181a-5p, miR-30e-5p/TUSC3 axis. Mol Cancer. 16:622017. View Article : Google Scholar : PubMed/NCBI | |
Zhai Z, Mu T, Zhao L, Li Y, Zhu D and Pan Y: MiR-181a-5p facilitates proliferation, invasion, and glycolysis of breast cancer through NDRG2-mediated activation of PTEN/AKT pathway. Bioengineered. 13:83–95. 2022. View Article : Google Scholar : | |
Alexandrova E, Lamberti J, Saggese P, Pecoraro G, Memoli D, Cappa VM, Ravo M, Iorio R, Tarallo R, Rizzo F, et al: Small non-coding RNA profiling identifies miR-181a-5p as a mediator of estrogen receptor beta-induced inhibition of cholesterol biosynthesis in triple-negative breast cancer. Cells. 9:8742020. View Article : Google Scholar : PubMed/NCBI | |
Gu M, Wang L, Yang C, Li X, Jia C, Croteau S, Ruan X and Hardy P: Micro-RNA-181a suppresses progestin-promoted breast cancer cell growth. Maturitas. 114:60–66. 2018. View Article : Google Scholar : PubMed/NCBI | |
Cai G, Wang Y, Houda T, Yang C, Wang L, Gu M, Mueck A, Croteau S, Ruan X and Hardy P: MicroRNA-181a suppresses norethisterone-promoted tumorigenesis of breast epithelial MCF10A cells through the PGRMC1/EGFR-PI3K/Akt/mTOR signaling pathway. Transl Oncol. 14:1010682021. View Article : Google Scholar | |
Liu Y, Cheng T, Du Y, Hu X and Xia W: LncRNA LUCAT1/miR-181a-5p axis promotes proliferation and invasion of breast cancer via targeting KLF6 and KLF15. BMC Mol Cell Biol. 21:692020. View Article : Google Scholar : PubMed/NCBI | |
Tsu V and Jerónimo J: Saving the world's women from cervical cancer. N Engl J Med. 374:2509–2511. 2016. View Article : Google Scholar : PubMed/NCBI | |
Yang M, Zhai X, Ge T, Yang C and Lou G: miR-181a-5p promotes proliferation and invasion and inhibits apoptosis of cervical cancer cells via regulating inositol polyphosphate-5-phosphatase A (INPP5A). Oncol Res. 26:703–712. 2018. View Article : Google Scholar | |
Xu H, Zhu J, Hu C, Song H and Li Y: Inhibition of microRNA-181a may suppress proliferation and invasion and promote apoptosis of cervical cancer cells through the PTEN/Akt/FOXO1 pathway. J Physiol Biochem. 72:721–732. 2016. View Article : Google Scholar : PubMed/NCBI | |
Ke G, Liang L, Yang JM, Huang X, Han D, Huang S, Zhao Y, Zha R, He X and Wu X: MiR-181a confers resistance of cervical cancer to radiation therapy through targeting the pro-apoptotic PRKCD gene. Oncogene. 32:3019–3027. 2013. View Article : Google Scholar | |
Luo C and Qiu J: miR-181a inhibits cervical cancer development via downregulating GRP78. Oncol Res. 25:1341–1348. 2017. View Article : Google Scholar | |
Zhu L, Zhang Q, Li S, Jiang S, Cui J and Dang G: Interference of the long noncoding RNA CDKN2B-AS1 upregulates miR-181a-5p/TGFβI axis to restrain the metastasis and promote apoptosis and senescence of cervical cancer cells. Cancer Med. 8:1721–1730. 2019. View Article : Google Scholar : PubMed/NCBI | |
Zhang L, Liu SK, Song L and Yao HR: SP1-induced up-regulation of lncRNA LUCAT1 promotes proliferation, migration and invasion of cervical cancer by sponging miR-181a. Artif Cells Nanomed Biotechnol. 47:555–564. 2019. View Article : Google Scholar | |
Hu Z, Zhu D, Wang W, Li W, Jia W, Zeng X, Ding W, Yu L, Wang X, Wang L, et al: Genome-wide profiling of HPV integration in cervical cancer identifies clustered genomic hot spots and a potential microhomology-mediated integration mechanism. Nat Genet. 47:158–163. 2015. View Article : Google Scholar : PubMed/NCBI | |
Felix AS, Scott McMeekin D, Mutch D, Walker JL, Creasman WT, Cohn DE, Ali S, Moore RG, Downs LS, Ioffe OB, et al: Associations between etiologic factors and mortality after endometrial cancer diagnosis: The NRG oncology/gynecologic oncology group 210 trial. Gynecol Oncol. 139:70–76. 2015. View Article : Google Scholar : PubMed/NCBI | |
Geletina NS, Kobelev VS, Babayants EV, Feng L, Pustylnyak VO and Gulyaeva LF: PTEN negative correlates with miR-181a in tumour tissues of non-obese endometrial cancer patients. Gene. 655:20–24. 2018. View Article : Google Scholar : PubMed/NCBI | |
Yu J, Jiang L, Gao Y, Sun Q, Liu B, Hu Y and Han X: LncRNA CCAT1 negatively regulates miR-181a-5p to promote endometrial carcinoma cell proliferation and migration. Exp Ther Med. 17:4259–4266. 2019.PubMed/NCBI | |
Dong P, Xiong Y, Konno Y, Ihira K, Kobayashi N, Yue J and Watari H: Long non-coding RNA DLEU2 drives EMT and glycolysis in endometrial cancer through HK2 by competitively binding with miR-455 and by modulating the EZH2/miR-181a pathway. J Exp Clin Cancer Res. 40:2162021. View Article : Google Scholar : PubMed/NCBI | |
Parikh A, Lee C, Joseph P, Marchini S, Baccarini A, Kolev V, Romualdi C, Fruscio R, Shah H, Wang F, et al: microRNA-181a has a critical role in ovarian cancer progression through the regulation of the epithelial-mesenchymal transition. Nat Commun. 5:29772014. View Article : Google Scholar | |
Belur Nagaraj A, Knarr M, Sekhar S, Connor RS, Joseph P, Kovalenko O, Fleming A, Surti A, Nurmemmedov E, Beltrame L, et al: The miR-181a-SFRP4 axis regulates Wnt activation to drive stemness and platinum resistance in ovarian cancer. Cancer Res. 81:2044–2055. 2021. View Article : Google Scholar : PubMed/NCBI | |
Zhou CK, Check DP, Lortet-Tieulent J, Laversanne M, Jemal A, Ferlay J, Bray F, Cook MB and Devesa SS: Prostate cancer incidence in 43 populations worldwide: An analysis of time trends overall and by age group. Int J Cancer. 138:1388–1400. 2016. View Article : Google Scholar : | |
Ding X, Xu X, He XF, Yuan Y, Chen C, Shen XY, Su S, Chen Z, Xu ST and Huang YH: Muscleblind-like 1 antisense RNA 1 inhibits cell proliferation, invasion, and migration of prostate cancer by sponging miR-181a-5p and regulating PTEN/PI3K/AKT/mTOR signaling. Bioengineered. 12:803–814. 2021. View Article : Google Scholar | |
Liang J, Li X, Li Y, Wei J, Daniels G, Zhong X, Wang J, Sfanos K, Melamed J, Zhao J and Lee P: LEF1 targeting EMT in prostate cancer invasion is mediated by miR-181a. Am J Cancer Res. 5:1124–1132. 2015. | |
Hu W, Yan F, Ru Y, Xia M, Yan G, Zhang M, Wang H, Wu G, Yao L, Shen L, et al: MIIP inhibits EMT and cell invasion in prostate cancer through miR-181a/b-5p-KLF17 axis. Am J Cancer Res. 10:630–647. 2020.PubMed/NCBI | |
Mao W, Huang X, Wang L, Zhang Z, Liu M, Li Y, Luo M, Yao X, Fan J and Geng J: Circular RNA hsa_circ_0068871 regulates FGFR3 expression and activates STAT3 by targeting miR-181a-5p to promote bladder cancer progression. J Exp Clin Cancer Res. 38:1692019. View Article : Google Scholar : PubMed/NCBI | |
Lai Y, Zhao L, Hu J, Quan J, Chen P, Xu J, Guan X, Lai Y and Ni L: microRNA-181a-5p functions as an oncogene in renal cell carcinoma. Mol Med Rep. 17:8510–8517. 2018.PubMed/NCBI | |
Lei Z, Ma X, Li H, Zhang Y, Gao Y, Fan Y, Li X, Chen L, Xie Y, Chen J, et al: Up-regulation of miR-181a in clear cell renal cell carcinoma is associated with lower KLF6 expression, enhanced cell proliferation, accelerated cell cycle transition, and diminished apoptosis. Urol Oncol. 36:93.e23–93.e37. 2018. View Article : Google Scholar | |
Coca-Pelaz A, Shah JP, Hernandez-Prera JC, Ghossein RA, Rodrigo JP, Hartl DM, Olsen KD, Shaha AR, Zafereo M, Suarez C, et al: Papillary thyroid cancer-aggressive variants and impact on management: A narrative review. Adv Ther. 37:3112–3128. 2020. View Article : Google Scholar : | |
Wang Y, Ye H, Yang Y, Li J, Cen A and Zhao L: microRNA-181a promotes the oncogene S100A2 and enhances papillary thyroid carcinoma growth by mediating the expression of histone demethylase KDM5C. J Endocrinol Invest. 45:17–28. 2022. View Article : Google Scholar | |
Sun CX, Liu BJ, Su Y, Shi GW, Wang Y and Chi JF: MiR-181a promotes cell proliferation and migration through targeting KLF15 in papillary thyroid cancer. Clin Transl Oncol. 24:66–75. 2022. View Article : Google Scholar | |
Le F, Li HM, Lv QL, Chen JJ, Lin QX, Ji YL and Yi B: lncRNA ZNF674-AS1 inhibits the migration, invasion and epithelial-mesenchymal transition of thyroid cancer cells by modulating the miR-181a/SOCS4 axis. Mol Cell Endocrinol. 544:1115512022. View Article : Google Scholar : PubMed/NCBI | |
Gierlikowski W, Broniarek K, Cheda Ł, Rogulski Z and Kotlarek-Łysakowska M: MiR-181a-5p regulates NIS expression in papillary thyroid carcinoma. Int J Mol Sci. 22:60672021. View Article : Google Scholar : PubMed/NCBI | |
Ju R, Huang Y, Guo Z, Han L, Ji S, Zhao L and Long J: The circular RNAs differential expression profiles in the metastasis of salivary adenoid cystic carcinoma cells. Mol Cell Biochem. 476:1269–1282. 2021. View Article : Google Scholar | |
Nabhan M, Louka ML, Khairy E, Tash F, Ali-Labib R and El-Habashy S: MicroRNA-181a and its target Smad 7 as potential biomarkers for tracking child acute lymphoblastic leukemia. Gene. 628:253–258. 2017. View Article : Google Scholar : PubMed/NCBI | |
Liu X, Liao W, Peng H, Luo X, Luo Z, Jiang H and Xu L: miR-181a promotes G1/S transition and cell proliferation in pediatric acute myeloid leukemia by targeting ATM. J Cancer Res Clin Oncol. 142:77–87. 2016. View Article : Google Scholar | |
Lyu X, Li J, Yun X, Huang R, Deng X, Wang Y, Chen Y and Xiao G: miR-181a-5p, an inducer of Wnt-signaling, facilitates cell proliferation in acute lymphoblastic leukemia. Oncol Rep. 37:1469–1476. 2017. View Article : Google Scholar | |
Assmann JLJC, Leon LG, Stavast CJ, van den Bogaerdt SE, Schilperoord-Vermeulen J, Sandberg Y, Bellido M, Erkeland SJ, Feith DJ, Loughran TP Jr and Langerak AW: miR-181a is a novel player in the STAT3-mediated survival network of TCRαβ+ CD8+ T large granular lymphocyte leukemia. Leukemia. 36:983–993. 2022. View Article : Google Scholar | |
Fei J, Li Y, Zhu X and Luo X: miR-181a post-transcriptionally downregulates oncogenic RalA and contributes to growth inhibition and apoptosis in chronic myelogenous leukemia (CML). PLoS One. 7:e328342012. View Article : Google Scholar : PubMed/NCBI | |
Sun Y, Jiang T, Jia Y, Zou J, Wang X and Gu W: LncRNA MALAT1/miR-181a-5p affects the proliferation and adhesion of myeloma cells via regulation of Hippo-YAP signaling pathway. Cell Cycle. 18:2509–2523. 2019. View Article : Google Scholar : PubMed/NCBI | |
Chen L, Hu N, Wang C, Zhao H and Gu Y: Long non-coding RNA CCAT1 promotes multiple myeloma progression by acting as a molecular sponge of miR-181a-5p to modulate HOXA1 expression. Cell Cycle. 17:319–329. 2018. View Article : Google Scholar : | |
Martelli M, Ferreri AJ, Agostinelli C, Di Rocco A, Pfreundschuh M and Pileri SA: Diffuse large B-cell lymphoma. Crit Rev Oncol Hematol. 87:146–171. 2013. View Article : Google Scholar | |
Kozloski GA, Jiang X, Bhatt S, Ruiz J, Vega F, Shaknovich R, Melnick A and Lossos IS: miR-181a negatively regulates NF-κB signaling and affects activated B-cell-like diffuse large B-cell lymphoma pathogenesis. Blood. 127:2856–2866. 2016. View Article : Google Scholar : PubMed/NCBI | |
Bao Z, Wang Y, Wang Q, Fang S, Shan X, Wang J and Jiang T: Intratumor heterogeneity, microenvironment, and mechanisms of drug resistance in glioma recurrence and evolution. Front Med. 15:551–561. 2021. View Article : Google Scholar : PubMed/NCBI | |
Lei B, Huang Y, Zhou Z, Zhao Y, Thapa AJ, Li W, Cai W and Deng Y: Circular RNA hsa_circ_0076248 promotes oncogenesis of glioma by sponging miR-181a to modulate SIRT1 expression. J Cell Biochem. 120:6698–6708. 2019. View Article : Google Scholar | |
Hanif F, Muzaffar K, Perveen K, Malhi SM and Simjee SU: Glioblastoma multiforme: A review of its epidemiology and pathogenesis through clinical presentation and treatment. Asian Pac J Cancer Prev. 18:3–9. 2017.PubMed/NCBI | |
Rezaei T, Hejazi M, Mansoori B, Mohammadi A, Amini M, Mosafer J, Rezaei S, Mokhtarzadeh A and Baradaran B: microRNA-181a mediates the chemo-sensitivity of glioblastoma to carmustine and regulates cell proliferation, migration, and apoptosis. Eur J Pharmacol. 888:1734832020. View Article : Google Scholar : PubMed/NCBI | |
Huang SX, Zhao ZY, Weng GH, He XY, Wu CJ, Fu CY, Sui ZY, Ma YS and Liu T: Upregulation of miR-181a suppresses the formation of glioblastoma stem cells by targeting the Notch2 oncogene and correlates with good prognosis in patients with glioblastoma multiforme. Biochem Biophys Res Commun. 486:1129–1136. 2017. View Article : Google Scholar | |
Marisetty A, Wei J, Kong LY, Ott M, Fang D, Sabbagh A and Heimberger AB: MiR-181 family modulates osteopontin in glioblastoma multiforme. Cancers (Basel). 12:38132020. View Article : Google Scholar : PubMed/NCBI | |
Ma J, Yao Y, Wang P, Liu Y, Zhao L, Li Z, Li Z and Xue Y: MiR-181a regulates blood-tumor barrier permeability by targeting Krüppel-like factor 6. J Cereb Blood Flow Metab. 34:1826–1836. 2014. View Article : Google Scholar : PubMed/NCBI | |
Liao Y, Shen L, Zhao H, Liu Q, Fu J, Guo Y, Peng R and Cheng L: LncRNA CASC2 interacts with miR-181a to modulate glioma growth and resistance to TMZ through PTEN pathway. J Cell Biochem. 118:1889–1899. 2017. View Article : Google Scholar | |
Matthay KK, Maris JM, Schleiermacher G, Nakagawara A, Mackall CL, Diller L and Weiss WA: Neuroblastoma. Nat Rev Dis Primers. 2:160782016. View Article : Google Scholar | |
Liu X, Peng H, Liao W, Luo A, Cai M, He J, Zhang X, Luo Z, Jiang H and Xu L: MiR-181a/b induce the growth, invasion, and metastasis of neuroblastoma cells through targeting ABI1. Mol Carcinog. 57:1237–1250. 2018. View Article : Google Scholar | |
Orr BA: Pathology, diagnostics, and classification of medulloblastoma. Brain Pathol. 30:664–678. 2020. View Article : Google Scholar : PubMed/NCBI | |
Zhu LY, Wu XY, Liu XD, Zheng DF, Li HS, Yang B, Zhang J and Chang Q: Aggressive medulloblastoma-derived exosomal miRNAs promote in vitro invasion and migration of tumor cells via Ras/MAPK pathway. J Neuropathol Exp Neurol. 79:734–745. 2020. View Article : Google Scholar : PubMed/NCBI | |
Wang Z, Wang X, Zhou H, Dan X, Jiang L and Wu Y: Long non-coding RNA CASC2 inhibits tumorigenesis via the miR-181a/PLXNC1 axis in melanoma. Acta Biochim Biophys Sin (Shanghai). 50:263–272. 2018. View Article : Google Scholar : PubMed/NCBI | |
Zhang S, Wan H and Zhang X: LncRNA LHFPL3-AS1 contributes to tumorigenesis of melanoma stem cells via the miR-181a-5p/BCL2 pathway. Cell Death Dis. 11:9502020. View Article : Google Scholar : PubMed/NCBI | |
Waldman A and Schmults C: Cutaneous squamous cell carcinoma. Hematol Oncol Clin North Am. 33:1–12. 2019. View Article : Google Scholar | |
Chitsazzadeh V, Nguyen TN, de Mingo Pulido A, Bittencourt BB, Du L, Adelmann CH, Ortiz Rivera I, Nguyen KA, Guerra LD, Davis A, et al: miR-181a promotes multiple protumorigenic functions by targeting TGFβR3. J Invest Dermatol. 142:1956–1965.e2. 2022. View Article : Google Scholar | |
Neu J, Dziunycz PJ, Dzung A, Lefort K, Falke M, Denzler R, Freiberger SN, Iotzova-Weiss G, Kuzmanov A, Levesque MP, et al: miR-181a decelerates proliferation in cutaneous squamous cell carcinoma by targeting the proto-oncogene KRAS. PLoS One. 12:e01850282017. View Article : Google Scholar : PubMed/NCBI | |
Mirabello L, Troisi RJ and Savage SA: Osteosarcoma incidence and survival rates from 1973 to 2004: Data from the surveillance, epidemiology, and end results program. Cancer. 115:1531–1543. 2009. View Article : Google Scholar : PubMed/NCBI | |
Ba Z, Gu L, Hao S, Wang X, Cheng Z and Nie G: Downregulation of lncRNA CASC2 facilitates osteosarcoma growth and invasion through miR-181a. Cell Prolif. 51:e124092018. View Article : Google Scholar | |
Zhao A, Liu W, Cui X, Wang N, Wang Y, Sun L, Xue H, Wu L, Cui S, Yang Y and Bai R: lncRNA TUSC7 inhibits osteosarcoma progression through the miR-181a/RASSF6 axis. Int J Mol Med. 47:583–594. 2021. View Article : Google Scholar : | |
Mutlu S, Mutlu H, Kirkbes S, Eroglu S, Kabukcuoglu YS, Kabukcuoglu F, Duymus TM, ISık M and Ulasli M: The expression of miR-181a-5p and miR-371b-5p in chondrosarcoma. Eur Rev Med Pharmacol Sci. 19:2384–2388. 2015.PubMed/NCBI | |
Sun X, Charbonneau C, Wei L, Chen Q and Terek RM: miR-181a targets RGS16 to promote chondrosarcoma growth, angiogenesis, and metastasis. Mol Cancer Res. 13:1347–1357. 2015. View Article : Google Scholar : | |
Ho PTB, Clark IM and Le LTT: MicroRNA-based diagnosis and therapy. Int J Mol Sci. 23:71672022. View Article : Google Scholar : PubMed/NCBI | |
Guo LJ and Zhang QY: Decreased serum miR-181a is a potential new tool for breast cancer screening. Int J Mol Med. 30:680–686. 2012. View Article : Google Scholar : PubMed/NCBI | |
Zhang H, Zhu M, Shan X, Zhou X, Wang T, Zhang J, Tao J, Cheng W, Chen G, Li J, et al: A panel of seven-miRNA signature in plasma as potential biomarker for colorectal cancer diagnosis. Gene. 687:246–254. 2019. View Article : Google Scholar | |
Lin Z, Chen Y, Lin Y, Lin H, Li H, Su X, Fang Z, Wang J, Wei Q, Teng J and Zhang Z: Potential miRNA biomarkers for the diagnosis and prognosis of esophageal cancer detected by a novel absolute quantitative RT-qPCR method. Sci Rep. 10:200652020. View Article : Google Scholar : | |
He S, Zeng S, Zhou ZW, He ZX and Zhou SF: Hsa-microRNA-181a is a regulator of a number of cancer genes and a biomarker for endometrial carcinoma in patients: A bioinformatic and clinical study and the therapeutic implication. Drug Des Devel Ther. 9:1103–1175. 2015.PubMed/NCBI | |
Shan X, Zhang H, Zhang L, Zhou X, Wang T, Zhang J, Shu Y, Zhu W, Wen W and Liu P: Identification of four plasma microRNAs as potential biomarkers in the diagnosis of male lung squamous cell carcinoma patients in China. Cancer Med. 7:2370–2381. 2018. View Article : Google Scholar : | |
Nishimura J, Handa R, Yamamoto H, Tanaka F, Shibata K, Mimori K, Takemasa I, Mizushima T, Ikeda M, Sekimoto M, et al: microRNA-181a is associated with poor prognosis of colorectal cancer. Oncol Rep. 28:2221–2226. 2012. View Article : Google Scholar | |
Panoutsopoulou K, Avgeris M, Magkou P, Mavridis K, Dreyer T, Dorn J, Obermayr E, Reinthaller A, Michaelidou K, Mahner S, et al: miR-181a overexpression predicts the poor treatment response and early-progression of serous ovarian cancer patients. Int J Cancer. 147:3560–3573. 2020. View Article : Google Scholar : PubMed/NCBI | |
Papadimitriou MA, Papanota AM, Adamopoulos PG, Pilala KM, Liacos CI, Malandrakis P, Mavrianou-Koutsoukou N, Patseas D, Eleutherakis-Papaiakovou E, Gavriatopoulou M, et al miRNA-seq and clinical evaluation in multiple myeloma: miR-181a overexpression predicts short-term disease progression and poor post-treatment outcome. Br J Cancer. 126:79–90. 2022. View Article : Google Scholar | |
Meijer LL, Garajová I, Caparello C, Le Large TYS, Frampton AE, Vasile E, Funel N, Kazemier G and Giovannetti E: Plasma miR-181a-5p downregulation predicts response and improved survival after FOLFIRINOX in pancreatic ductal adenocarcinoma. Ann Surg. 271:1137–1147. 2020. View Article : Google Scholar | |
Egyed B, Kutszegi N, Sági JC, Gézsi A, Rzepiel A, Visnovitz T, Lőrincz P, Müller J, Zombori M, Szalai C, et al: MicroRNA-181a as novel liquid biopsy marker of central nervous system involvement in pediatric acute lymphoblastic leukemia. J Transl Med. 18:2502020. View Article : Google Scholar : | |
Xue WX, Zhang MY, Rui Li, Liu X, Yin YH and Qu YQ: Serum miR-1228-3p and miR-181a-5p as noninvasive biomarkers for non-small cell lung cancer diagnosis and prognosis. Biomed Res Int. 2020:96018762020. View Article : Google Scholar : PubMed/NCBI | |
Gao W, Yu Y, Cao H, Shen H, Li X, Pan S and Shu Y: Deregulated expression of miR-21, miR-143 and miR-181a in non small cell lung cancer is related to clinicopathologic characteristics or patient prognosis. Biomed Pharmacother. 64:399–408. 2010. View Article : Google Scholar | |
Schwind S, Maharry K, Radmacher MD, Mrózek K, Holland KB, Margeson D, Whitman SP, Hickey C, Becker H, Metzeler KH, et al: Prognostic significance of expression of a single microRNA, miR-181a, in cytogenetically normal acute myeloid leukemia: A cancer and leukemia group B study. J Clin Oncol. 28:5257–5264. 2010. View Article : Google Scholar : PubMed/NCBI | |
Wang Y, Fang YX, Dong B, Du X, Wang J, Wang X, Gao WQ and Xue W: Discovery of extracellular vesicles derived miR-181a-5p in patient's serum as an indicator for bone-metastatic prostate cancer. Theranostics. 11:878–892. 2021. View Article : Google Scholar : PubMed/NCBI | |
Bjørnetrø T, Redalen KR, Meltzer S, Thusyanthan NS, Samiappan R, Jegerschöld C, Handeland KR and Ree AH: An experimental strategy unveiling exosomal microRNAs 486-5p, 181a-5p and 30d-5p from hypoxic tumour cells as circulating indicators of high-risk rectal cancer. J Extracell Vesicles. 8:15672192019. View Article : Google Scholar : PubMed/NCBI | |
Leonetti A, Capula M, Minari R, Mazzaschi G, Gregori A, El Hassouni B, Papini F, Bordi P, Verzè M, Avan A, et al: Dynamic evaluation of circulating miRNA profile in EGFR-mutated NSCLC patients treated with EGFR-TKIs. Cells. 10:15202021. View Article : Google Scholar : | |
Pichler M, Winter E, Ress AL, Bauernhofer T, Gerger A, Kiesslich T, Lax S, Samonigg H and Hoefler G: miR-181a is associated with poor clinical outcome in patients with colorectal cancer treated with EGFR inhibitor. J Clin Pathol. 67:198–203. 2014. View Article : Google Scholar | |
Robak P, Dróżdż I, Jarych D, Mikulski D, Węgłowska E, Siemieniuk-Ryś M, Misiewicz M, Stawiski K, Fendler W, Szemraj J, et al: The value of serum MicroRNA expression signature in predicting refractoriness to bortezomib-based therapy in multiple myeloma patients. Cancers (Basel). 12:25692020. View Article : Google Scholar : PubMed/NCBI | |
Nishida N, Arizumi T, Hagiwara S, Ida H, Sakurai T and Kudo M: MicroRNAs for the prediction of early response to sorafenib treatment in human hepatocellular carcinoma. Liver Cancer. 6:113–125. 2017. View Article : Google Scholar : PubMed/NCBI | |
Seipel K, Messerli C, Wiedemann G, Bacher U and Pabst T: MN1, FOXP1 and hsa-miR-181a-5p as prognostic markers in acute myeloid leukemia patients treated with intensive induction chemotherapy and autologous stem cell transplantation. Leuk Res. 89:1062962020. View Article : Google Scholar | |
Danza K, Silvestris N, Simone G, Signorile M, Saragoni L, Brunetti O, Monti M, Mazzotta A, De Summa S, Mangia A and Tommasi S: Role of miR-27a, miR-181a and miR-20b in gastric cancer hypoxia-induced chemoresistance. Cancer Biol Ther. 17:400–406. 2016. View Article : Google Scholar : PubMed/NCBI | |
Petrillo M, Zannoni GF, Beltrame L, Martinelli E, DiFeo A, Paracchini L, Craparotta I, Mannarino L, Vizzielli G, Scambia G, et al: Identification of high-grade serous ovarian cancer miRNA species associated with survival and drug response in patients receiving neoadjuvant chemotherapy: A retrospective longitudinal analysis using matched tumor biopsies. Ann Oncol. 27:625–634. 2016. View Article : Google Scholar : PubMed/NCBI | |
Shi L, Zhu W, Huang Y, Zhuo L, Wang S, Chen S, Zhang B and Ke B: Cancer-associated fibroblast-derived exosomal microRNA-20a suppresses the PTEN/PI3K-AKT pathway to promote the progression and chemoresistance of non-small cell lung cancer. Clin Transl Med. 12:e9892022. View Article : Google Scholar : PubMed/NCBI | |
Novoa Díaz MB, Martín MJ and Gentili C: Tumor microenvironment involvement in colorectal cancer progression via Wnt/β-catenin pathway: Providing understanding of the complex mechanisms of chemoresistance. World J Gastroenterol. 28:3027–3046. 2022. View Article : Google Scholar | |
Kousar K, Ahmad T, Abduh MS, Kanwal B, Shah SS, Naseer F and Anjum S: miRNAs in regulation of tumor microenvironment, chemotherapy resistance, immunotherapy modulation and miRNA therapeutics in cancer. Int J Mol Sci. 23:138222022. View Article : Google Scholar : PubMed/NCBI | |
Shah MY, Ferrajoli A, Sood AK, Lopez-Berestein G and Calin GA: microRNA therapeutics in cancer-an emerging concept. EBioMedicine. 12:34–42. 2016. View Article : Google Scholar : PubMed/NCBI | |
Zhang C, Xu C, Gao X and Yao Q: Platinum-based drugs for cancer therapy and anti-tumor strategies. Theranostics. 12:2115–2132. 2022. View Article : Google Scholar | |
Zhao X, Wang J, Zhu R, Zhang J and Zhang Y: DLX6-AS1 activated by H3K4me1 enhanced secondary cisplatin resistance of lung squamous cell carcinoma through modulating miR-181a-5p/miR-382-5p/CELF1 axis. Sci Rep. 11:210142021. View Article : Google Scholar : | |
Sun J: VDR/vitamin D receptor regulates autophagic activity through ATG16L1. Autophagy. 12:1057–1058. 2016. View Article : Google Scholar | |
Lin J, Chen X, Sun M, Qu X, Wang Y, Li C, Li X, Zhao L, Su Z and Ye H: Upregulation of microRNA-181a-5p increases the sensitivity of HS578T breast cancer cells to cisplatin by inducing vitamin D receptor-mediated cell autophagy. Oncol Lett. 21:2472021. View Article : Google Scholar : PubMed/NCBI | |
Galluzzi L, Morselli E, Vitale I, Kepp O, Senovilla L, Criollo A, Servant N, Paccard C, Hupé P, Robert T, et al: miR-181a and miR-630 regulate cisplatin-induced cancer cell death. Cancer Res. 70:1793–1803. 2010. View Article : Google Scholar : PubMed/NCBI | |
Hu X, Lou T, Yuan C, Wang Y, Tu X, Wang Y and Zhang T: Effects of lncRNA ANRIL-knockdown on the proliferation, apoptosis and cell cycle of gastric cancer cells. Oncol Lett. 22:6212021. View Article : Google Scholar : PubMed/NCBI | |
Wu J, Ma C, Tang X, Shi Y, Liu Z, Chai X, Tang Q, Li L and Hann SS: The regulation and interaction of PVT1 and miR181a-5p contributes to the repression of SP1 expression by the combination of XJD decoction and cisplatin in human lung cancer cells. Biomed Pharmacother. 121:1096322020. View Article : Google Scholar | |
Bai H, Cao Z, Deng C, Zhou L and Wang C: miR-181a sensitizes resistant leukaemia HL-60/Ara-C cells to Ara-C by inducing apoptosis. J Cancer Res Clin Oncol. 138:595–602. 2012. View Article : Google Scholar | |
Ping W, Gao Y, Fan X, Li W, Deng Y and Fu X: MiR-181a contributes gefitinib resistance in non-small cell lung cancer cells by targeting GAS7. Biochem Biophys Res Commun. 495:2482–2489. 2018. View Article : Google Scholar | |
Barbato A, Iuliano A, Volpe M, D'Alterio R, Brillante S, Massa F, De Cegli R, Carrella S, Salati M, Russo A, et al: Integrated genomics identifies miR-181/TFAM pathway as a critical driver of drug resistance in melanoma. Int J Mol Sci. 22:18012021. View Article : Google Scholar : PubMed/NCBI | |
Tabatabaei SN, Derbali RM, Yang C, Superstein R, Hamel P, Chain JL and Hardy P: Co-delivery of miR-181a and melphalan by lipid nanoparticles for treatment of seeded retinoblastoma. J Control Release. 298:177–185. 2019. View Article : Google Scholar : PubMed/NCBI |